1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Action Mechanism of Huamoyan Granules in Treatment of Knee Osteoarthritis Based on TRPV1/p38 MAPK Pathway
Jin ZHANG ; Lili YANG ; Canwen ZHENG ; Jing KANG ; Yanlei MA ; Yue SHI ; Lei LI ; Hongxu MENG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(4):79-89
ObjectiveThis paper aims to observe the protective effect of Huamoyan granules on knee osteoarthritis (KOA) and explore whether its protective effect is oriented toward an anti-inflammatory direction by regulation of macrophage polarization, which can effectively inhibit the progression of pathological inflammatory response, reduce the release of inflammatory pain mediators, and downregulate the protein expression level of transient receptor potential vanilloid 1 (TRPV1), so as to provide experimental evidence for its clinical application and investigate its action mechanism. MethodsAfter adaptive feeding, Sprague-Dawley (SD) rats were randomly divided into six groups: sham group, model group, celecoxib group, and high, medium, and low-dose synovitis granule groups (9.6, 4.8, 2.4 g·kg-1). The administration dose of celecoxib capsules was 20 mg·kg-1. There were 10 rats in the sham group and 12 rats in the model group and each administration group. A KOA animal model was established by means of intra-articular injection of sodium iodoacetate into the knee joint. From the 10th day of the experiment, each administration group was given intragastric administration at a dose of 10 mL·kg-1 for 4 weeks. General conditions of rats in each group were assessed daily. The pressure pain threshold (PPT) to mechanical stimulation and joint diameter were recorded. X-ray examination was performed on the right knee joints of rats for imaging analysis. Enzyme linked immunosorbent assay (ELISA) was performed to detect the tumor necrosis factor-α (TNF-α), serum interleukin-1β (IL-1β), and other pro-inflammatory cytokines in rat serum samples, as well as the expression levels of neurogenic inflammatory mediators such as nerve growth factor (NGF) and calcitonin gene-related peptide (CGRP). Histopathological changes in the knee joint synovial tissues were examined by hematoxylineosin (HE) staining. Safranin O-fast green staining was performed to observe and evaluate the degree of knee cartilage lesions. Western blot was employed to quantitatively analyze TRPV1, p38 mitogen-activated protein kinase (p38 MAPK), and phosphorylated (p)-p38 MAPK in rat knee synovial tissues. Immunofluorescence (IF) was used to measure and assess M1/M2 macrophage polarization. ResultsCompared with those in the sham group, the circumference and joint diameter of the right knee were markedly enlarged in the model group (P<0.01), while PPTs of rats showed a significant reduction (P<0.01). The contents of IL-1β, TNF-α, CGRP, and NGF in rats' serum were significantly elevated (P<0.01), and the synovial Krenn score was increased (P<0.01). The Mankin score of cartilage tissue was increased (P<0.01), and the protein expressions of TRPV1 and p-p38 MAPK/p38 MAPK were significantly upregulated (P<0.01). The experimental intervention significantly reduced the proportion of pro-inflammatory M1 macrophages in the total macrophage population (P<0.01), and the percentage of M2 macrophages was decreased (P<0.01). The M1/M2 macrophage ratio was significantly elevated (P<0.01). Knee joint diameters of all dose groups of Huamoyan granules and the celecoxib group were reduced (P<0.01) compared with those of the model group, and the PPT recovery speeds in the high and medium-dose groups of Huamoyan granules were more obvious (P<0.05). The contents of IL-1β, CGRP, and NGF in the rats' serum in all administration groups were significantly reduced (P<0.05, P<0.01), and the content of TNF-α in rats' serum was significantly reduced (P<0.01). All dose groups of Huamoyan granules demonstrated significant reductions in both synovial Krenn score (P<0.05, P<0.01) and protein expression of TRPV1 and p-p38 MAPK/p38 MAPK in rats' synovial tissues (P<0.01). The percentage of M1 macrophages in the synovial tissues of the celecoxib group and all dose groups of Huamoyan granules was decreased (P<0.01). The percentage of M2 macrophages was increased (P<0.05), and the M1/M2 ratio was decreased (P<0.01). ConclusionHuamoyan granules can alleviate the inflammatory response of KOA, reduce the release of inflammatory pain mediators, and downregulate TRPV1 protein expression by regulating macrophage polarization. Its mechanism may be related to the TRPV1/p38 MAPK signaling pathway, thereby achieving the effect of improving peripheral pain hypersensitivity in KOA.
