Objective: Huntington’s disease (HD) is characterized by motor, cognitive, and neuropsychiatric symptoms. Oculomotor impairments and gait variability have been independently considered as potential markers in HD. However, an integrated analysis of eye movement and gait is lacking. We performed multiple examinations of eye movement and gait variability in HTT mutation carriers, analyzed the consistency between these parameters and clinical severity, and then examined the associations between oculomotor impairments and gait deficits. Methods: We included 7 patients with pre-HD, 30 patients with HD and 30 age-matched controls. We collected demographic data and assessed the Unified Huntington’s Disease Rating Scale (UHDRS) score. Examinations, including saccades, smooth pursuit tests, and optokinetic (OPK) tests, were performed to evaluate eye movement function. The parameters of gait include stride length, walking velocity, step deviation, step length, and gait phase. Results: HD patients have significant impairments in the latency and velocity of saccades, the gain of smooth pursuit, and the gain and slow phase velocities of OPK tests. Only the speed of saccades significantly differed between pre-HD patients and controls. There are significant impairments in stride length, walking velocity, step length, and gait phase in HD patients. The parameters of eye movement and gait variability in HD patients were consistent with the UHDRS scores. There were significant correlations between eye movement and gait parameters. Conclusion Our results show that eye movement and gait are impaired in HD patients and that the speed of saccades is impaired early in pre-HD. Eye movement and gait abnormalities in HD patients are significantly correlated with clinical disease severity.

Objective: Huntington’s disease (HD) is characterized by motor, cognitive, and neuropsychiatric symptoms. Oculomotor impairments and gait variability have been independently considered as potential markers in HD. However, an integrated analysis of eye movement and gait is lacking. We performed multiple examinations of eye movement and gait variability in HTT mutation carriers, analyzed the consistency between these parameters and clinical severity, and then examined the associations between oculomotor impairments and gait deficits. Methods: We included 7 patients with pre-HD, 30 patients with HD and 30 age-matched controls. We collected demographic data and assessed the Unified Huntington’s Disease Rating Scale (UHDRS) score. Examinations, including saccades, smooth pursuit tests, and optokinetic (OPK) tests, were performed to evaluate eye movement function. The parameters of gait include stride length, walking velocity, step deviation, step length, and gait phase. Results: HD patients have significant impairments in the latency and velocity of saccades, the gain of smooth pursuit, and the gain and slow phase velocities of OPK tests. Only the speed of saccades significantly differed between pre-HD patients and controls. There are significant impairments in stride length, walking velocity, step length, and gait phase in HD patients. The parameters of eye movement and gait variability in HD patients were consistent with the UHDRS scores. There were significant correlations between eye movement and gait parameters. Conclusion Our results show that eye movement and gait are impaired in HD patients and that the speed of saccades is impaired early in pre-HD. Eye movement and gait abnormalities in HD patients are significantly correlated with clinical disease severity.

This study aims to systematically characterize the targeted effects of Quanduzhong Capsules on cartilage lesions in knee osteoarthritis by integrating spatial transcriptomics data mining and animal experiments validation, thereby elucidating the related molecular mechanisms. A knee osteoarthritis model was established using Sprague-Dawley(SD) rats, via a modified Hulth method. Hematoxylin and eosin(HE) staining was employed to detect knee osteoarthritis-associated pathological changes in knee cartilage. Candidate targets of Quanduzhong Capsules were collected from the HIT 2.0 database, followed by bioinformatics analysis of spatial transcriptomics datasets(GSE254844) from cartilage tissues in clinical knee osteoarthritis patients to identify spatially specific disease genes. Furthermore, a "formula candidate targets-spatially specific genes in cartilage lesions" interaction network was constructed to explore the effects and major mechanisms of Quanduzhong Capsules in distinct cartilage regions. Experimental validation was conducted through immunohistochemistry using animal-derived biospecimens. The results indicated that Quanduzhong Capsules effectively inhibited the degenerative changes in the cartilage of affected joints in rats, which was associated with the regulation of Quanduzhong Capsules on the thioredoxin-interacting protein(TXNIP)-NOD-like receptor family pyrin domain containing 3(NLRP3)-bone morphogenetic protein receptor type 2(BMPR2)-fibronectin 1(FN1)-matrix metallopeptidase 2(MMP2) signal axis in the articular cartilage surface and superficial zones, subsequently inhibiting cartilage matrix degradation leading to oxidative stress and inflammatory diffusion. In summary, this study clarifies the spatially specific targeted effects and protective mechanisms of Quanduzhong Capsules within pathological cartilage regions in knee osteoarthritis, providing theoretical and experimental support for the clinical application of this drug in the targeted therapy on the inflamed cartilage.
Animals ; Osteoarthritis, Knee/metabolism* ; Drugs, Chinese Herbal/administration & dosage* ; Rats, Sprague-Dawley ; Rats ; Male ; Humans ; Capsules ; Female ; Disease Models, Animal

