1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.The efficacy of oral solution of magnesium sodium potassium sulfate in bowel preparation before colonoscopy
Xin HUANG ; Rujie YANG ; Feng QIN ; Shilian ZHANG ; Xin WU ; Xiaoyan YIN
Journal of Pharmaceutical Practice and Service 2026;44(2):85-87
Objective To explore the efficacy and safety of oral solution of magnesium sodium potassium sulfate in bowel preparation before colonoscopy. Methods Patients who planned to undergo colonoscopy at the digestive department of the Ninth People’s Hospital, affiliated to School of Medicine of Shanghai Jiao Tong University from January 2023 to August 2023 were selected and eligible subjects were divided into two groups: Group A took polyethylene glycol (PEG) and Group B took oral solution of magnesium sodium potassium sulfate (OSS). The quality, drug tolerance, and safety of intestinal preparation were evaluated. The quality of bowel preparation was evaluated by the boston bowel preparation scale (BBPS). Results The right colon BBPS score of Group B was (2.39±0.82) points, which was significantly higher than of Group A (2.11±0.43) points (P<0.05). The overall score of Group B was higher than that of Group A (P<0.05). OSS was easier to take than PEG, with a good taste and overall sensation. Patients were willing to use OSS to clean their bowels even when they were willing to undergo another examination (P<0.05). There was a significant difference in nausea and vomiting symptoms between the two groups (P<0.05), and there were no significant changes in renal function and electrolytes before and after medication in the two groups of patients. Conclusion OSS had a higher quality of bowel cleaning and was easier for patients to accept.
3.Umbrella decision-making model for diagnosis and treatment of elderly lung cancer patients: Construction and practice
Lunxu LIU ; Jian ZHOU ; Xiang DING ; Nan CHEN ; Jianxin XUE ; Xuelei MA ; Ye WANG ; Weiya WANG ; Liqing PENG ; Xin YOU ; Minggang SU ; Xu CHENG ; Jiao WANG ; Ning GE ; Deying KANG ; Yuchen HUANG ; Jinghan WANG ; Yu TONG ; Yaoxi ZHANG ; Jirong YUE ; Hu LIAO
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2026;33(06):833-839
With the accelerating trend of population aging, the number of elderly patients with lung cancer continues to rise, and the disease burden is becoming increasingly heavy. The clinical management of these patients faces severe challenges due to their decreased physiological reserve, complex comorbidities, and significant individual heterogeneity. Consequently, under traditional diagnosis and treatment models, doctors often struggle to identify the individualized risks of elderly patients in a timely and comprehensive manner, which can easily lead to decision biases such as undertreatment or overtreatment. In view of this, this study advocates for the establishment of an umbrella decision-making model specifically tailored for elderly lung cancer patients. Grounded in a multidisciplinary team (MDT) platform, this model deeply integrates oncological indicators with the comprehensive geriatric assessment (CGA) system. By holistically considering multidimensional variables including tumor burden, organ function, frailty index, cognitive status, and social support, the model establishes an operational mechanism characterized by "single entry, precise stratification, and targeted selection". Accordingly, patients can be scientifically triaged into distinct intervention tiers, such as active surveillance, minimally invasive surgery, drug therapy, radiotherapy, and best supportive care, thereby achieving real-time alignment between treatment intensity and patient fitness. This article elaborates on the construction logic and key operational procedures of this novel decision-making framework, aiming to guide clinical practice beyond the limitations of a tumor-centric perspective toward a holistic, dynamic, whole-course management strategy. This transition seeks to ensure optimal quality of life and clinical net benefit for elderly patients alongside survival prolongation.
