ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveColorectal cancer (CRC) is a highly heterogeneous malignancy, and traditional Chinese medicine (TCM) syndrome differentiation is widely used in its clinical management. However, the biological basis underlying different TCM syndromes remains insufficiently understood. This study aimed to investigate the proteomic differences between qi-blood deficiency syndrome (QBDS) and damp-heat syndrome (DHS) in CRC patients and to establish a “syndrome-differential protein-herbal component” network for exploring potential molecular mechanisms and therapeutic targets associated with syndrome-specific treatment strategies. MethodsTumor tissue samples were collected from 10 patients with pathologically confirmed CRC, including 5 patients diagnosed with QBDS and 5 with DHS according to standardized TCM syndrome differentiation criteria. Tandem mass tag (TMT)-based quantitative proteomics was employed to identify differentially expressed proteins (DEPs) between the two syndrome groups. Functional enrichment analyses, including Gene Ontology (GO) annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses, were performed to characterize the biological functions and signaling pathways associated with the identified DEPs. Least absolute shrinkage and selection operator (LASSO) regression analysis was further applied to screen key syndrome-related proteins and construct a core protein prediction model. Subsequently, molecular docking was conducted to evaluate the binding affinities between representative herbal compounds, astragaloside IV and berberine, and the identified core proteins. Finally, cell counting kit-8 (CCK-8) assays were performed in HCT 116 and HT-29 colorectal cancer cell lines to validate the anti-proliferative activities of these compounds in vitro. ResultsA total of 44 DEPs were identified between QBDS and DHS tissues, including 21 upregulated and 23 downregulated proteins in the QBDS group relative to the DHS group. Functional enrichment analyses revealed that these proteins were primarily associated with antiviral immune responses, regulation of inflammatory signaling, NF‑κB signaling pathways, cholesterol metabolism, and other biological processes relevant to tumor progression and host immune regulation. LASSO regression analysis identified eight core proteins with potential syndrome-specific significance. Among them, ST7, GPCPD1, and PODXL were closely associated with QBDS, whereas FAT1, GRB7, KRT7, MAFF, and MMP8 were associated with DHS. Molecular docking demonstrated favorable interactions between astragaloside IV and QBDS-related proteins, with binding energies lower than -5 kcal/mol, indicating stable binding activity. Berberine exhibited even lower binding energies and stronger binding specificity toward DHS-related core proteins. In vitro experiments further confirmed that both compounds inhibited CRC cell proliferation, while berberine displayed significantly greater anti-proliferative efficacy. The lowest 48 h IC₅₀ value of berberine reached 15.21 mg/L in CRC cells, indicating a stronger growth-inhibitory effect than astragaloside IV. ConclusionCRC patients with QBDS and DHS exhibit distinct proteomic characteristics, suggesting that different TCM syndromes possess unique molecular signatures. The identified core proteins may serve as potential biomarkers for syndrome differentiation, while astragaloside IV and berberine may exert therapeutic effects through targeting syndrome-specific molecular networks. These findings provide preliminary proteomic evidence supporting syndrome-guided precision integrative medicine in CRC and offer new insights into the biological basis of TCM syndrome differentiation and individualized therapeutic strategies.

[Objective] To explore the temperature parameters affecting the polybrene test and determine the optimal temperature conditions for detecting unexpected antibodies of the Rh system. [Methods] The reaction of IgG human anti-D antibody with different dilutions (undiluted, 1∶2, 1∶4, 1∶8, 1∶16, 1∶32，1∶64) with D antigen-positive red blood cells was detected by manual polybrene test (MPT). Different temperatures (25℃ and 37℃) were set, and the reaction time with low ionic medium was 4 minutes. The agglutination integral value of anti-D and red cell depolymerization time were compared to observe the effect of enhanced agglutination reaction, thereby establishing the test temperature reaction conditions for enhancing the MPT. The same reaction condition was applied to 36 blood samples containing unexpected antibodies of the Rh system, and the effect of enhanced MPT was observed in comparison with the polybrene method and the antiglobulin test (column agglutination). [Results] With all other conditions held constant, when low ionic medium was added, the incubation temperature of 25℃ and 37℃ resulted in different total agglutination integral values for anti-D (20.9±2.025 vs 25.5±2.635), and the comparison showed a significant difference (P<0.05). When the antibody dilution was 1∶16, the incubation temperature of 25℃ and 37℃ resulted in different agglutination integral values (3.9±0.738 vs 5.8±0.632), and the comparison showed a significant difference (P<0.05). Erythrocyte depolymerization time (62.8±8.149 vs 90.1±10.713) was significantly different (P<0.05). At a dilution of 1∶32, the incubation temperatures of 25℃ and 37℃ resulted in different agglutination integral values (2.5±0.527 vs 4.3±0.675), as well as different red blood cell dissociation times (35.4±7.792 vs 57.4±10.885)(P<0.05), and the comparison showed a significant difference (P<0.05), with no differences observed in the other groups. In the detection of 36 Rh system unexpected antibody samples, when the antibody titer was ≤2, the enhanced polybrene method had a higher positive rate, and when the antibody titer was ≥4, the detection rates of the three methods were consistent. [Conclusion] The reference temperature condition for the modified MPT is incubation at 37℃ for 4 min after the addition of low ionic medium. The application of this temperature condition to unexpected antibody samples of Rh system could achieve a significant enhancement effect, thereby increasing transfusion safety for the treatment of emergency patients, and is worth popularizing.