3.Research progress on the comorbidity mechanism of dry eye and depression
Yunfan ZHANG ; Kang WANG ; Jing LI
International Eye Science 2026;26(4):629-635
Dry eye disease(DED)and depression(DEP), though anatomically and clinically distinct, show significant epidemiological, pathophysiological, and prognostic interplay. Their co-occurrence has risen sharply in recent years, yet the mechanisms driving this comorbidity remain under-investigated. This review systematically synthesizes current evidence, highlighting that pro-inflammatory cytokines, neuro-regulatory imbalance, mitochondrial dysfunction, and gut-microbiota dysbiosis constitute a shared molecular network, while sleep deprivation and antidepressant use further amplify the vicious cycle. By identifying limitations in existing studies, this review proposes future research directions to offer new theoretical and clinical insights for managing DED-DEP comorbidity.
4.Influencing factors of significant corneal astigmatism in pterygium patients during the perioperative period
Shiru CHAI ; Xiaofen ZHENG ; Hua YU ; Zhen LI ; Yuguo KANG
International Eye Science 2026;26(4):683-686
AIM: To explore the factors associated with significant corneal astigmatism during the perioperative period in patients with pterygium. METHODS: Patients with primary pterygium presenting at Shanxi Eye Hospital between February and June 2025 were enrolled. All patients underwent medical history collection. Pre- and postoperative data were obtained using Pentacam, anterior segment photography, Image J software, and anterior segment optical coherence tomography(AS-OCT). All patients underwent pterygium excision combined with autologous bulbar conjunctival flap transplantation under local infiltration anesthesia. RESULTS: A total of 76 patients(76 eyes)with pterygium were finally enrolled(30 males, 46 females)with a mean age of 62.2±8.2 y. The mean length of corneal invasion by pterygium was 3.61±0.89 mm, the mean depth of invasion into the anterior corneal surface was 0.15±0.09 mm, and the median area of corneal invasion was 10.25(6.90, 18.75)mm2. The median preoperative corneal astigmatism was 1.50(0.70, 5.45)D. Median astigmatism was 0.8(0.40, 1.28)D at 2 wk postoperatively and 0.60(0.30, 1.15)D at 1 mo postoperatively. Patient age showed a positive correlation with preoperative astigmatism, and with residual astigmatism at 2 wk and 1 mo postoperatively(all P<0.05). The length of corneal invasion was positively correlated with preoperative astigmatism and residual astigmatism at both postoperative timepoints(P<0.01). The depth of invasion showed no significant linear correlation with astigmatism at any stage(P=0.250, 0.761, 0.686). The area of corneal invasion was positively correlated with astigmatism at all stages(P<0.01). Patients were grouped based on significant astigmatism(≥1.0 D)and non-significant astigmatism(<1.0 D), after adjusting for other variables, age(P=0.031)and the area of corneal invasion(P=0.004)were identified as risk factors for significant astigmatism. Pterygium invasion length was not significant factors(P>0.05). Receiver operating characteristic(ROC)analysis showed the highest area under the curve(AUC)for the invasion area(AUC=0.915). CONCLUSION: Significant preoperative corneal astigmatism in pterygium patients is correlated with patient age, the length of corneal invasion, and the area of invasion. The area of pterygium invasion into the cornea is the strongest predictor of significant preoperative corneal astigmatism.
