AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

[Objective] To explore the temperature parameters affecting the polybrene test and determine the optimal temperature conditions for detecting unexpected antibodies of the Rh system. [Methods] The reaction of IgG human anti-D antibody with different dilutions (undiluted, 1∶2, 1∶4, 1∶8, 1∶16, 1∶32，1∶64) with D antigen-positive red blood cells was detected by manual polybrene test (MPT). Different temperatures (25℃ and 37℃) were set, and the reaction time with low ionic medium was 4 minutes. The agglutination integral value of anti-D and red cell depolymerization time were compared to observe the effect of enhanced agglutination reaction, thereby establishing the test temperature reaction conditions for enhancing the MPT. The same reaction condition was applied to 36 blood samples containing unexpected antibodies of the Rh system, and the effect of enhanced MPT was observed in comparison with the polybrene method and the antiglobulin test (column agglutination). [Results] With all other conditions held constant, when low ionic medium was added, the incubation temperature of 25℃ and 37℃ resulted in different total agglutination integral values for anti-D (20.9±2.025 vs 25.5±2.635), and the comparison showed a significant difference (P<0.05). When the antibody dilution was 1∶16, the incubation temperature of 25℃ and 37℃ resulted in different agglutination integral values (3.9±0.738 vs 5.8±0.632), and the comparison showed a significant difference (P<0.05). Erythrocyte depolymerization time (62.8±8.149 vs 90.1±10.713) was significantly different (P<0.05). At a dilution of 1∶32, the incubation temperatures of 25℃ and 37℃ resulted in different agglutination integral values (2.5±0.527 vs 4.3±0.675), as well as different red blood cell dissociation times (35.4±7.792 vs 57.4±10.885)(P<0.05), and the comparison showed a significant difference (P<0.05), with no differences observed in the other groups. In the detection of 36 Rh system unexpected antibody samples, when the antibody titer was ≤2, the enhanced polybrene method had a higher positive rate, and when the antibody titer was ≥4, the detection rates of the three methods were consistent. [Conclusion] The reference temperature condition for the modified MPT is incubation at 37℃ for 4 min after the addition of low ionic medium. The application of this temperature condition to unexpected antibody samples of Rh system could achieve a significant enhancement effect, thereby increasing transfusion safety for the treatment of emergency patients, and is worth popularizing.

Intraoperative cell salvage (IOCS) has been widely applied as an important blood conservation measure in surgical operations. However, there is currently a lack of clinical practice guidelines for the implementation of IOCS in patients with malignant tumors. This report aims to provide clinicians with recommendations on the use of IOCS in patients with malignant tumors based on the review and assessment of the existed evidence. Data were derived from databases such as PubMed, Embase, the Cochrane Library and Wanfang. The guideline development team formulated recommendations based on the quality of evidence, balance of benefits and harms, patient preferences, and health economic assessments. This study constructed seven major clinical questions. The main conclusions of this guideline are as follows: 1) Compared with no perioperative allogeneic blood transfusion (NPABT), perioperative allogeneic blood transfusion (PABT) leads to a more unfavorable prognosis in cancer patients (Recommended); 2) Compared with the transfusion of allogeneic blood or no transfusion, IOCS does not lead to a more unfavorable prognosis in cancer patients (Recommended); 3) The implementation of IOCS in cancer patients is economically feasible (Recommended); 4) Leukocyte depletion filters (LDF) should be used when implementing IOCS in cancer patients (Strongly Recommended); 5) Irradiation treatment of autologous blood to be reinfused can be used when implementing IOCS in cancer patients (Recommended); 6) A careful assessment of the condition of cancer patients (meeting indications and excluding contraindications) should be conducted before implementing IOCS (Strongly Recommended); 7) Informed consent from cancer patients should be obtained when implementing IOCS, with a thorough pre-assessment of the patient's condition and the likelihood of blood loss, adherence to standardized internally audited management procedures, meeting corresponding conditions, and obtaining corresponding qualifications (Recommended). In brief, current evidence indicates that IOCS can be implemented for some malignant tumor patients who need allogeneic blood transfusion after physician full evaluation, and LDF or irradiation should be used during the implementation process.