4.Structural and Functional Abnormalities of White-matter Tracts in Male College Smokers
Xiao-Jiao LI ; Da-Hua YU ; Ting XUE ; Kai YUAN ; Zhen-Zhen MAI ; Xu-Wen WANG ; Fang DONG ; Juan WANG ; Yu-Xin MA
Progress in Biochemistry and Biophysics 2026;53(6):1770-1779
ObjectiveThe present study aimed to investigate alterations in white matter microstructure and spontaneous neural activity in male college smokers, and to further explore their associations with nicotine dependence. Given that adolescence and early adulthood represent critical periods for brain maturation, particularly for white matter development, understanding the neural correlates of smoking behavior during this stage is of substantial importance for both neuroscience and public health. MethodsA total of 115 male undergraduate students were initially recruited for this study. After quality control and exclusion procedures, 52 male college smokers and 42 demographically matched healthy non-smokers were included in the final analysis. All participants underwent multimodal magnetic resonance imaging (MRI), including diffusion tensor imaging (DTI) and resting-state functional MRI (rs-fMRI). White matter fiber tracts were reconstructed using the automated fiber quantification (AFQ) method, which enables precise identification and quantification of major fiber bundles. Eighteen major white matter tracts were segmented for each participant. Along the core trajectory of each tract, 100 equidistant nodes were sampled. Fractional anisotropy (FA) was calculated at each node to assess white matter microstructural integrity, while amplitude of low-frequency fluctuation (ALFF) was computed to evaluate spontaneous neural activity within white matter tracts. Between-group differences in FA and ALFF were assessed using two-sample t-tests, with appropriate corrections applied for multiple comparisons. Furthermore, Pearson correlation analyses were conducted to examine the relationships between imaging-derived metrics (FA and ALFF values in regions showing significant group differences) and nicotine dependence severity, as measured by the Fagerström test for nicotine dependence (FTND). ResultsCompared with healthy non-smokers, male college smokers exhibited significantly increased FA values in several white matter tracts, including the left thalamic radiation, right corticospinal tract, forceps major of the corpus callosum, left uncinate fasciculus, and right arcuate fasciculus. These findings suggest altered microstructural organization or increased directional coherence within these pathways. In addition, smokers demonstrated significantly elevated ALFF values in the forceps major, right uncinate fasciculus, and left arcuate fasciculus, indicating enhanced spontaneous neural activity in these white matter regions. Correlation analyses revealed that FA values in the left thalamic radiation and right corticospinal tract were negatively correlated with FTND scores, suggesting that higher levels of nicotine dependence were associated with reduced microstructural integrity or altered fiber organization in these regions. In contrast, ALFF values in the forceps major and right uncinate fasciculus were positively correlated with FTND scores, indicating that greater nicotine dependence was associated with increased spontaneous neural activity in specific white matter pathways. ConclusionThe present study provides evidence that male college smokers exhibit distinct alterations in both white matter microstructure and functional activity. These abnormalities are not uniformly distributed but rather localized to specific fiber tracts implicated in sensorimotor processing, interhemispheric communication, and higher-order cognitive and emotional regulation. Importantly, the observed associations between imaging metrics and nicotine dependence severity suggest that these structural and functional alterations may reflect neurobiological mechanisms underlying addiction. The combination of AFQ-based tract profiling and multimodal MRI offers a sensitive approach for detecting subtle changes along white matter pathways, highlighting its potential utility in identifying neuroimaging biomarkers of nicotine dependence. Overall, these findings indicate that smoking during early adulthood may disrupt ongoing white matter maturation, potentially leading to long-term consequences for brain function. This study provides novel insights into the neural basis of nicotine dependence and underscores the importance of early intervention and prevention strategies targeting young smokers.