Paraplegia caused by spinal cord injury is a serious neurological complication, for which surgery is currently the main treatment method. Due to different surgical approaches, patients are usually expected to maintain a passive prone position for a long time or switch between the supine and prone positions. Affected by multiple factors such as neurogenic sensory disorders, pathological changes in muscle tone and operative duration, the risk of intraoperative acquired pressure injury (IAPI) is significantly increased. Current clinical prevention strategies for IAPI in these patients predominantly focus on localized pressure relief during positioning, lacking systematic, standardized comprehensive prevention protocols or evidence-based guidelines. To address it, Department of Nursing, Orthopedics Branch, China International Exchange and Promotive Association for Medical and Health Care, Spinal Trauma Professional Committee, Orthopedics Branch, Chinese Medical Doctor Association, Nursing Group of Spine and Spinal Cord Professional Committee of Chinese Association of Rehabilitation Medicine organized experts in relevant fields to formulate Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury ( version 2025), based on evidence-based medical evidence and latest research results and clinical practice at home and abroad. Eleven recommendations were put forward from the aspects of preoperative risk assessment, intraoperative prevention strategies, postoperative handover and monitoring, and supportive mechanisms for IAPI prevention, aiming to standardize the prevention measures and management strategies of IAPI in paraplegic patients with spinal cord injury and accelerate the recovery of patients and improve the therapeutic effect.

Objective:To assess the feasibility of first polar body transfer (PB1T) combined with preimplantation mitochondrial genetic testing for blocking the transmission of a pathogenic mitochondrial DNA 8993T>G mutation.Methods:A Chinese family affected with Leigh syndrome which had attended the Reproductive Medicine Centre of the First Affiliated Hospital of Anhui Medical University in September 2021 was selected as the study subject. Controlled ovarian hyperstimulation was carried out for the proband after completing the detection of the mitochondrial DNA 8993T>G mutation load among the pedigree members. Mature MII oocytes were inseminated by intracytoplasmic sperm injection (ICSI), cultured in vitro for 5 to 6 days to the blastocyst stage, and trophoblastocytes were obtained by microbiopsy. Mitochondrial DNA testing (PGT-MT) and chromosomal aneuploidy (PGT-A) analyses were carried out after whole-genome amplification, and the embryos with zero mutation load were selected for transfer. Amniotic fluid and umbilical cord blood samples were collected during middle pregnancy and after birth respectively for mitochondrial DNA testing to verify the reliability of embryo screening. As an attempt, PB1 with good morphology of MⅡ oocytes was selected for transfer into the enucleated oocytoplasm from healthy donors, followed by ICSI fertilization, blastocyst culture and PGT of embryos using the same procedure. This study has been approved by the Ethics Committee of the First Affiliated Hospital of Anhui Medical University (No. 2021zhyx-B12). Results:An antagonist protocol was used for ovarian stimulation, and a total of 19 oocytes were obtained, of which 14 MⅡ were fertilized by ICSI, and 2 had developed into blastocysts. PGT-MT was carried out on biopsied trophoblastocytes, in which the mitochondrial DNA 8993T>G mutation load was not detected in one embryo, the other was 100% mutated, and the mutation loads of the remaining unfertilized eggs and developmentally arrested embryos ranged from 0% ~ 100%, presenting a clear biased distribution. With fully informed consent, one PGT-MT zero mutation load blastocyst was transferred and clinical pregnancy was achieved. Mitochondrial DNA and chromosomal testing of amniotic fluid cells during middle pregnancy had revealed no abnormalities. The proband had delivered a healthy boy through Caesarean section at 39+ 5 weeks of gestation, and no mutation was detected in the cord blood sample. Five well-formed PBs from 14 eggs were selected for PB1 transfer, followed by ICSI and culture, and two of the reconstituted embryos had formed blastocysts, with none of the above mutations detected in the biopsied samples.Conclusion:The PGT-MT technology can help families affected with mitochondrial diseases to have healthy offspring. PB1 transfer in combination with ICSI and PGT-MT holds the promise of turning waste into treasure and providing an alternative means of fertility for such families.

