Despite of the widespread use of hydrogen and methane breath test, the variability in testing protocols, gas measurement techniques, and interpretation criteria continues to challenge the reproducibility and comparability across centers, especially in the Asia-Pacific region. The Asian Neurogastroenterology and Motility Association hence presents the first Asian monograph guiding application and interpretation of breath test. The monograph was formulated according to the framework of indications, preparatory process, performance, and interpretation of results, as well as future direction for research.

Objective This study reports on the obligatory parasitism of water mites Arrenurus sp. on Anopheles messeae at the Manzhouli Port, Inner Mongolia, China. Methods Duing July 2024, a survey on the mosquito diversity was conducted at the Manzhouli Port. Captured mosquitoes and their ectoparasites were identified to species level. Results A total of 1840 adult mosquitoes were collected, representing species from three genera: Culex(Cx. modestus, Cx. pipiens pallens), Aedes(Ae. dorsalis, Ae. flavidorsalis, Ae. flavescens), and Anopheles (An. messeae). Among all the mosqutioes specimens,3 out of 150 captured An. messeae were found to carry ectoparasitic mites, with number of 2,4,27 mites separately. Morphological and molecular identification reached the same result as water mites(Hydrachnidiae, Hydracrina). COI gene sequence showed 94% similarity with the closest species Arrenurus truncatellus. Conlusions Literature review suggests water mites are host-specific parasitism of mosquito species and herein with the first record of Arrenurus sp. parasiting on An. Messeae in the most high-latitude region globally.

OBJECTIVE: To investigate the effectiveness of Xuanshen Yishen Decoction (XYD) in the treatment of hypertension. METHODS: Hospital electronic medical records from 2019-2023 were utilized to emulate a randomized pragmatic clinical trial. Hypertensive participants were eligible if they were aged ⩾40 years with baseline systolic blood pressure (BP) ⩾140 mm Hg. Patients treated with XYD plus antihypertensive regimen were assigned to the treatment group, whereas those who followed only antihypertensive regimen were assigned to the control group. The primary outcome assessed was the attainment rate of intensive BP control at discharge, with the secondary outcome focusing on the 6-month all-cause readmission rate. RESULTS: The study included 3,302 patients, comprising 2,943 individuals in the control group and 359 in the treatment group. Compared with the control group, a higher proportion in the treatment group achieved the target BP for intensive BP control [8.09% vs. 17.5%; odds ratio (OR)=2.29, 95% confidence interval (CI)=1.68 to 3.13; P<0.001], particularly in individuals with high homocysteine levels (OR=3.13; 95% CI=1.72 to 5.71; P<0.001; P for interaction=0.041). Furthermore, the 6-month all-cause readmission rate in the treatment group was lower than in the control group (hazard ratio=0.58; 95% CI=0.36 to 0.91; P=0.019), and the robustness of the results was confirmed by sensitivity analyse. CONCLUSIONS XYD could be a complementary therapy for intensive BP control. Our study offers real-world evidence and guides the choice of complementary and alternative therapies. (Registration No. ChiCTR2400086589).
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Antihypertensive Agents/pharmacology* ; Blood Pressure/drug effects* ; Drugs, Chinese Herbal/pharmacology* ; Hypertension/physiopathology* ; Patient Readmission ; Treatment Outcome

Mycophenolic acid (MPA), the active moiety of both mycophenolate mofetil (MMF) and enteric-coated mycophenolate sodium (EC-MPS), serves as a primary immunosuppressant for maintaining solid organ transplants. Therapeutic drug monitoring (TDM) enhances treatment outcomes through tailored approaches. This study aimed to develop an evidence-based guideline for MPA TDM, facilitating its rational application in clinical settings. The guideline plan was drawn from the Institute of Medicine and World Health Organization (WHO) guidelines. Using the Delphi method, clinical questions and outcome indicators were generated. Systematic reviews, Grading of Recommendations Assessment, Development, and Evaluation (GRADE) evidence quality evaluations, expert opinions, and patient values guided evidence-based suggestions for the guideline. External reviews further refined the recommendations. The guideline for the TDM of MPA (IPGRP-2020CN099) consists of four sections and 16 recommendations encompassing target populations, monitoring strategies, dosage regimens, and influencing factors. High-risk populations, timing of TDM, area under the curve (AUC) versus trough concentration (C₀), target concentration ranges, monitoring frequency, and analytical methods are addressed. Formulation-specific recommendations, initial dosage regimens, populations with unique considerations, pharmacokinetic-informed dosing, body weight factors, pharmacogenetics, and drug‍-‍drug interactions are covered. The evidence-based guideline offers a comprehensive recommendation for solid organ transplant recipients undergoing MPA therapy, promoting standardization of MPA TDM, and enhancing treatment efficacy and safety.
Mycophenolic Acid/administration & dosage* ; Drug Monitoring/methods* ; Humans ; Organ Transplantation ; Immunosuppressive Agents/administration & dosage* ; Delphi Technique

