AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective To explore the efficacy and safety of oral solution of magnesium sodium potassium sulfate in bowel preparation before colonoscopy. Methods Patients who planned to undergo colonoscopy at the digestive department of the Ninth People’s Hospital, affiliated to School of Medicine of Shanghai Jiao Tong University from January 2023 to August 2023 were selected and eligible subjects were divided into two groups: Group A took polyethylene glycol （PEG） and Group B took oral solution of magnesium sodium potassium sulfate （OSS）. The quality, drug tolerance, and safety of intestinal preparation were evaluated. The quality of bowel preparation was evaluated by the boston bowel preparation scale （BBPS）. Results The right colon BBPS score of Group B was (2.39±0.82) points, which was significantly higher than of Group A (2.11±0.43) points （P<0.05）. The overall score of Group B was higher than that of Group A （P<0.05）. OSS was easier to take than PEG, with a good taste and overall sensation. Patients were willing to use OSS to clean their bowels even when they were willing to undergo another examination （P<0.05）. There was a significant difference in nausea and vomiting symptoms between the two groups （P<0.05）, and there were no significant changes in renal function and electrolytes before and after medication in the two groups of patients. Conclusion OSS had a higher quality of bowel cleaning and was easier for patients to accept.

[Objective] To analyze the effects of different factors and red blood cell transfusion thresholds on the efficacy of neonatal red blood cell (RBC) transfusion, in order to provide more references for neonatal transfusions to better achieve rational and effective blood use. [Methods] A retrospective collection of data from 282 neonates who received RBC transfusions at our hospital from 2022 to 2023 was conducted, including birth weight, gestational age, number of blood transfusions, length of hospital stay, assisted ventilation during RBC transfusion, and laboratory test results before and after transfusion. SPSS software was used for statistical analysis to comprehensively analyze the impact of different factors on the efficacy of RBC transfusion in neonates. [Results] The results showed that the gestational age and weight of newborns at birth were negatively correlated with their length of hospital stay and the number of RBC transfusions during hospitalization. Newborns with younger gestational age and lower weight had longer hospital stays and more RBC transfusions during hospitalization. After administering RBCs according to the standard of 15 mL/kg, there was a statistically significant difference in the efficacy of RBC transfusion at different transfusion thresholds. In non-critical situations, RBC transfusions were ineffective when the pre-transfusion hemoglobin (Hb) level was >120 g/L. When the pre-transfusion Hb level was ≤70 g/L, RBC transfusions achieved higher efficacy in both critical and non-critical situations. [Conclusion] In critical situations, the group with pre-transfusion Hb values ≤ 70 g/L has the best RBC transfusion effect, while in non-critical situations, the group with pre-transfusion Hb levels between 81 and 90 g/L has the best RBC transfusion effect. Overall, the efficacy of RBC transfusion in non-critical situations is higher than that in critical situations.