Objective:To investigate the efficacy of a decellularized extracellular matrix (dECM)-quaternized chitosan (QCS)-gelatin (Gel) composite scaffold loaded with growth factors in repairing diabetic foot wounds in a rat model.Methods:A dECM-QCS-Gel composite scaffold (referred to as GDQ scaffold) was fabricated using a 3D bioprinter. Forty 8-week-old male Sprague-Dawley (SD) rats were selected to establish a diabetic foot wound model with a diameter of approximately 1 cm. Based on the treatment methods for diabetic foot wounds, the rats were divided into five groups: Control group (no treatment), Exosome group (wound covered with exosome suspension), Exosome+GDQ group (wound covered with GDQ scaffold loaded with exosome suspension), GDQ group (wound covered with GDQ scaffold alone), and Growth factor+GDQ group (wound covered with GDQ scaffold loaded with recombinant human basic fibroblast growth factor suspension). The wound healing rate was measured. Histological analysis was performed by HE staining and Masson staining. ELISA kits were used to determine the levels of tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), IL-6, and IL-10 in wound tissues from each group. Protein expression levels of MIP-1 and MIP-2 genes were also assessed.Results:The wound healing rate of the growth factor+GDQ group on the 21st d was 94.89%±1.21%, which was higher than that of the exosome+GDQ group ( P<0.05). With increasing repair time, the expression levels of TNF-α, IL-1β and IL-6 in each group all decreased, while IL-10 increased in all groups ( P<0.05). Among them, the exosome+GDQ group (TNF-α: 46.54±1.26 pg/ml, IL-1β: 225.79±7.29 pg/ml, IL-6: 142.81±4.02 pg/ml and IL-10: 117.36±0.95 pg/ml, P<0.001) and the growth factor+GDQ group (TNF-α : 40.01±1.64 pg/ml, IL-1β: 209.15±2.98 pg/ml, IL-6: 138.50±2.61 pg/ml and IL-10: 127.66±1.23 pg/ml, P<0.05); The levels of TNF-α and IL-1β in the exosome+GDQ group were both lower than those in the exosome+GDQ group ( P<0.05), and IL-10 was higher than that in the exosome+GDQ group ( P<0.05). On the 7th d the control group showed the highest expression levels of MIP-1α and MIP-2. All other groups had lower levels, with the growth factor+GDQ group showing the lowest among them. On the 21st d, the inflammatory protein expression in the growth factor+GDQ group had further decreased and remained lower than in all other experimental groups. Conclusions:The GDQ composite scaffold, when combined with bioactive factors, can synergistically reduce inflammation in diabetic foot wounds and promote wound healing. The scaffold loaded with basic fibroblast growth factor demonstrated superior therapeutic efficacy compared to the scaffold loaded with exosomes.