5.Evaluation system for standardized surgery in elderly patients with lung cancer
Xingqi MI ; Nan CHEN ; Jiandong MEI ; Hecheng LI ; Shuguang ZHANG ; Huanwen CHEN ; Peng JIAO ; Jun WANG ; Chunfang ZHANG ; Guangjian ZHANG ; Xin LI ; Qiang PU ; Peng LIN ; Lunxu LIU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2026;33(06):866-873
To address the growing challenge of an increasing number of elderly lung cancer patients amidst China's aging population and to fill the gap in quality control standards for surgical treatment in this special population, this study aimed to develop a standardized surgical evaluation system for elderly lung cancer patients tailored to China's national conditions. The system was established through a literature review, integrated the pathophysiological characteristics of elderly patients, and was constructed following review, feedback, and revision by experts from multiple thoracic surgery centers. Employing a 100-point scoring system, it comprises three primary domains: physical infrastructure and geriatric adaptability foundational conditions (10 points); management level and perioperative care models (20 points); and technical proficiency and clinical outcomes (70 points). The system places a strong emphasis on geriatric adaptability, proposing specific, quantifiable indicators for age-friendly facility modifications, control of elderly-specific complications, multidisciplinary collaboration, and standardized perioperative management. It provides a convenient and measurable assessment tool for quality control in the surgical treatment of elderly lung cancer in China, which is expected to promote the standardization and homogenization of diagnosis and treatment.
6.Etiology and treatment of dysuria shortly after holmium laser enucleation of the prostate: a report of 98 cases
Chao LU ; Xin GU ; Wenfeng LI ; Chong LIU ; Bao HUA ; Jiangyi WANG ; Minkai XIE ; Yiwei WANG ; Qing YANG
Journal of Modern Urology 2026;31(5):435-439
Objective To investigate the etiology and treatment of dysuria shortly after holmium laser enucleation of the prostate (HoLEP) for benign prostatic hyperplasia (BPH), so as to improve the therapeutic efficacy. Methods A retrospective analysis was conducted on 1361 BPH patients who received HoLEP at our hospital during Mar. 2018 and Mar. 2025. All patients underwent ultrasound, computed tomography (CT), urethral probing or radiography, cystourethroscopy, and urodynamic testing. The causes, treatments and prognosis of dysuria after operation were summarized. Results ninety-eight patients (7.2%) experienced dysuria within 3 months after surgery, and all patients received initial urethral dilation. Among the 62 cases with urethral stricture, 28 were treated with urethral dilation (average of 8 sessions), 16 underwent external urethral incision, 8 underwent anterior urethroplasty, and 10 underwent transurethral plasma incision for urethral stricture. Of the 12 cases with residual prostate tissue, 5 underwent urethral plasma prostatectomy and 7 received medication. All of the 12 cases with bladder neck contracture underwent transurethral plasma incision of the bladder neck and local drug injection. Five cases with intravesical blood clots underwent urethral blood clot irrigation, 2 of which developed active bleeding and then underwent electrocoagulation. Four cases with detrusor dysfunction had catheters re-indwelled for one week followed by medication. Two cases with stone and one case with tissue fragment impacted in the urethra underwent urethral holmium lithotripsy and cystoscopic removal. All patients underwent reoperation successfully and experienced complete resolution or significant improvement of urinary difficulties. Conclusion A certain proportion of patients experience dysuria after HoLEP, with diverse etiologies. The combination of prevention and treatment can reduce the incidence of dysuria.