To explore the variation laws of volatile oil during the extraction process of Artemisiae Argyi Folium and its impact on the quality of the medicinal solution, as well as to achieve precise control of the extraction process, this study employed headspace solid phase microextraction gas chromatography-mass spectrometry(HS-SPME-GC-MS) in combination with multiple light scattering techniques to conduct a comprehensive analysis, identification, and characterization of the changes in volatile components and the physical properties of the medicinal solution during the extraction process. A total of 82 volatile compounds were identified using the HS-SPME-GC-MS technique, including 21 alcohols, 15 alkenes, 14 ketones, 9 acids, 6 aldehydes, 5 phenols, 3 esters, and 9 other types of compounds. At different extraction time points(15, 30, 45, and 60 min), 71, 72, 64, and 44 compounds were identified in the medicinal solution, respectively. It was observed that the content of volatile components gradually decreased with the extension of extraction time. Through multivariate statistical analysis, four compounds with significant differences during different extraction time intervals were identified, namely 1,8-cineole, terpinen-4-ol, 3-octanone, and camphor. RESULTS:: from multiple light scattering techniques indicated that at 15 minutes of extraction, the transmittance of the medicinal solution was the lowest(25%), the particle size was the largest(0.325-0.350 nm), and the stability index(turbiscan stability index, TSI) was the highest(0-2.5). With the extension of extraction time, the light transmittance of the medicinal solution improved, stability was enhanced, and the particle size decreased. These laws of physicochemical property changes provide important basis for the control of Artemisiae Argyi Folium extraction process. In addition, the changes in the bioactivity of Artemisiae Argyi Folium extracts during the extraction process were investigated through mouse writhing tests and antimicrobial assays. The results indicated that the analgesic and antimicrobial effects of the medicinal solution were strongest at the 15-minute extracting point. In summary, the findings of this study demonstrate that the content of volatile oil in Artemisiae Argyi Folium extracts gradually decreases with the extension of extraction time, and the variation in volatile oil content directly influences the physicochemical properties and pharmacological efficacy of the medicinal solution. This discovery provides important scientific reference for the optimization of Artemisiae Argyi Folium extraction processes and the development and application of process analytical technologies.
Oils, Volatile/pharmacology* ; Artemisia/chemistry* ; Gas Chromatography-Mass Spectrometry ; Drugs, Chinese Herbal/pharmacology* ; Chlorogenic Acid/pharmacology* ; Solid Phase Microextraction ; Quality Control