Background Kurtosis reflecting noise's temporal structure is an effective metric for evaluating noise-induced hearing loss (NIHL), and its threshold is still unclear. Objective To explore the energy range of kurtosis and the threshold of NIHL induced by kurtosis in this energy rangeMethods Using cross-sectional design, 4631 noise-exposed workers in manufacturing industry were selected. The hearing loss and noise exposure data of each worker were collected. Logistic regression model was used to establish the dose-response relationship between noise exposure and hearing loss and estimate the range of energy effects. Restricted cubic spline model was utilized to analyze the dose-response relationship curves of kurtosis to noise-induced hearing loss (NIHI) and high-frequency noise-induced hearing loss (HFNIHL) under different 8 h equivalent sound levels (L_{EX,8 h}), as well as to estimate the kurtosis effect threshold. Results The logistic regression model analysis showed that the prevalence of NIHI and HFNIHL increased significantly with increase of L_{EX,8 h} for steady noise; when L_{EX,8 h} of non-steady noise was 80-100 dB(A), the risk of hearing loss increased with an increase in kurtosis (P<0.05). The restricted cubic spline model showed that when L_{EX,8 h} of non-steady noise was 0-80 dB(A) or >100 dB(A), there was no significant relationship between kurtosis and NIHI or HFNIHL. When L_{EX,8 h} was 80-100 dB(A), there was a significant nonlinear dose-response relationship between kurtosis and NIHL or HFNIHL (P <0.001), and kurtosis > 28.08 exerted effect in elevating NIHI or HFNIHL. Conclusion The effect threshold of kurtosis on NIHL is 28.08 when non-steady noise levels are in the range of 80-100 dB(A). The effect threshold of kurtosis needs further verification.

Background Temporal kurtosis (without frequency weighting, i.e., Z-weighted kurtosis) can evaluate noise-induced hearing loss (NIHL). However, few studies have considered the function of frequency weighting (A- or C-weighted) kurtosis on NIHL. Objective To study the significance of A- and C-weighted kurtosis adjustment for equivalent sound level (L'_{EX,8 h}) in evaluating occupational hearing loss. Methods A cross-sectional survey was used to select 973 noise-exposed workers in seven industries as the subjects. The noise exposure of all workers was assessed by distributions of A-, C-, and Z-weighted kurtosis (e.g., K_A, K_C, and K_Z) and respective adjusted equivalent sound level (e.g., L'_{EX,8 h}-K_A, L'_{EX,8 h}-K_C, and L'_{EX,8 h}-K_Z). The significance of A- and C-weighted kurtosis in evaluating NIHL was evaluated by correlations between three types of L'_{EX,8 h} and NIHL, and improvement of noise-induced permanent threshold shift (NIPTS) underestimation predicted by the ISO prediction model (Acoustics—Estimation of noise-induced hearing loss, ISO 1999-2013). Results The median K_A, K_C, and K_Z were 68.33, 28.22, and 19.82, respectively. The binary logistic regression showed that L_{EX, 8 h}-K_A, L_{EX, 8 h}-K_C, and L'_{EX, 8 h}-K_Z were risk factors for NIHL (OR>1, P<0.001). The receiver operating characteristic (ROC) curve showed that when the outcome variable was noise-induced hearing impairment (NIHI), the areas under the curves corresponding to L'_{EX,8 h}-K_A, L'_{EX,8 h}-K_C, and L'_{EX,8 h}-K_Z were 0.625, 0.628, and 0.625, respectively. When the outcome variable was high-frequency noise-induced hearing loss (HFNIHL), the areas under the curves corresponding to L'_{EX,8 h}-K_A, L'_{EX, 8 h}-K_C, and L'_{EX,8 h}-K_Z were 0.624, 0.623, and 0.622, respectively (P<0.05). The order of underestimation improvement values predicted by L'_{EX,8 h} for NIPTS₁₂₃₄ was: L'_{EX,8 h}-K_A (4.68 dB HL)>L'_{EX,8 h}-K_C (4.38 dB HL)>L'_{EX,8 h}-K_Z (4.28 dB HL) (P<0.001). The order of underestimation improvement values predicted by L'_{EX,8 h}-K for NIPTS₃₄₆ was: L'_{EX,8 h}-K_A (7.20 dB HL)>L'_{EX,8 h}-K_C (6.83 dB HL)>L'_{EX,8 h}-K_Z (6.71 dB HL) (P<0.001). Conclusion The adjustment of A- and C-weighted kurtosis to equivalent sound level L_{EX,8 h} can effectively improve the accuracy of the ISO 1999 prediction model in NIPTS prediction, and compared with the C-weighted, the A-weighted kurtosis can improve the result of the ISO 1999 prediction model in terms of underestimating NIPTS.