Objective:This study aimed to explore the molecular mechanisms of the maladaptation of H3N2 influenza virus in chicken embryos, provide a theoretical basis for the restoration of H3N2 influenza vaccine production in chicken embryos.Methods:Samples of respiratory secretions from patients with influenza-like symptoms (Influenza-like Illness, ILI) caused by H3N2 influenza virus were inoculated into chicken embryos and Madin-Darby Canine Kidney cells (MDCK), respectively. After isolating the virus, hemagglutination experiments were conducted to detect hemagglutination titers and hemagglutination inhibition experiments were used to compare antigenic differences; further, whole-genome sequencing of H3N2 influenza virus was performed using second-generation high-throughput gene sequencing (Next Generation High-Throughput Gene Sequencing, NGS), and key amino acid sites of mutations were identified through sequence alignment; combined with sialic acid receptor binding experiments, the differences in the binding of wild-type and mutant receptor binding sites (RBS) to sialic acid receptors were compared; finally, molecular docking and molecular dynamics simulation method were used to explore the specific molecular mechanisms of how mutation sites affect the differences in the affinity of the RBS pocket for sialic acid receptors.Results:The hemagglutination assay result indicated that both chicken embryos and MDCK cells could isolate the influenza virus, and the hemagglutination inhibition test showed that no antigenic differences were produced in the isolated strains. NGS analysis revealed that the H3N2 virus underwent an F195Y mutation in the (RBS) region of the hemagglutinin (HA) protein after adaptation through chicken embryo passages. Receptor-binding experiments demonstrated that the F195Y mutation enhanced the virus′s binding ability to α2, 3-linked sialic acid glycan (Neu5Acα2-3Galβ1-4GlcNAcβ-PAA, 3′SLN), while the mutation did not affect the affinity of the RBS pocket for α2, 6-linked sialic acid glycan (Neu5Acα2-6Galβ1-4GlcNAcβ-PAA, 6′SLN). Molecular docking and molecular dynamics simulation result indicate that the F195Y mutation, by replacing a hydrophobic amino acid with a hydrophilic one, leads to a significant decrease in the structure of the RBS pocket, enhancing the binding stability of the H3N2 influenza virus with α2, 3-sln. This is specifically manifested by an increase in binding time and an increase in the number of hydrogen bonds at the RBS site with the receptor. Furthermore, the F195Y mutation does not alter the binding of the virus to other receptors.Conclusions:The F195Y mutation in the RBS pocket of H3N2 influenza virus is a key site affecting the viral chicken embryo inadaptability.

Patients with novel coronavirus pneumonia enter the recovery period after effective intervention,but the patients in the recovery period may then suffer from multi-system sequelae.Symptomatic treatment is considered as the primary method for the treatment of multi-system sequelae of novel coronavirus infection in modern medicine,and there are no specific effective therapies yet.In the view of traditional Chinese medicine(TCM),novel coronavirus pneumonia can be categorized as damp-toxin pestilence and cold-damp pestilence,and the multi-system sequelae of novel coronavirus pneumonia result from the lingering pathogens,which consume the yin fluid continuously and lead to the injury of kidney yin.Classical formulas of TCM are formulated excellently and exert definite efficacy which have been confirmed by long-term clinical experience.This paper reviewed the literature on the classical formulas of TCM in the treatment of sequelae of novel coronavirus pneumonia.It is concluded that chronic cough,pulmonary fibrosis,dyspnea are the common respiratory disorders associated with novel coronavirus pneumonia,and can be treated separately by Xiao Qinglong Decoction and Xiao Chaihu Decoction,by Maimendong Decoction,Buyang Huanwu Decoction and Bufei Decoction,and by Qianj in Weij ing Decoction for modification.Abdominal pain and diarrhea,and poor appetite are the common digestive disorders associated with novel coronavirus pneumonia,and can be treated separately by Chaihu Guizhi Ganj iang Decoction and Xiao Chaihu Decoction,and by Buzhong Yiqi Decoction and Yiwei Decoction for modification.Neurological headache,sleep disorders,and cognitive dysfunction are the common neurological disorders associated with novel coronavirus pneumonia,and can be treated separately by Guizhi Decoction plus Chuanxiong Cha Tiao Powder,Danggui Sini Decoction,Mahuang Decoction,Guizhi Decoction,Gegen Decoction,Wuzhuyu Decoction,Mahuang Fuzi Xixin Decoction and Lizhong Pills,by Suanzaoren Decoction and Sini Decoction plus Chai Gui Longgu Muli Decoction,and by Renshen Yangrong Decoction and Changpu Yuj in Decoction plus Didang Decoction for modification.Chest tightness and chest pain,and palpitation are the common circulatory disorders associated with novel coronavirus pneumonia,and can be treated separately by Wendan Decoction plus Danshen Decoction and Tao Hong Siwu Decoction,and Shen Fu Decoction plus Guizhi Gancao Longgu Muli Decoction,and by Guizhi Decoction plus Zhi Gancao Decoction and Shengmai Decoction,Shengmai Decoction plus Shengxian Decoction,Huangqi Shengmai Decoction plus Sanj ia Fumai Decoction,Li's Qingshu Yiqi Decoction plus Xue's Wuye Lugen Decoction,and Tao Hong Siwu Decoction plus Xuefu Zhuyu Decoction for modification.The effective formulas screened from the classical formulas of TCM for the treatment of sequelae of novel coronavirus pneumonia from will provide more choices for the treatment of multi-system sequelae after novel coronavirus pneumonia.