The medicinal materials of Bawei Chenxiang Pills(BCPs) were extracted via three methods: reflux extraction by water, reflux extraction by 70% ethanol, and extraction by pure water following reflux extraction by 70% ethanol, yielding three extracts of ST, CT, and CST. The efficacy of ST(760 mg·kg~(-1)), CT(620 mg·kg~(-1)), and CST(1 040 mg·kg~(-1)) were evaluated by acute myocardial ischemia(AMI) and p-chlorophenylalanine(PCPA)-induced insomnia in mice, respectively. Western blot was further utilized to investigate their hypnosis mechanisms. The main chemical components of different extracts were identified by the UPLC-Q-Exactive-MS technique. The results showed that CT and CST significantly increased the ejection fraction(EF) and fractional shortening(FS) of myocardial infarction mice, reduced left ventricular internal dimension at end-diastole(LVIDd) and left ventricular internal dimension at end-systole(LVIDs). In contrast, ST did not exhibit significant effects on these parameters. In the insomnia model, CT significantly reduced sleep latency and prolonged sleep duration, whereas ST only prolonged sleep duration without shortening sleep latency. CST showed no significant effects on either sleep latency or sleep duration. Additionally, both CT and ST upregulated glutamic acid decarboxylase 67(GAD67) protein expression in brain tissue. A total of 15 main chemical components were identified from CT, including 2-(2-phenylethyl) chromone and 6-methoxy-2-(2-phenylethyl) chromone. Six chemical components including chebulidic acid were identified from ST. The results suggested that chromones and terpenes were potential anti-myocardial ischemia drugs of BCPs, and tannin and phenolic acids were potential hypnosis drugs. This study enriches the pharmacological and chemical research of BCPs, providing a basis and reference for their secondary development, quality standard improvement, and clinical application.
Animals ; Drugs, Chinese Herbal/isolation & purification* ; Mice ; Male ; Sleep Initiation and Maintenance Disorders/physiopathology* ; Humans ; Myocardial Infarction/drug therapy* ; Myocardial Ischemia/drug therapy*

Microbial detection and control of traditional Chinese medicine(TCM) decoction pieces are crucial for the quality control of TCM preparations. It is also a key area of research in the measurement technology and equipment development for TCM manufacturing. Guided by TCM manufacturing measurement methodologies, this study presented a design of a novel portable microbial detection device, using Atractylodis Macrocephalae Rhizoma decoction pieces as a demonstration. Immunomagnetic separation technology was employed for specific isolation and labeling of target microorganisms. Enzymatic signal amplification was utilized to convert weak biological signals into colorimetric signals, constructing an optical biosensor. A self-developed smartphone APP was further applied to analyze the colorimetric signals and quantify target concentrations. A portable and automated detection system based on Arduino microcontroller was developed to automatically perform target microbial separation/extraction, as well as mimetic enzyme labeling and catalytic reactions. The developed equipment specifically focuses on the rapid and quantitative microbial analysis of TCM active pharmaceutical ingredients, intermediates in TCM manufacturing, and final TCM products. Experimental results demonstrate that the equipment could detect Salmonella in samples within 2 h, with a detection limit as low as 5.1 × 10~3 CFU·mL~(-1). The equipment enables the rapid detection of microorganisms in TCM decoction pieces, providing a potential technical solution for on-site rapid screening of microbial contamination indicators in TCM. It has broad application prospects in measurement technology for TCM manufacturing and offers strong technical support for the modernization, industrialization, and intelligent development of TCM.
Drugs, Chinese Herbal/analysis* ; Atractylodes/microbiology* ; Rhizome/microbiology* ; Biosensing Techniques/methods* ; Medicine, Chinese Traditional ; Colorimetry/instrumentation* ; Quality Control

Investigating the correlation between micronucleus formation and male infertility has the potential to improve clinical diagnosis and deepen our understanding of pathological progression. Our study enrolled 2252 male patients whose semen was analyzed from March 2023 to July 2023. Their clinical data, including semen parameters and age, were also collected. Genetic analysis was used to determine whether the sex chromosome involved in male infertility was abnormal (including the increase, deletion, and translocation of the X and Y chromosomes), and subsequent semen analysis was conducted for clinical grouping purposes. The participants were categorized into five groups: normozoospermia, asthenozoospermia, oligozoospermia, oligoasthenozoospermia, and azoospermia. Patients were randomly selected for further study; 41 patients with normozoospermia were included in the control group and 117 patients with non-normozoospermia were included in the study group according to the proportions of all enrolled patients. Cytokinesis-block micronucleus (CBMN) screening was conducted through peripheral blood. Statistical analysis was used to determine the differences in micronuclei (MNi) among the groups and the relationships between MNi and clinical data. There was a significant increase in MNi in infertile men, including those with azoospermia, compared with normozoospermic patients, but there was no significant difference between the genetic and nongenetic groups in azoospermic men. The presence of MNi was associated with sperm concentration, progressive sperm motility, immotile spermatozoa, malformed spermatozoa, total sperm count, and total sperm motility. This study underscores the potential utility of MNi as a diagnostic tool and highlights the need for further research to elucidate the underlying mechanisms of male infertility.
Humans ; Male ; Infertility, Male/genetics* ; Adult ; Micronucleus Tests ; Semen Analysis ; Oligospermia/genetics* ; Azoospermia/genetics* ; Chromosome Aberrations ; Sperm Count ; Micronuclei, Chromosome-Defective ; Middle Aged

