AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective To explore the efficacy and safety of oral solution of magnesium sodium potassium sulfate in bowel preparation before colonoscopy. Methods Patients who planned to undergo colonoscopy at the digestive department of the Ninth People’s Hospital, affiliated to School of Medicine of Shanghai Jiao Tong University from January 2023 to August 2023 were selected and eligible subjects were divided into two groups: Group A took polyethylene glycol （PEG） and Group B took oral solution of magnesium sodium potassium sulfate （OSS）. The quality, drug tolerance, and safety of intestinal preparation were evaluated. The quality of bowel preparation was evaluated by the boston bowel preparation scale （BBPS）. Results The right colon BBPS score of Group B was (2.39±0.82) points, which was significantly higher than of Group A (2.11±0.43) points （P<0.05）. The overall score of Group B was higher than that of Group A （P<0.05）. OSS was easier to take than PEG, with a good taste and overall sensation. Patients were willing to use OSS to clean their bowels even when they were willing to undergo another examination （P<0.05）. There was a significant difference in nausea and vomiting symptoms between the two groups （P<0.05）, and there were no significant changes in renal function and electrolytes before and after medication in the two groups of patients. Conclusion OSS had a higher quality of bowel cleaning and was easier for patients to accept.

With the accelerating trend of population aging, the number of elderly patients with lung cancer continues to rise, and the disease burden is becoming increasingly heavy. The clinical management of these patients faces severe challenges due to their decreased physiological reserve, complex comorbidities, and significant individual heterogeneity. Consequently, under traditional diagnosis and treatment models, doctors often struggle to identify the individualized risks of elderly patients in a timely and comprehensive manner, which can easily lead to decision biases such as undertreatment or overtreatment. In view of this, this study advocates for the establishment of an umbrella decision-making model specifically tailored for elderly lung cancer patients. Grounded in a multidisciplinary team (MDT) platform, this model deeply integrates oncological indicators with the comprehensive geriatric assessment (CGA) system. By holistically considering multidimensional variables including tumor burden, organ function, frailty index, cognitive status, and social support, the model establishes an operational mechanism characterized by "single entry, precise stratification, and targeted selection". Accordingly, patients can be scientifically triaged into distinct intervention tiers, such as active surveillance, minimally invasive surgery, drug therapy, radiotherapy, and best supportive care, thereby achieving real-time alignment between treatment intensity and patient fitness. This article elaborates on the construction logic and key operational procedures of this novel decision-making framework, aiming to guide clinical practice beyond the limitations of a tumor-centric perspective toward a holistic, dynamic, whole-course management strategy. This transition seeks to ensure optimal quality of life and clinical net benefit for elderly patients alongside survival prolongation.

ObjectiveThe present study aimed to investigate alterations in white matter microstructure and spontaneous neural activity in male college smokers, and to further explore their associations with nicotine dependence. Given that adolescence and early adulthood represent critical periods for brain maturation, particularly for white matter development, understanding the neural correlates of smoking behavior during this stage is of substantial importance for both neuroscience and public health. MethodsA total of 115 male undergraduate students were initially recruited for this study. After quality control and exclusion procedures, 52 male college smokers and 42 demographically matched healthy non-smokers were included in the final analysis. All participants underwent multimodal magnetic resonance imaging (MRI), including diffusion tensor imaging (DTI) and resting-state functional MRI (rs-fMRI). White matter fiber tracts were reconstructed using the automated fiber quantification (AFQ) method, which enables precise identification and quantification of major fiber bundles. Eighteen major white matter tracts were segmented for each participant. Along the core trajectory of each tract, 100 equidistant nodes were sampled. Fractional anisotropy (FA) was calculated at each node to assess white matter microstructural integrity, while amplitude of low-frequency fluctuation (ALFF) was computed to evaluate spontaneous neural activity within white matter tracts. Between-group differences in FA and ALFF were assessed using two-sample t-tests, with appropriate corrections applied for multiple comparisons. Furthermore, Pearson correlation analyses were conducted to examine the relationships between imaging-derived metrics (FA and ALFF values in regions showing significant group differences) and nicotine dependence severity, as measured by the Fagerström test for nicotine dependence (FTND). ResultsCompared with healthy non-smokers, male college smokers exhibited significantly increased FA values in several white matter tracts, including the left thalamic radiation, right corticospinal tract, forceps major of the corpus callosum, left uncinate fasciculus, and right arcuate fasciculus. These findings suggest altered microstructural organization or increased directional coherence within these pathways. In addition, smokers demonstrated significantly elevated ALFF values in the forceps major, right uncinate fasciculus, and left arcuate fasciculus, indicating enhanced spontaneous neural activity in these white matter regions. Correlation analyses revealed that FA values in the left thalamic radiation and right corticospinal tract were negatively correlated with FTND scores, suggesting that higher levels of nicotine dependence were associated with reduced microstructural integrity or altered fiber organization in these regions. In contrast, ALFF values in the forceps major and right uncinate fasciculus were positively correlated with FTND scores, indicating that greater nicotine dependence was associated with increased spontaneous neural activity in specific white matter pathways. ConclusionThe present study provides evidence that male college smokers exhibit distinct alterations in both white matter microstructure and functional activity. These abnormalities are not uniformly distributed but rather localized to specific fiber tracts implicated in sensorimotor processing, interhemispheric communication, and higher-order cognitive and emotional regulation. Importantly, the observed associations between imaging metrics and nicotine dependence severity suggest that these structural and functional alterations may reflect neurobiological mechanisms underlying addiction. The combination of AFQ-based tract profiling and multimodal MRI offers a sensitive approach for detecting subtle changes along white matter pathways, highlighting its potential utility in identifying neuroimaging biomarkers of nicotine dependence. Overall, these findings indicate that smoking during early adulthood may disrupt ongoing white matter maturation, potentially leading to long-term consequences for brain function. This study provides novel insights into the neural basis of nicotine dependence and underscores the importance of early intervention and prevention strategies targeting young smokers.