Ischemic stroke (IS) is a globally life-threatening disease. Presently, few therapeutic medicines are available for treating IS, and rt-PA is the only drug approved by the US Food and Drug Administration (FDA) in the US. In fact, many agents showing excellent neuroprotection but no blood flow-improving activity in animals have not achieved ideal clinical efficacy, while thrombolytic drugs only improving blood flow without neuroprotection have limited their wider application. To address these challenges and meet the huge unmet clinical need, we have designed and identified a novel compound AAPB with dual effects of neuroprotection and cerebral blood flow improvement. AAPB significantly reduced cerebral infarction and neural function deficit in tMCAO rats, pMCAO rats, and IS rhesus monkeys, as well as displayed exceptional safety profiles and excellent pharmacokinetic properties in rats and dogs. AAPB has now entered phase I of clinical trials fighting IS in China.

Neuropathic pain, a debilitating condition caused by dysfunction of the somatosensory nervous system, remains difficult to treat due to limited understanding of its molecular mechanisms. Bioinformatics analysis identified cerebellin 2 (CBLN2) as highly enriched in human and murine proprioceptive and nociceptive neurons. We found that CBLN2 expression is persistently upregulated in dorsal root ganglia (DRG) following spinal nerve ligation (SNL) in mice. In addition, transcription factor SOX11 binds to 12 cis-regulatory elements within the Cbln2 promoter to enhance its transcription. SNL also induced SOX11 upregulation, with SOX11 and CBLN2 co-localized in nociceptive neurons. The siRNA-mediated knockdown of Sox11 or Cbln2 attenuated SNL-induced mechanical allodynia and thermal hyperalgesia. High-throughput sequencing of DRG following intrathecal injection of CBLN2 revealed widespread gene expression changes, including upregulation of numerous NF-κB downstream targets. Consistently, CBLN2 activated NF-κB signaling, and inhibition with pyrrolidine dithiocarbamate reduced CBLN2-induced pain hypersensitivity, proinflammatory cytokines and chemokines production, and neuronal hyperexcitability. Together, these findings identified the SOX11/CBLN2/NF-κB axis as a critical mediator of neuropathic pain and a promising target for therapeutic intervention.
Animals ; Neuralgia/metabolism* ; Ganglia, Spinal/metabolism* ; Up-Regulation ; Mice ; NF-kappa B/metabolism* ; SOXC Transcription Factors/genetics* ; Male ; Neuroinflammatory Diseases/metabolism* ; Mice, Inbred C57BL ; Nerve Tissue Proteins/genetics* ; Hyperalgesia/metabolism* ; Signal Transduction ; Spinal Nerves