OBJECTIVES: To investigate the clinical characteristics and prognosis of infants and young children with basal ganglia infarction after minor head trauma (BGIMHT). METHODS: A retrospective analysis was conducted on the clinical data and follow-up results of children aged 28 days to 3 years with BGIMHT who were hospitalized at Children's Hospital of Soochow University from January 2011 to January 2022. RESULTS: A total of 45 cases of BGIMHT were included, with the most common symptom being limb movement disorders (96%, 43/45), followed by facioplegia (56%, 25/45). Cerebral imaging showed that 72% (31/43) had infarction accompanied by basal ganglia calcification. After conservative treatment, 42 children (93%) showed significant symptom improvement, while 3 children (7%) experienced recurrent strokes. The median follow-up time was 82 months (range: 17-141 months). At the last follow-up, 97% (29/30) had residual basal ganglia softening lesions. Among 29 cases participating in questionnaire follow-up, 66% (19/29) recovered normally, 17% (5/29) showed significant improvement in symptoms, and 17% (5/29) had poor improvement. According to the grading of the Global Burden of Disease Control Projects, only 1 child (3%) had severe sequelae. There were no significant differences in age at onset, gender, or presence of concomitant basal ganglia calcification between children with and without neurological sequelae (P>0.05). CONCLUSIONS The most common initial symptom of BGIMHT is limb movement disorder, and imaging results indicate that most children have concurrent intracranial calcifications. Most infarct lesions later transform into softening lesions, resulting in a generally good prognosis.
Humans ; Male ; Female ; Infant ; Child, Preschool ; Craniocerebral Trauma/complications* ; Follow-Up Studies ; Retrospective Studies ; Basal Ganglia/pathology* ; Infant, Newborn

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To investigate the relationship between the polygenic risks for various psychiatric disorders and clinical and neuropsychological characteristics in children with attention-deficit/hyperactivity disorder (ADHD). METHODS: Using a cross-sectional design, 285 children with ADHD and 107 healthy controls were assessed using the Child Behavior Checklist, the Behavior Rating Inventory of Executive Function for parents, the Wechsler Intelligence Scale for Children, Fourth Edition, and the Cambridge Neuropsychological Test Automated Battery. Blood samples were collected for genetic data. Polygenic risk scores (PRSs) for various psychiatric disorders were calculated using the PRSice-2 software. RESULTS: Compared with the healthy controls, the children with ADHD displayed significantly higher PRSs for ADHD, major depressive disorder, anxiety disorder, and obsessive-compulsive disorder (P<0.05). In terms of daily-life executive function, ADHD-related PRS was significantly correlated with the working memory factor; panic disorder-related PRS was significantly correlated with the initiation factor; bipolar disorder-related PRS was significantly correlated with the shift factor; schizophrenia-related PRS was significantly correlated with the inhibition, emotional control, initiation, working memory, planning, organization, and monitoring factors (P<0.05). The PRS related to anxiety disorders was negatively correlated with total IQ and processing speed index (P<0.05). The PRS related to obsessive-compulsive disorder was negatively correlated with the processing speed index and positively correlated with the stop-signal reaction time index of the stop-signal task (P<0.05). CONCLUSIONS PRSs for various psychiatric disorders are closely correlated with the behavioral and cognitive characteristics in children with ADHD, which provides more insights into the heterogeneity of ADHD.
Humans ; Attention Deficit Disorder with Hyperactivity/genetics* ; Child ; Male ; Female ; Cross-Sectional Studies ; Neuropsychological Tests ; Multifactorial Inheritance ; Adolescent ; Mental Disorders/etiology* ; Executive Function ; Genetic Risk Score