Objective To investigate the changes in the prevalence of Babesia microti infections, spleen morphology and proportions of splenic immune cells in BALB/c mice following intravenous and intraperitoneal injections, so as to provide insights into unraveling the immune regulatory mechanisms of Babesia infections. Methods Laboratory - maintained B. microti strains were prepared into whole blood samples with 10% prevalence of B. microti infection. A total of 75 BALB/c mice were randomly divided into three groups, including the normal control group, intravenous injection group, and intraperitoneal injection group, of 25 mice in each group. Mice in the intravenous and intraperitoneal injection groups were administered 100 μL of whole blood samples with 10% prevalence of B. microti infection, with the day of injection recorded as d0, and animals in the normal control group were given no treatments. Blood was sampled from mice in each group via the tail tip on d7, d14, d21, d28 and d35, and prepared into thin-film blood smears, and B. microti infection was observed in red blood cells. Five mice were randomly sampled from each group and sacrificed on d7, d14, d21, d28 and d35, and spleen was collected for measurement of spleen size and weight. In addition, splenic cells were isolated, and the proportions of CD3e⁺ T cells, CD45R⁺ B cells, CD49b⁺ nature killer (NK) cells, and F4/80⁺ macrophages were detected in CD45⁺ lymphocytes using flow cytometry. Results The prevalence of B. microti infection in the intravenous (22.80%) and intraperitoneal injection groups (44.82%) peaked on d7 (χ² = 8.141, P < 0.01) and then rapidly decreased, and no parasites were observed on d35. The longest mouse spleen length [(32.91 ± 2.20) mm] and width [(9.82 ± 0.43) mm], and the greatest weight [(0.78 ± 0.10) g] were found on d14 in the intravenous injection group, and the longest spleen length [(32.42 ± 3.21) mm] and width [(10.25 ± 0.73) mm], and the greatest weight [(0.73 ± 0.09) g] were seen in the intra-peritoneal injection group on d21, d7 and d14, respectively. There were significant differences among the intravenous injection group, intraperitoneal injection group and the normal control group in terms of spleen length (F = 10.310, P < 0.05), width (F = 9.824, P < 0.05), and weight (F = 10.672, P < 0.05) on d21, and the mouse spleen length, width and weight were all significantly greater in the intraperitoneal injection group than in the intravenous injection group (allP values < 0.05). The proportions of splenic CD3e⁺ T cells [(60.60 ± 6.20)% and (39.68 ± 7.62)%], CD45R⁺ B cells [(43.32 ± 2.08)% and (49.53 ± 4.90)%], CD49b⁺ NK cells [(6.88 ± 1.34)% and (7.71 ± 1.59)%], and F4/80⁺ macrophages [(2.21 ± 0.29)% and (3.80 ± 0.35)%] peaked on d14, d21, d21 and d14 in the intravenous and intraperitoneal injection groups, respectively. There were significant differences in the proportions of CD3e⁺ T cells (F = 16.730, P < 0.05) and F4/80⁺ macrophages (F = 15.941, P < 0.05) among the intravenous injection group, intraperitoneal injection group and normal control group on d14, and a higher proportion of CD3e⁺ T cells and a lower proportion of F4/80⁺ macrophages were detected in the intravenous injection group than in the intraperitoneal injection group (both P values < 0.01). There were significant differences among the intravenous injection group, intraperitoneal injection group and normal control group on d21 in terms of proportions of splenic CD3e⁺ T cells (F = 9.252, P < 0.05), CD45R⁺ B cells (F = 14.349, P < 0.05), CD49b⁺ NK cells (F = 13.436,P < 0.05), and F4/80⁺ macrophages (F = 8.180, P < 0.05), and a higher proportion of CD3e⁺ T cells and lower proportions of CD45R⁺ B cells and F4/80⁺ macrophages were detected in the intravenous injection group than in the intraperitoneal injection group (all P values < 0.01). In addition, there was a significant difference in the proportion of CD3e⁺ T cells among the intravenous injection group, intraperitoneal injection group and normal control group on d28 (F = 9.772,P < 0.05), and a lower proportion of CD3e⁺ T cells was found in the intravenous injection group than in the intraperitoneal injection group (P < 0.01). Conclusions Both intraperitoneal and intravenous routes are effective to induce B. microti infections in BALB/c mice, and the prevalence of B. microti infections is higher in BALB/c mice through the intraperitoneal route than through the intravenous route. Intraperitoneal and intravenous injections with B. microti cause diverse spleen morphologies and proportions of splenic immune cells in mice, indicating routes of B. microti infections cause different impacts on immune response mechanisms in mice.

ObjectiveFor prepubertal and urgently treated malignant tumor patients, ovarian tissue cryopreservation and transplantation represent more appropriate fertility preservation methods. Current clinical practices often involve freezing ovarian tissue with high concentrations of cryoprotectants (CPAs) and thawing with water baths. These processes lead to varying degrees of toxicity and devitrification damage to ovarian tissue. Therefore, this paper proposes optimized methods for vitrification of ovarian tissues based on sodium alginate hydrogel encapsulation and magnetic induction nanowarming technology. MethodsFirstly, the study investigated the effects of sodium alginate concentration, the sequence of hydrogel encapsulation and CPAs loading on vitrification efficiency of encapsulated ovarian tissue. Additionally, the capability of sodium alginate hydrogel encapsulation to reduce the required concentration of CPAs was validated. Secondly, a platform combining water bath and magnetic induction nanowarming was established to rewarm ovarian tissue under various concentrations of magnetic nanoparticles and magnetic field strengths. The post-warming follicle survival rate, antioxidant capacity, and ovarian tissue integrity were evaluated to assess the efficacy of the method. ResultsThe study found that ovarian tissue encapsulated with 2% sodium alginate hydrogel exhibited the highest follicle survival rate after vitrification. The method of loading CPAs prior to encapsulation proved more suitable for ovarian tissue cryopreservation, effectively reducing the required concentration of CPAs by 50%. A combination of 8 g/L Fe₃O₄ nanoparticles and an alternating magnetic field of 300 Gs showed optimal warming effectiveness for ovarian tissue. Combining water bath rewarming with magnetic induction nanowarming yielded the highest follicle survival rate, enhanced antioxidant capacity, and preserved tissue morphology. ConclusionSodium alginate hydrogel encapsulation of ovarian tissue reduces the concentration of CPAs required during the freezing process. The combination of magnetic induction nanowarming with water bath provides an efficient method ovarian tissue rewarming. This study offers novel approaches to optimize ovarian tissues vitrification.