5.Predictive modle for violence risk in hospitalized schizophrenia patients based on support vector machine
Huan LIU ; Peifang SHI ; Kun ZHANG ; Li KANG ; Yan ZHANG ; Long NA ; Binhong WANG ; Meiqing HE
Sichuan Mental Health 2026;39(1):27-35
BackgroundThe violent aggressive behaviors of patients with schizophrenia usually have the characteristics of suddenness, unpredictability, high severity, and great difficulty in prevention. Early identification and accurate assessment of their risk of violent aggression have significant clinical significance. ObjectiveTo construct a predictive model for the violence risk in hospitalized patients with schizophrenia, to identify the key factors influencing the occurrence of violent behavior in these patients, so as to provide references for clinical precise quantitative assessment and early intervention. MethodsA total of 200 patients with schizophrenia who were hospitalized at Taiyuan Psychiatric Hospital from March 2022 to September 2024 and met the diagnostic criteria of the International Classification of Diseases, eleventh edition (ICD-11) were collected to form the modeling cohort. They were randomly divided into a training set (n=140) and a test set (n=60) at a ratio of 7∶3. Based on the least absolute shrinkage and selection operator (LASSO) regression algorithm, the feature variables were screened and dimension-reduced. The support vector machine (SVM) from machine learning was selected for model training and prediction. The discrimination efficacy of the model was evaluated by the area under the receiver operating characteristic (ROC) curve (AUC), accuracy, precision, sensitivity, specificity, F1 value, and Brier value. ResultsLASSO regression screening identified 16 feature variables. Pearson correlation analysis revealed a positive correlation between prior violent behavior frequency and clinical psychiatric symptom scores (r=0.580, P<0.01), a positive correlation between hospitalization compliance and current disease status (r=0.550, P=0.003), and a positive correlation between educational level and family per capita monthly income (r=0.367, P<0.01). The SVM model achieved an AUC of 0.853, accuracy of 0.800, precision of 0.810, sensitivity of 0.895, specificity of 0.636, F1 value of 0.850, and Brier value of 0.168. ConclusionThe SVM model has a relatively high level of applicability and overall predictive performance in the assessment of violent risk in schizophrenia patients, which is helpful for the early identification of violent risks in such patients. [Funded by Specialized Research Project for Enhancing the Competence of Health Professionals in Taiyuan City (number, Y2023006)]
6.Anti-osteoporosis Effect of Isorhamnetin: A Review
Shilong MENG ; Xu ZHANG ; Yawei XU ; Yang YU ; Wei LI ; Yanguang CAO ; Xiaolin SHI ; Wei ZHANG ; Kang LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(5):347-352
Osteoporosis is a common senile bone metabolism disease, clinically characterized by decreased bone mass, destruction of bone microstructure, increased bone fragility, and easy fracture. It tends to occur in the elderly and postmenopausal women, seriously threatening the quality of life and physical and mental health of the elderly. At present, the treatment of osteoporosis is mainly based on oral western medicines, such as calcium, Vitamin D, and bisphosphonates. Still, there are drawbacks such as a long medication cycle and many adverse reactions. In recent years, due to the advantages of multi-component, multi-pathway, and multi-target, some traditional Chinese medicines and effective ingredients can regulate the osteogenic and osteoclastic differentiation process in both directions and are widely used in the prevention and treatment of osteoporosis. Hippophae rhamnoides is a commonly used herbal medicine, and its fruits are rich in flavonoids, polyphenols, fatty acids, vitamins, and trace elements, which have been proven to have a good anti-osteoporosis effect. Isorhamnetin is the main effective ingredient of Hippophae rhamnoides fruits, which has many pharmacological effects such as anti-inflammation, anti-oxidative stress, anti-aging, and anti-tumor. Studies have shown that isorhamnetin can participate in the regulation of bone metabolism and has a good anti-osteoporosis effect. However, the pharmacological effects and related mechanisms of isorhamnetin against osteoporosis have not been systematically summarized. Therefore, this paper reviewed the pharmacological effects and related mechanisms of isorhamnetin against osteoporosis by referring to relevant literature to provide more basis for the development and application of isorhamnetin.
7.Principles, technical specifications, and clinical application of lung watershed topography map 2.0: A thoracic surgery expert consensus (2024 version)
Wenzhao ZHONG ; Fan YANG ; Jian HU ; Fengwei TAN ; Xuening YANG ; Qiang PU ; Wei JIANG ; Deping ZHAO ; Hecheng LI ; Xiaolong YAN ; Lijie TAN ; Junqiang FAN ; Guibin QIAO ; Qiang NIE ; Mingqiang KANG ; Weibing WU ; Hao ZHANG ; Zhigang LI ; Zihao CHEN ; Shugeng GAO ; Yilong WU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(02):141-152
With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.