To address the growing challenge of an increasing number of elderly lung cancer patients amidst China's aging population and to fill the gap in quality control standards for surgical treatment in this special population, this study aimed to develop a standardized surgical evaluation system for elderly lung cancer patients tailored to China's national conditions. The system was established through a literature review, integrated the pathophysiological characteristics of elderly patients, and was constructed following review, feedback, and revision by experts from multiple thoracic surgery centers. Employing a 100-point scoring system, it comprises three primary domains: physical infrastructure and geriatric adaptability foundational conditions (10 points); management level and perioperative care models (20 points); and technical proficiency and clinical outcomes (70 points). The system places a strong emphasis on geriatric adaptability, proposing specific, quantifiable indicators for age-friendly facility modifications, control of elderly-specific complications, multidisciplinary collaboration, and standardized perioperative management. It provides a convenient and measurable assessment tool for quality control in the surgical treatment of elderly lung cancer in China, which is expected to promote the standardization and homogenization of diagnosis and treatment.

Objective To investigate the etiology and treatment of dysuria shortly after holmium laser enucleation of the prostate (HoLEP) for benign prostatic hyperplasia (BPH), so as to improve the therapeutic efficacy. Methods A retrospective analysis was conducted on 1361 BPH patients who received HoLEP at our hospital during Mar. 2018 and Mar. 2025. All patients underwent ultrasound, computed tomography (CT), urethral probing or radiography, cystourethroscopy, and urodynamic testing. The causes, treatments and prognosis of dysuria after operation were summarized. Results ninety-eight patients (7.2%) experienced dysuria within 3 months after surgery, and all patients received initial urethral dilation. Among the 62 cases with urethral stricture, 28 were treated with urethral dilation (average of 8 sessions), 16 underwent external urethral incision, 8 underwent anterior urethroplasty, and 10 underwent transurethral plasma incision for urethral stricture. Of the 12 cases with residual prostate tissue, 5 underwent urethral plasma prostatectomy and 7 received medication. All of the 12 cases with bladder neck contracture underwent transurethral plasma incision of the bladder neck and local drug injection. Five cases with intravesical blood clots underwent urethral blood clot irrigation, 2 of which developed active bleeding and then underwent electrocoagulation. Four cases with detrusor dysfunction had catheters re-indwelled for one week followed by medication. Two cases with stone and one case with tissue fragment impacted in the urethra underwent urethral holmium lithotripsy and cystoscopic removal. All patients underwent reoperation successfully and experienced complete resolution or significant improvement of urinary difficulties. Conclusion A certain proportion of patients experience dysuria after HoLEP, with diverse etiologies. The combination of prevention and treatment can reduce the incidence of dysuria.