Radiation-induced thrombocytopenia (RIT) faces a perplexing challenge in the clinical treatment of cancer patients, and current therapeutic approaches are inadequate in the clinical settings. In this research, oxymatrine, a new molecule capable of healing RIT was screened out, and the underlying regulatory mechanism associated with magakaryocyte (MK) differentiation and thrombopoiesis was demonstrated. The capacity of oxymatrine to induce MK differentiation was verified in K-562 and Meg-01 cells in vitro. The ability to induce thrombopoiesis was subsequently demonstrated in Tg (cd41:enhanced green fluorescent protein (eGFP)) zebrafish and RIT model mice. In addition, we carried out network pharmacological prediction, drug affinity responsive target stability assay (DARTS) and cellular thermal shift assay (CETSA) analyses to explore the potential targets of oxymatrine. Moreover, the pathway underlying the effects of oxymatrine was determined by Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses, Western blot (WB), and immunofluorescence. Oxymatrine markedly promoted MK differentiation and maturation in vitro. Moreover, oxymatrine induced thrombopoiesis in Tg (cd41:eGFP) zebrafish and accelerated thrombopoiesis and platelet function recovery in RIT model mice. Mechanistically, oxymatrine directly binds to toll-like receptor 2 (TLR2) and further regulates the downstream pathway stimulator of interferon genes (STING)/nuclear factor-kappaB (NF-κB), which can be blocked by C29 and C-176, which are specific inhibitors of TLR2 and STING, respectively. Taken together, we demonstrated that oxymatrine, a novel TLR2 agonist, plays a critical role in accelerating MK differentiation and thrombopoiesis via the STING/NF-κB axis, suggesting that oxymatrine is a promising candidate for RIT therapy.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To investigate the clinical characteristics, treatment and prognosis of adult AML patients with NUP98::HOXA9 fusion gene. METHODS: From May 2017 to October 2023， among 2 113 AML patients who visited the Hematology Department of our hospital, patients with NUP98 rearrangements were screened. The clinical characteristics, chromosome karyotypes, immunophenotypes, gene mutations, treatment efficacy and prognosis of the patients with NUP98::HOXA9 positive were analyzed. RESULTS: Among the 2 113 AML patients, there were 18 cases with NUP98 rearrangement, including 14 NUP98::HOXA9 positive cases, with a detection rate of 0.66% (14/2 113). The median age of the NUP98::HOXA9 positive patients was 42.5 (23-64) years old. The most common chromosome karyotype was t(7; 11)(p15; p15). The immunophenotypes of all patients expressed CD13, CD33, CD117 and CD38, and most patients expressed CD34 and cMPO, while only a few expressed HLA-DR. Second-generation sequencing (NGS) was performed to detect genetic mutations associated with leukemia in all 14 patients, and the genes exhibiting a high frequency of mutation were WT1 (10/14), TET2 (7/14), and FLT3-ITD (6/14). Additionally, mutations were also observed in KRAS/NRAS, IDH1, and KIT. Of the 13 patients who received treatment, 9 achieved complete remission (CR), and all 3 patients who received azacytidine(AZA)+ venetoclax (VEN) regimen achieved CR after the first course of treatment. Within this cohort, 6 patients were classified as relapsed/refractory (6/13). 4 patients underwent allogeneic hematopoietic stem cell transplantation (allo-HSCT), of which two achieved long-term survival. The median follow-up time was 12 (2.1-65.0) months, while the median overall survival (OS) and relapse-free survival (RFS) were recorded as 11.4 months and 9.6 months, respectively. CONCLUSION The most common type of NUP98 rearrangement in adults AML patients is NUP98::HOXA9 , which is often accompanied by somatic mutations in WT1, TET2, and FLT3-ITD. These patients are prone to relapse, have short survival time, and generally face poor prognoses. Hopefully, utilization of the AZA+VEN regimen is anticipated to enhance the rate of induced remission in the patients, and some patients may prolong their survival through allo-HSCT. However, more effective treatment methods are still needed to improve the overall prognosis of these patients.
Humans ; Adult ; Leukemia, Myeloid, Acute/genetics* ; Middle Aged ; Prognosis ; Nuclear Pore Complex Proteins/genetics* ; Oncogene Proteins, Fusion/genetics* ; Mutation ; Male ; Female ; Young Adult ; Homeodomain Proteins/genetics*

OBJECTIVE: This study investigated the antidepression mechanisms of Xiaoyaosan (XYS), a classic Chinese prescription, from the perspective of energy metabolism in the brain and intestinal tissues. METHODS: Chronic unpredictable mild stress model-a classic depression rat model-was established. Effects of XYS on behaviors and gastrointestinal motility of depressed rats were investigated. Effects of XYS on energetic charge (EC), adenosine triphosphate-related enzymes, and key enzymes of energy metabolism in both hippocampus and jejunum tissues of depressed rats were investigated using high-performance liquid chromatography, biochemical analysis, and real-time quantitative polymerase chain reaction, respectively. Spearman correlation analysis was conducted to construct a correlation network of "behavior-brain energy metabolism-intestinal energy metabolism" of depression. RESULTS: XYS significantly reduced the abnormal behaviors that observed in depressed rats and increased the EC and the activity of Na⁺-K⁺-adenosine triphosphatase (ATPase) and Ca²⁺-Mg²⁺-ATPase in hippocampus and jejunum tissues of depressed rats. XYS restored the key energetic pathways that had been interrupted by depression, including glycolysis, tricarboxylic acid cycle, and oxidative phosphorylation. Furthermore, XYS exhibited antidepressive effects in terms of regulating energy metabolism in tissues of both brain and intestine. CONCLUSION XYS significantly corrected the disturbances in EC and energy metabolism-related enzymes of both brain and intestinal tissues, alleviating both core and concomitant symptoms of depression. The current findings underscore the role of energy metabolism in the antidepressive activity of XYS, providing a fresh perspective on depression, and novel research strategies for revealing the mechanism of actions of traditional Chinese medicines on multi-site and multi-symptom diseases. Please cite this article as: Xiao MT, Wang SY, Wu XL, Zhao ZY, Wang HM, Liu HM, Qin XM, Liu XJ. Antidepressant mechanism of Xiaoyaosan: A perspective from energy metabolism of the brain and intestine. J Integr Med. 2025; 23(6):706-720.
Animals ; Energy Metabolism/drug effects* ; Antidepressive Agents/therapeutic use* ; Drugs, Chinese Herbal/therapeutic use* ; Brain/drug effects* ; Male ; Depression/metabolism* ; Rats ; Rats, Sprague-Dawley ; Intestines/drug effects* ; Hippocampus/drug effects*