8.Advances in neoadjuvant therapy for locally advanced resectable esophageal cancer
Xiaozheng KANG ; Ruixiang ZHANG ; Zhen WANG ; Xiankai CHEN ; Yong LI ; Jianjun QIN ; Yin LI
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(02):153-159
Neoadjuvant therapy has become the standard treatment for locally advanced resectable esophageal cancer, significantly improving long-term survival compared to surgery alone. Neoadjuvant therapy has evolved to include various strategies, such as concurrent chemoradiotherapy, chemotherapy, immunotherapy, or targeted combination therapy. This enriches clinical treatment options and provides a more personalized and scientific treatment approach for patients. This article aims to comprehensively summarize current academic research hot topics, review the rationale and evaluation measures of neoadjuvant therapy, discuss challenges in restaging methods after neoadjuvant therapy, and identify the advantages and disadvantages of various neoadjuvant therapeutic strategies.
9.Mechanism of Different Dosage Forms of Kaixinsan in Improving Mitochondrial Function for Prevention and Treatment of Cognitive Disorder Based on AMPK/PGC-1α/SIRT3 Pathway
Shuyue KANG ; Yanzi YU ; Jiaqun SUN ; Wenxuan CHEN ; Yaqin YANG ; Qi WANG ; Weirong LI ; Limei YAO
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(7):15-24
ObjectiveTo explore the effects of different dosage forms of Kaixinsan (KXS) on the morphology and function of mitochondria in rat models of Alzheimer's disease (AD) and potential mechanisms of action. MethodsMale SD rats were randomly assigned to a sham group, model group, treatment groups receiving KXS decoction, powders, and granules (3.08 g·kg-1), as well as donepezil group (0.51×10-3 g·kg-1), with 10 rats in each group. AD model was created using intracerebroventricular injection of streptozocin (STZ). After 30 days of administration, behavioral assessments were conducted, and mitochondrial morphology was observed using transmission electron microscopy. Mitochondrial respiratory chain complex content was measured via enzyme-linked immunosorbent assay (ELISA). Changes in mitochondrial membrane potential were measured via JC-1 staining, and superoxide dismutase (SOD) activity and reactive oxygen species (ROS) levels were measured via biochemical assays. The mRNA expression of adenosine 5'-monophosphate-activated protein kinase (AMPK), peroxisome proliferator-activated receptor gamma coactivator-1α (PGC-1α), and silent information regulator 3 (SIRT3) was detected by real-time fluorescent quantitative polymerase chain reaction (Real-time PCR), and Western blot was used to examine the protein expression levels of optic atrophy protein1 (OPA1), mitochondrial fission protein 1 (FIS1), AMPK, p-AMPK, PGC-1α, and SIRT3. ResultsCompared with the sham group, rats in the model group had significantly lower recognition index, spontaneous alternation rate, escape latency, number of platform crossings, time spent in the target quadrant, and percentage of distance traveled in the target quadrant distance (P<0.05, P<0.01). Significant mitochondrial damage was observed in the hippocampal tissue, with a marked decrease in mitochondrial respiratory chain complex content (P<0.01) and reduced mitochondrial membrane potential (P<0.05). Additionally, the SOD activity was reduced, while ROS levels were elevated (P<0.01). The mRNA expression of PGC-1α and SIRT3 was significantly downregulated (P<0.01), along with decreased protein expression levels of OPA1, p-AMPK/AMPK, PGC-1α, and SIRT3, whereas FIS1 protein expression was significantly upregulated (P<0.05, P<0.01). Compared with the model group, rats in KXS-treated groups (various dosage forms) showed significant improvement in behavioral indexes (P<0.05, P<0.01), reduced hippocampal mitochondrial damage, and more organized mitochondrial cristae. Mitochondrial respiratory chain complex content was significantly increased (P<0.05, P<0.01), and mitochondrial membrane potentials were elevated (P<0.05). SOD activity was elevated, and ROS levels were significantly reduced (P<0.05, P<0.01). Furthermore, the mRNA expression of PGC-1α and SIRT3 was upregulated, with increased protein levels of OPA1, p-AMPK/AMPK, PGC-1α, and SIRT3, while FIS1 protein expression levels were significantly reduced (P<0.05, P<0.01). Across the KXS-treated groups, the granule group showed a higher spontaneous alternation rate than the decoction and powder groups (P<0.05). ConclusionKXS decoction, powders, and granules can improve the learning and memory ability of rats, with granules being the most effective. The mechanism of action may involve activation of the AMPK/PGC-1α/SIRT3 signaling pathway, improvement of the mitochondrial function, and subsequent amelioration of the brain energy metabolism disorders.