Intraoperative cell salvage (IOCS) has been widely applied as an important blood conservation measure in surgical operations. However, there is currently a lack of clinical practice guidelines for the implementation of IOCS in patients with malignant tumors. This report aims to provide clinicians with recommendations on the use of IOCS in patients with malignant tumors based on the review and assessment of the existed evidence. Data were derived from databases such as PubMed, Embase, the Cochrane Library and Wanfang. The guideline development team formulated recommendations based on the quality of evidence, balance of benefits and harms, patient preferences, and health economic assessments. This study constructed seven major clinical questions. The main conclusions of this guideline are as follows: 1) Compared with no perioperative allogeneic blood transfusion (NPABT), perioperative allogeneic blood transfusion (PABT) leads to a more unfavorable prognosis in cancer patients (Recommended); 2) Compared with the transfusion of allogeneic blood or no transfusion, IOCS does not lead to a more unfavorable prognosis in cancer patients (Recommended); 3) The implementation of IOCS in cancer patients is economically feasible (Recommended); 4) Leukocyte depletion filters (LDF) should be used when implementing IOCS in cancer patients (Strongly Recommended); 5) Irradiation treatment of autologous blood to be reinfused can be used when implementing IOCS in cancer patients (Recommended); 6) A careful assessment of the condition of cancer patients (meeting indications and excluding contraindications) should be conducted before implementing IOCS (Strongly Recommended); 7) Informed consent from cancer patients should be obtained when implementing IOCS, with a thorough pre-assessment of the patient's condition and the likelihood of blood loss, adherence to standardized internally audited management procedures, meeting corresponding conditions, and obtaining corresponding qualifications (Recommended). In brief, current evidence indicates that IOCS can be implemented for some malignant tumor patients who need allogeneic blood transfusion after physician full evaluation, and LDF or irradiation should be used during the implementation process.

[Objective] To analyze the effects of different factors and red blood cell transfusion thresholds on the efficacy of neonatal red blood cell (RBC) transfusion, in order to provide more references for neonatal transfusions to better achieve rational and effective blood use. [Methods] A retrospective collection of data from 282 neonates who received RBC transfusions at our hospital from 2022 to 2023 was conducted, including birth weight, gestational age, number of blood transfusions, length of hospital stay, assisted ventilation during RBC transfusion, and laboratory test results before and after transfusion. SPSS software was used for statistical analysis to comprehensively analyze the impact of different factors on the efficacy of RBC transfusion in neonates. [Results] The results showed that the gestational age and weight of newborns at birth were negatively correlated with their length of hospital stay and the number of RBC transfusions during hospitalization. Newborns with younger gestational age and lower weight had longer hospital stays and more RBC transfusions during hospitalization. After administering RBCs according to the standard of 15 mL/kg, there was a statistically significant difference in the efficacy of RBC transfusion at different transfusion thresholds. In non-critical situations, RBC transfusions were ineffective when the pre-transfusion hemoglobin (Hb) level was >120 g/L. When the pre-transfusion Hb level was ≤70 g/L, RBC transfusions achieved higher efficacy in both critical and non-critical situations. [Conclusion] In critical situations, the group with pre-transfusion Hb values ≤ 70 g/L has the best RBC transfusion effect, while in non-critical situations, the group with pre-transfusion Hb levels between 81 and 90 g/L has the best RBC transfusion effect. Overall, the efficacy of RBC transfusion in non-critical situations is higher than that in critical situations.