Intraoperative cell salvage (IOCS) has been widely applied as an important blood conservation measure in surgical operations. However, there is currently a lack of clinical practice guidelines for the implementation of IOCS in patients with malignant tumors. This report aims to provide clinicians with recommendations on the use of IOCS in patients with malignant tumors based on the review and assessment of the existed evidence. Data were derived from databases such as PubMed, Embase, the Cochrane Library and Wanfang. The guideline development team formulated recommendations based on the quality of evidence, balance of benefits and harms, patient preferences, and health economic assessments. This study constructed seven major clinical questions. The main conclusions of this guideline are as follows: 1) Compared with no perioperative allogeneic blood transfusion (NPABT), perioperative allogeneic blood transfusion (PABT) leads to a more unfavorable prognosis in cancer patients (Recommended); 2) Compared with the transfusion of allogeneic blood or no transfusion, IOCS does not lead to a more unfavorable prognosis in cancer patients (Recommended); 3) The implementation of IOCS in cancer patients is economically feasible (Recommended); 4) Leukocyte depletion filters (LDF) should be used when implementing IOCS in cancer patients (Strongly Recommended); 5) Irradiation treatment of autologous blood to be reinfused can be used when implementing IOCS in cancer patients (Recommended); 6) A careful assessment of the condition of cancer patients (meeting indications and excluding contraindications) should be conducted before implementing IOCS (Strongly Recommended); 7) Informed consent from cancer patients should be obtained when implementing IOCS, with a thorough pre-assessment of the patient's condition and the likelihood of blood loss, adherence to standardized internally audited management procedures, meeting corresponding conditions, and obtaining corresponding qualifications (Recommended). In brief, current evidence indicates that IOCS can be implemented for some malignant tumor patients who need allogeneic blood transfusion after physician full evaluation, and LDF or irradiation should be used during the implementation process.

The purpose of the present study was to investigate the effects of resistance combined with aerobic chrono-exercise on the common carotid artery elasticity and hemodynamics. 24 healthy young men (21.96±0.43 years old) underwent a single acute resistance combined with aerobic exercise intervention at eight time periods (6, 8, 10, 12, 14, 16, 18, and 20 o'clock). The axial flow velocity and diameter waveforms of the common carotid artery were measured, and the hemodynamics were calculated using the classical hemodynamic theory before exercise, immediately after exercise, 10 min and 20 min after exercise. The results showed that during exercise recovery, systolic and mean pressures decreased more markedly after exercise at 8 o'clock (P < 0.05); At 20 min post-exercise, arterial stiffness index and pressure-strain elastic modulus after exercise at 6 o'clock were reduced compared with the resting state, but were significantly elevated after exercise at 20 o'clock (P < 0.05). Immediately after exercise, the pressure rise was higher after exercise at 6 o'clock and the mean wall shear stress was higher after exercise at 20 o'clock (P < 0.05). These results suggest that resistance combined with aerobic chrono-exercise produces different effects on common carotid artery hemodynamics in young men. A single acute session of resistance combined with aerobic exercise at 8 o'clock is more effective in lowering blood pressure. Exercise at 6 o'clock is beneficial to improve arterial elasticity but is not recommended for young male individuals with cardiovascular disease risks because of the excessive increase in blood pressure immediately after exercise. Exercise at 20 o'clock is more effective in improving wall shear stress but is accompanied by elevated arterial stiffness indices and pressure-strain elastic modulus. These results provide a scientific basis for healthy young men in choosing the time of exercise by exploring the common carotid artery elasticity and hemodynamic-related indices.
Humans ; Male ; Young Adult ; Exercise/physiology* ; Carotid Artery, Common/physiology* ; Hemodynamics/physiology* ; Vascular Stiffness/physiology* ; Elasticity ; Resistance Training ; Adult