Objective To investigate the effects of fractionated low-dose ionizing radiation (LDIR) on the ferroptosis in human bronchial epithelial (HBE) cells as well as the associated differentially expressed genes (DEGs), biological processes, and signaling pathways. Methods HBE cells were exposed to different single doses of X-ray irradiation (0, 25, 50, 75, and 100 mGy) for 24, 48, and 72 h, respectively. The change in cell viability was detected by MTT assay. Cells were irradiated with 0, 25, 50, and 100 mGy X-rays 5 times, with 48 h between each irradiation and a dose rate of 50 mGy/min. Cells were harvested 24 h after irradiation for the measurement of the expression of ferroptosis-related genes SLC7A11 and GPX4 at the mRNA and protein levels, cellular iron content, and the expression of FTH1 and FTL mRNAs. High-throughput sequencing was used to screen for the DEGs in each dose group, followed by Gene Ontology-Biological Process (GO-BP) analysis, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, and Gene Set Enrichment Analysis (GSEA). Results Compared with the control group, single-dose LDIR significantly increased cell proliferation at 75 mGy after 24 h (P < 0.05), at 50, 75, and 100 mGy after 48 h (P < 0.05), and at 75 and 100 mGy after 72 h (P < 0.05). Compared with the control group, at the end of the fifth fractionated LDIR, SLC7A11 and GPX4 mRNAs decreased at all doses (P < 0.05), SLC7A11 protein decreased at all doses, GPX4 protein decreased at 25 and 100 mGy, iron content increased at all doses, and FTH1 and FTL mRNAs decreased at all doses (P< 0.05). Sequencing analysis identified 248, 30, and 291 DEGs and 10, 2, and 9 ferroptosis-associated genes at the three doses compared to the control. Gene Ontology-Biological Process analysis showed that DEGs were mainly enriched in biological processes such as response to lipids, cell death, and response to unfolded proteins. Kyoto Encyclopedia of Genes and Genomes analysis showed that DEGs were mainly enriched in the JAK-STAT signaling pathway, lipids and atherosclerosis, ferroptosis, protein processing in the endoplasmic reticulum, and FoxO signaling pathway. Gene set enrichment analysis showed that DEGs were mainly enriched in ferroptosis, fatty acid degradation, and glutathione metabolism. Conclusion Fractionated low-dose radiation induced ferroptosis in HBE cells, and DEGs were predominantly enriched in biological processes and signaling pathways related to inflammation, ferroptosis, and endoplasmic reticulum stress.