Objective To investigate the changes in the prevalence of Babesia microti infections, spleen morphology and proportions of splenic immune cells in BALB/c mice following intravenous and intraperitoneal injections, so as to provide insights into unraveling the immune regulatory mechanisms of Babesia infections. Methods Laboratory - maintained B. microti strains were prepared into whole blood samples with 10% prevalence of B. microti infection. A total of 75 BALB/c mice were randomly divided into three groups, including the normal control group, intravenous injection group, and intraperitoneal injection group, of 25 mice in each group. Mice in the intravenous and intraperitoneal injection groups were administered 100 μL of whole blood samples with 10% prevalence of B. microti infection, with the day of injection recorded as d0, and animals in the normal control group were given no treatments. Blood was sampled from mice in each group via the tail tip on d7, d14, d21, d28 and d35, and prepared into thin-film blood smears, and B. microti infection was observed in red blood cells. Five mice were randomly sampled from each group and sacrificed on d7, d14, d21, d28 and d35, and spleen was collected for measurement of spleen size and weight. In addition, splenic cells were isolated, and the proportions of CD3e⁺ T cells, CD45R⁺ B cells, CD49b⁺ nature killer (NK) cells, and F4/80⁺ macrophages were detected in CD45⁺ lymphocytes using flow cytometry. Results The prevalence of B. microti infection in the intravenous (22.80%) and intraperitoneal injection groups (44.82%) peaked on d7 (χ² = 8.141, P < 0.01) and then rapidly decreased, and no parasites were observed on d35. The longest mouse spleen length [(32.91 ± 2.20) mm] and width [(9.82 ± 0.43) mm], and the greatest weight [(0.78 ± 0.10) g] were found on d14 in the intravenous injection group, and the longest spleen length [(32.42 ± 3.21) mm] and width [(10.25 ± 0.73) mm], and the greatest weight [(0.73 ± 0.09) g] were seen in the intra-peritoneal injection group on d21, d7 and d14, respectively. There were significant differences among the intravenous injection group, intraperitoneal injection group and the normal control group in terms of spleen length (F = 10.310, P < 0.05), width (F = 9.824, P < 0.05), and weight (F = 10.672, P < 0.05) on d21, and the mouse spleen length, width and weight were all significantly greater in the intraperitoneal injection group than in the intravenous injection group (allP values < 0.05). The proportions of splenic CD3e⁺ T cells [(60.60 ± 6.20)% and (39.68 ± 7.62)%], CD45R⁺ B cells [(43.32 ± 2.08)% and (49.53 ± 4.90)%], CD49b⁺ NK cells [(6.88 ± 1.34)% and (7.71 ± 1.59)%], and F4/80⁺ macrophages [(2.21 ± 0.29)% and (3.80 ± 0.35)%] peaked on d14, d21, d21 and d14 in the intravenous and intraperitoneal injection groups, respectively. There were significant differences in the proportions of CD3e⁺ T cells (F = 16.730, P < 0.05) and F4/80⁺ macrophages (F = 15.941, P < 0.05) among the intravenous injection group, intraperitoneal injection group and normal control group on d14, and a higher proportion of CD3e⁺ T cells and a lower proportion of F4/80⁺ macrophages were detected in the intravenous injection group than in the intraperitoneal injection group (both P values < 0.01). There were significant differences among the intravenous injection group, intraperitoneal injection group and normal control group on d21 in terms of proportions of splenic CD3e⁺ T cells (F = 9.252, P < 0.05), CD45R⁺ B cells (F = 14.349, P < 0.05), CD49b⁺ NK cells (F = 13.436,P < 0.05), and F4/80⁺ macrophages (F = 8.180, P < 0.05), and a higher proportion of CD3e⁺ T cells and lower proportions of CD45R⁺ B cells and F4/80⁺ macrophages were detected in the intravenous injection group than in the intraperitoneal injection group (all P values < 0.01). In addition, there was a significant difference in the proportion of CD3e⁺ T cells among the intravenous injection group, intraperitoneal injection group and normal control group on d28 (F = 9.772,P < 0.05), and a lower proportion of CD3e⁺ T cells was found in the intravenous injection group than in the intraperitoneal injection group (P < 0.01). Conclusions Both intraperitoneal and intravenous routes are effective to induce B. microti infections in BALB/c mice, and the prevalence of B. microti infections is higher in BALB/c mice through the intraperitoneal route than through the intravenous route. Intraperitoneal and intravenous injections with B. microti cause diverse spleen morphologies and proportions of splenic immune cells in mice, indicating routes of B. microti infections cause different impacts on immune response mechanisms in mice.

[Objective] To retrospectively analyse the serological characteristics of hemolytic transfusion reactions caused by Rh and Kidd antibodies, and to provide reference for safe, timely, and effective blood transfusion. [Methods] Two cases of patients with RhCcEe and Kidd blood type who experienced allogeneic transfusion at Dazhou Central Hospital were selected. A series of immunohematological tests were performed, including ABO, RhDCcEe and Kidd blood typing, unexpected antibody screening and identification, crossmatching, direct antiglobulin test, acid elution test, and capillary centrifugation to separate the patient's own red blood cells from donated red blood cells. [Results] Unexpected antibody screening, antibody identification, and direct antiglobulin test were positive in both patients. Case 1 had anti-Jk in the plasma, but no specific antibodies were found in the eluate. Case 2 had anti-c and E in the plasma, and anti-E was detected in the eluate. High-speed capillary centrifugation revealed corresponding antigen-positive erythrocytes at the distal end of the blood samples of both patients. [Conclusion] Case 1 received Kidd allogeneic red blood cells, and case 2 received RhCcEe allogeneic red blood cells, and both patients developed the corresponding unexpected antibodies, which led to the occurrence of immune haemolytic blood transfusion reaction.