Fermented traditional Chinese medicine(TCM) has a long history of medicinal use, such as Sojae Semen Praeparatum, Arisaema Cum Bile, Pinelliae Rhizoma Fermentata, red yeast rice, and Jianqu. Fermentation technology was recorded in the earliest TCM work, Shen Nong's Classic of the Materia Medica. Microorganisms are essential components of the fermentation process. However, the contamination of fermented TCM by toxigenic fungi and mycotoxins due to unstandardized fermentation processes seriously affects the quality of TCM and poses a threat to the life and health of consumers. In this paper, the characteristics, microbial composition, and mycotoxin profile of fermented TCM are systematically summarized to provide a theoretical basis for its quality and safety control.
Fermentation ; Mycotoxins/analysis* ; Drugs, Chinese Herbal/analysis* ; Fungi/classification* ; Bacteria/genetics* ; Drug Contamination ; Medicine, Chinese Traditional

The 95% ethanol extract of Stephania hernandifolia was isolated and purified by column chromatography on silica gel and Sephadex LH-20, RP-18 medium-pressure liquid chromatography, and semi-preparative high performance liquid chromatography. The chemical structures of the compounds were identified by NMR and high-resolution mass spectrometry. Four alkaloids were isolated and identified as(-)-8-oxo-2,3,4,10,11-pentamethoxyberberine(1),(-)-8-oxo-11-hydroxy-2,3,4,10-tetramethoxyberberine(2), N-trans-feruloyl tyramine(3), and N-cis-feruloyl tyramine(4). Compounds 1 and 2 were new protoberberine alkaloids, while compounds 3 and 4 were amide alkaloids. All the four compounds were separated from this plant for the first time. The inhibitory activities of compounds 1, 3, and 4 against α-glycosidase were measured by the enzymatic reaction in vitro with 4-nitrophenyl-α-D-glucopyranoside(PNPG) as the substrate. Compounds 3 and 4 showed inhibitory activities against α-glucosidase, with median inhibition concentration(IC_(50)) values of(7.09±0.42) and(31.25±1.14) μmol·L~(-1), respectively.
Berberine Alkaloids/isolation & purification* ; Stephania/chemistry* ; Drugs, Chinese Herbal/isolation & purification* ; Molecular Structure ; alpha-Glucosidases/metabolism* ; Chromatography, High Pressure Liquid ; Alkaloids/isolation & purification*

Metabonomics and proteomics were employed to investigate the mechanism of Yuzhi Zhixue Granules in treating polycystic ovary syndrome with insulin resistance(PCOS-IR). The disease model was established by feeding a high-fat diet and gavage of letrozole solution and it was then treated with different doses of Yuzhi Zhixue Granules. The therapeutic effect of Yuzhi Zhixue Granules was evaluated based on the body mass, homeostasis model assessment of insulin resistance and insulin sensitivity index, serum levels of adipokines, and histopathological changes of rats. Metabolomics and proteomics were employed to find the action pathways of Yuzhi Zhixue Granules. The results showed that Yuzhi Zhixue Granules reduced the body mass, improved the insulin sensitivity and aromatase activity, improved the levels of leptin, adiponectin and other adipokines, and alleviated insulin resistance, histopathological changes, and metabolic disorders in PCOS-IR rats. Metabolomics results revealed 14 metabolites with altered levels in the ovarian tissue, which were closely related to glutathione metabolism and pyruvate metabolism. Proteomics results showed that the therapeutic effect of Yuzhi Zhixue Granules was mainly related to the adipokine, adenosine 5'-monophosphate(AMP)-activated protein kinase(AMPK), phosphatidylinositol 3-kinase/protein kinase B(PI3K/Akt), forkhead box protein O(FoxO), and mechanistic target of rapamycin(mTOR) signaling pathways. Western blot results showed that compared with the model group, Yuzhi Zhixue Granules treatment decreased the p-AMPK/AMPK and p-FoxO1/FoxO1 levels, increased the p-mTOR/mTOR level, and up-regulated the expression level of recombinant glucose transporter 4(GLUT4). Yuzhi Zhixue Granules can balance amino acid metabolism and pyruvate metabolism by regulating the AMPK/mTOR/FoxO/GLUT pathway to maintain the homeostasis of the ovarian environment and alleviate insulin resistance, thus treating PCOS-IR.
Animals ; Female ; Insulin Resistance ; Polycystic Ovary Syndrome/genetics* ; Drugs, Chinese Herbal/administration & dosage* ; Rats ; Metabolomics ; Proteomics ; Rats, Sprague-Dawley ; Humans ; Ovary/metabolism* ; Signal Transduction/drug effects*