Background In recent years, the increasingly widespread application of nuclear and medical radiation technologies has resulted in a large number of occupational populations exposed to low-dose ionizing radiation (LDIR). At present, there is no consistent conclusion on the effects of long-term exposure to LDIR on the metabolic health of the occupational population. Objective To explore the association between long-term exposure to LDIR and metabolic syndrome (MetS) among medical radiologists. Methods A cross-sectional study was conducted to enroll 6431 medical radiologists who ordered occupational health checkups from January 2022 to December 2023, and basic information such as demographic characteristics, occupational characteristics, lifestyles, and dietary habits was collected through questionnaires. Physical examinations were conducted using a standardized protocol. Individual dose equivalents of occupational external exposure were monitored by dosimeters worn by medical radiologists. Logistic regression model was used for identifying influencing factors of MetS and sensitivity analysis, and restricted cubic spline model was used to explore the dose-response relationship between cumulative effective dose and MetS. Two-stage linear regression was used to evaluate threshold effect of association between cumulative effective dose and MetS. Results The positive rate of MetS was 13.6% (877/6431) among the enrolled 6431 study participants. The logistic regression showed that gender, age, monthly income, body mass index (BMI), cumulative effective dose, and smoking were influencing factors for MetS. The risk of MetS was higher in males (OR=1.511, 95%CI: 1.209, 1.888); using the < 30 years old group as reference, the risk of MetS was higher in the 30-39 years old (OR=1.509, 95%CI: 1.095, 2.079), 40-49 years old (OR=2.214, 95%CI: 1.551, 3.161), and ≥50 years old (OR=3.480, 95%CI: 2.338, 5.181) groups; using the <10000 yuan group as reference, the risk of MetS was lower in the group with a monthly income of 10000-14999 yuan (OR=0.715, 95%CI: 0.582, 0.878); the risk of MetS was higher in the BMI ≥ 24 kg·m⁻² group (OR=7.548, 95%CI: 6.223, 9.156); using the < 0.76 mSv group as reference, the risk of MetS was higher in the cumulative effective dose of 0.76-2.73 mSv group (OR=1.270, 95%CI: 1.017, 1.586); the risk of MetS was higher in the smoking group (OR=1.734, 95%CI: 1.428, 2.107). The results of restricted cubic spline showed that the cumulative effective dose was nonlinearly correlated with MetS (P _{non-linearity}=0.028), with an inflection point of 1.25 mSv. The risk of developing MetS increased by 34.1% for each unit increase in cumulative effective dose up to 1.25 mSv, whereas above 1.25 mSv, the statistical association was not significant. The sensitivity analysis results showed that after excluding the self-reported hypertensive and diabetic patients, the cumulative effective dose 0.76-2.73 mSv group still had an increased risk of developing MetS compared with the < 0.76 mSv group (P < 0.05), and the results were robust. Conclusion Among medical radiologists, male, age, BMI, and smoking are positively correlated with MetS, and monthly income is negatively correlated with MetS; cumulative effective dose is non-linearly correlated with MetS among medical radiologists.

Objective To investigate the induction of senescence in L02 hepatocytes by low-dose fractionated X-ray radiation and its effects on oxidative stress, oxidative damage, and nuclear factor-κB (NF-κB) pathway protein levels. Methods L02 cells were subjected to fractionated X-ray irradiation at doses of 0.1, 0.2, and 0.5 Gy per fraction for a total of six fractions. Assays were performed 24 hours after the final irradiation. Measurements included SA-β-gal staining, the mRNAs of senescence-related genes p53 and p21 and their encoded proteins, mRNAs of genes encoding senescence-associated secretory phenotype factors (IL-6, IL-8, GM-CSF, MMP-15), reactive oxygen species, oxidative and anti-oxidative markers (malondialdehyde, glutathione, superoxide dismutase), DNA oxidative damage markers (8-OHdG and γ-H2AX), and NF-κB pathway protein levels. Results Compared with the control group, at 24 hours after the end of six irradiations, the number of cells positive in SA-β-gal staining was significantly increased in all dose groups. The mRNA and protein levels of p21 and p53 were significantly elevated in the 0.2 Gy × 6 and 0.5 Gy × 6 groups (P < 0.05). The mRNA levels of genes encoding IL-6, GM-CSF, and MMP-15 were significantly increased in all dose groups (P < 0.05). The mRNA levels of the gene encoding IL-8 were significantly increased in the 0.2 Gy × 6 and 0.5 Gy × 6 groups (P < 0.05). The levels of reactive oxygen species, malondialdehyde, and glutathione were significantly increased in all dose groups (P < 0.01). The level of superoxide dismutase was significantly increased in the 0.5 Gy × 6 group (P < 0.01). The levels of 8-OHdG were significantly increased in all dose groups (P < 0.05). In both the 0.2 Gy × 6 and 0.5 Gy × 6 groups, the expression levels of γ-H2AX and p-NF-κB p65 were significantly increased (P < 0.05), and the levels of IκBα were significantly decreased (P < 0.05). Conclusion Low-dose fractionated X-ray radiation can induce senescence and cause alterations in oxidative stress, oxidative damage, and the levels of NF-κB pathway proteins in L02 hepatocytes.