10.Effect of Shenxiong Huanglian Jiedu Decoction on Neuronal Damage and Aβ Clearance in Mice Model of Alzheimer's Disease
Jing LIU ; Kang CHEN ; Yushun ZHOU ; Zhezuo ZHANG ; Guran YU ; Hao LI
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(7):43-52
ObjectiveTo investigate the effects of Shenxiong Huanglian Jiedu decoction on the clearance of amyloid β-protein (Aβ) and neuronal damage in the mouse model of Alzheimer's disease (AD). MethodsA total of 36 SPF-grade 2-month-old C57BL/6J mice were used in this study, and the modeling was performed by bilateral hippocampal injection of Aβ oligomers in C57BL/6J mice. The experiment was conducted with a blank group, a sham operation group, a model group, low- and high-dose (3.27,6.54 g·kg-1, respectively) Shenxiong Huanglian Jiedu decoction groups, and a positive control (donepezil hydrochloride, 0.65 mg·kg-1) group. At the end of the drug intervention, the learning and memory abilities and the activities of mice were evaluated by the Morris water maze and open field tests. Brain histopathology was examined by hematoxylin-eosin and Nissl staining. Additionally, in vivo imaging was employed to measure the metabolism of fluorescent Aβ in the cerebrospinal fluid, and staining of ionized calcium-binding adapter molecule-1 (Iba-1) was employed to assess microglial activation in the hippocampal tissue. Additionally, neurotrophin-3 (NT-3) and brain-derived neurotrophic factor (BDNF) levels in the brain tissue and serum were determined by the immunofluorescence assay and enzyme-linked immunosorbent assay. Western blot was conducted to determine the expression of inflammation and pathway-related proteins in the hippocampal tissue. ResultsCompared with the blank group and the sham operation group, the escape latency of the mice in the model group was prolonged, the platform residence time was shortened, the hippocampal tissue showed pathological manifestations such as neuronal pyknosis, Nissl body dissolution, and microglia activation. The metabolic rate of fluorescent Aβ through cerebrospinal fluid was slowed down, and the expression levels of BDNF, NT-3, and interleukin-10 (IL-10) in the hippocampus were significantly decreased (P<0.01). The expression levels of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), interleukin-1β (IL-1β), Toll-like receptor 4 (TLR4), myeloid differentiation factor 88 (MyD88) and phosphorylated nuclear transcription factor-κB (p-NF-κB p65) in hippocampus were significantly increased (P<0.05, P<0.01). Compared with the model group, the escape latency of mice in the low and high dose groups of Chinese medicine and donepezil group was shortened, and the platform residence time was prolonged. Neuronal karyopyknosis, Nissl body dissolution and microglia activation in hippocampus were improved. Fluorescence Aβ was metabolized faster by cerebrospinal fluid. The expression of BDNF and NT-3 in hippocampus was increased (P<0.01), and the expression of TLR4, MyD88 and p-NF-κB p65 was significantly decreased (P<0.05, P<0.01). The expression of TNF-α in the hippocampus of the high-dose group was significantly decreased (P<0.05), and the expression of IL-10 was significantly increased (P<0.05). The expression of TNF-α, IL-6 and IL-1β in the hippocampus of the donepezil group was significantly decreased (P<0.05, P<0.01). ConclusionShenxiong Huanglian Jiedu decoction may mitigate neuronal damage and enhance cerebrospinal fluid flow in the mouse model of AD, thereby promoting the clearance of Aβ and improving the learning and memory abilities. These beneficial effects are likely mediated through the inhibition of microglial activation, reduction of inflammation, and modulation of the TLR4/MyD88/NF-κB signaling pathway.

Result Analysis
Print
Save
E-mail