7.Adolescent Smoking Addiction Diagnosis Based on TI-GNN
Xu-Wen WANG ; Da-Hua YU ; Ting XUE ; Xiao-Jiao LI ; Zhen-Zhen MAI ; Fang DONG ; Yu-Xin MA ; Juan WANG ; Kai YUAN
Progress in Biochemistry and Biophysics 2025;52(9):2393-2405
ObjectiveTobacco-related diseases remain one of the leading preventable public health challenges worldwide and are among the primary causes of premature death. In recent years, accumulating evidence has supported the classification of nicotine addiction as a chronic brain disease, profoundly affecting both brain structure and function. Despite the urgency, effective diagnostic methods for smoking addiction remain lacking, posing significant challenges for early intervention and treatment. To address this issue and gain deeper insights into the neural mechanisms underlying nicotine dependence, this study proposes a novel graph neural network framework, termed TI-GNN. This model leverages functional magnetic resonance imaging (fMRI) data to identify complex and subtle abnormalities in brain connectivity patterns associated with smoking addiction. MethodsThe study utilizes fMRI data to construct functional connectivity matrices that represent interaction patterns among brain regions. These matrices are interpreted as graphs, where brain regions are nodes and the strength of functional connectivity between them serves as edges. The proposed TI-GNN model integrates a Transformer module to effectively capture global interactions across the entire brain network, enabling a comprehensive understanding of high-level connectivity patterns. Additionally, a spatial attention mechanism is employed to selectively focus on informative inter-regional connections while filtering out irrelevant or noisy features. This design enhances the model’s ability to learn meaningful neural representations crucial for classification tasks. A key innovation of TI-GNN lies in its built-in causal interpretation module, which aims to infer directional and potentially causal relationships among brain regions. This not only improves predictive performance but also enhances model interpretability—an essential attribute for clinical applications. The identification of causal links provides valuable insights into the neuropathological basis of addiction and contributes to the development of biologically plausible and trustworthy diagnostic tools. ResultsExperimental results demonstrate that the TI-GNN model achieves superior classification performance on the smoking addiction dataset, outperforming several state-of-the-art baseline models. Specifically, TI-GNN attains an accuracy of 0.91, an F1-score of 0.91, and a Matthews correlation coefficient (MCC) of 0.83, indicating strong robustness and reliability. Beyond performance metrics, TI-GNN identifies critical abnormal connectivity patterns in several brain regions implicated in addiction. Notably, it highlights dysregulations in the amygdala and the anterior cingulate cortex, consistent with prior clinical and neuroimaging findings. These regions are well known for their roles in emotional regulation, reward processing, and impulse control—functions that are frequently disrupted in nicotine dependence. ConclusionThe TI-GNN framework offers a powerful and interpretable tool for the objective diagnosis of smoking addiction. By integrating advanced graph learning techniques with causal inference capabilities, the model not only achieves high diagnostic accuracy but also elucidates the neurobiological underpinnings of addiction. The identification of specific abnormal brain networks and their causal interactions deepens our understanding of addiction pathophysiology and lays the groundwork for developing targeted intervention strategies and personalized treatment approaches in the future.
8.Expert consensus on apical microsurgery.
Hanguo WANG ; Xin XU ; Zhuan BIAN ; Jingping LIANG ; Zhi CHEN ; Benxiang HOU ; Lihong QIU ; Wenxia CHEN ; Xi WEI ; Kaijin HU ; Qintao WANG ; Zuhua WANG ; Jiyao LI ; Dingming HUANG ; Xiaoyan WANG ; Zhengwei HUANG ; Liuyan MENG ; Chen ZHANG ; Fangfang XIE ; Di YANG ; Jinhua YU ; Jin ZHAO ; Yihuai PAN ; Shuang PAN ; Deqin YANG ; Weidong NIU ; Qi ZHANG ; Shuli DENG ; Jingzhi MA ; Xiuping MENG ; Jian YANG ; Jiayuan WU ; Yi DU ; Junqi LING ; Lin YUE ; Xuedong ZHOU ; Qing YU
International Journal of Oral Science 2025;17(1):2-2
Apical microsurgery is accurate and minimally invasive, produces few complications, and has a success rate of more than 90%. However, due to the lack of awareness and understanding of apical microsurgery by dental general practitioners and even endodontists, many clinical problems remain to be overcome. The consensus has gathered well-known domestic experts to hold a series of special discussions and reached the consensus. This document specifies the indications, contraindications, preoperative preparations, operational procedures, complication prevention measures, and efficacy evaluation of apical microsurgery and is applicable to dentists who perform apical microsurgery after systematic training.
Microsurgery/standards*
;
Humans
;
Apicoectomy
;
Contraindications, Procedure
;
Tooth Apex/diagnostic imaging*
;
Postoperative Complications/prevention & control*
;
Consensus
;
Treatment Outcome
9.Expert consensus on early orthodontic treatment of class III malocclusion.
Xin ZHOU ; Si CHEN ; Chenchen ZHOU ; Zuolin JIN ; Hong HE ; Yuxing BAI ; Weiran LI ; Jun WANG ; Min HU ; Yang CAO ; Yuehua LIU ; Bin YAN ; Jiejun SHI ; Jie GUO ; Zhihua LI ; Wensheng MA ; Yi LIU ; Huang LI ; Yanqin LU ; Liling REN ; Rui ZOU ; Linyu XU ; Jiangtian HU ; Xiuping WU ; Shuxia CUI ; Lulu XU ; Xudong WANG ; Songsong ZHU ; Li HU ; Qingming TANG ; Jinlin SONG ; Bing FANG ; Lili CHEN
International Journal of Oral Science 2025;17(1):20-20
The prevalence of Class III malocclusion varies among different countries and regions. The populations from Southeast Asian countries (Chinese and Malaysian) showed the highest prevalence rate of 15.8%, which can seriously affect oral function, facial appearance, and mental health. As anterior crossbite tends to worsen with growth, early orthodontic treatment can harness growth potential to normalize maxillofacial development or reduce skeletal malformation severity, thereby reducing the difficulty and shortening the treatment cycle of later-stage treatment. This is beneficial for the physical and mental growth of children. Therefore, early orthodontic treatment for Class III malocclusion is particularly important. Determining the optimal timing for early orthodontic treatment requires a comprehensive assessment of clinical manifestations, dental age, and skeletal age, and can lead to better results with less effort. Currently, standardized treatment guidelines for early orthodontic treatment of Class III malocclusion are lacking. This review provides a comprehensive summary of the etiology, clinical manifestations, classification, and early orthodontic techniques for Class III malocclusion, along with systematic discussions on selecting early treatment plans. The purpose of this expert consensus is to standardize clinical practices and improve the treatment outcomes of Class III malocclusion through early orthodontic treatment.
Humans
;
Malocclusion, Angle Class III/classification*
;
Orthodontics, Corrective/methods*
;
Consensus
;
Child
10.Expert consensus on management of instrument separation in root canal therapy.
Yi FAN ; Yuan GAO ; Xiangzhu WANG ; Bing FAN ; Zhi CHEN ; Qing YU ; Ming XUE ; Xiaoyan WANG ; Zhengwei HUANG ; Deqin YANG ; Zhengmei LIN ; Yihuai PAN ; Jin ZHAO ; Jinhua YU ; Zhuo CHEN ; Sijing XIE ; He YUAN ; Kehua QUE ; Shuang PAN ; Xiaojing HUANG ; Jun LUO ; Xiuping MENG ; Jin ZHANG ; Yi DU ; Lei ZHANG ; Hong LI ; Wenxia CHEN ; Jiayuan WU ; Xin XU ; Jing ZOU ; Jiyao LI ; Dingming HUANG ; Lei CHENG ; Tiemei WANG ; Benxiang HOU ; Xuedong ZHOU
International Journal of Oral Science 2025;17(1):46-46
Instrument separation is a critical complication during root canal therapy, impacting treatment success and long-term tooth preservation. The etiology of instrument separation is multifactorial, involving the intricate anatomy of the root canal system, instrument-related factors, and instrumentation techniques. Instrument separation can hinder thorough cleaning, shaping, and obturation of the root canal, posing challenges to successful treatment outcomes. Although retrieval of separated instrument is often feasible, it carries risks including perforation, excessive removal of tooth structure and root fractures. Effective management of separated instruments requires a comprehensive understanding of the contributing factors, meticulous preoperative assessment, and precise evaluation of the retrieval difficulty. The application of appropriate retrieval techniques is essential to minimize complications and optimize clinical outcomes. The current manuscript provides a framework for understanding the causes, risk factors, and clinical management principles of instrument separation. By integrating effective strategies, endodontists can enhance decision-making, improve endodontic treatment success and ensure the preservation of natural dentition.
Humans
;
Root Canal Therapy/adverse effects*
;
Consensus
;
Root Canal Preparation/adverse effects*

Result Analysis
Print
Save
E-mail