AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Aim To investigate the effect of p-AMPK activity on autophagy in different subtypes of MDA-MB-231(triple-negative breast cancer cells)and MCF-7(estrogen receptor-positive cells)and its regulatory mechanism.Methods MDA-MB-231 cells were trea-ted with EBSS,Baf-A1,and EBSS+Baf-A1 for four hours,and MCF-7 cells for eight hours.The effects of autophagy on cell proliferation and apoptosis were ob-served,mitochondrial morphology was examined,and the expression of autophagy markers LC3B,P62,LAMP1,TOM20,AMPK,p-AMPK,ULK1,and Bec-lin1/VPS34 proteins was detected.The autophagy pathway was validated by inhibiting AMPK activity.Results Breast cancer cells underwent autophagy af-ter starvation induction(EBSS),with inconsistent au-tophagy processes observed in different subtypes of breast cancer cells.Autophagy inhibited cell prolifera-tion.In MDA-MB-231 cells,autophagy led to an in-crease in p-AMPK levels and a decrease in ULK1 lev-els,initiating autophagy through p-AMPK activation of ULK1.In MCF-7 cells,both p-AMPK and ULK1 levels decreased after autophagy,suggesting that autophagy might not be mediated by p-AMPK activation.Conclu-sions MDA-MB-231 cells primarily initiate autophagy by directly activating ULK1 by p-AMPK,independent of the MTOR pathway.In MCF-7 cells autophagy might be triggered by inhibiting MTOR through AMPK activity or directly activating MTOR through other up-stream factors.Regulating p-AMPK activity based on the autophagy pathways in different cell subtypes could enable more precise targeting and treatment of different types of breast cancer.

How to use family doctors as a starting point to improve the level of chronic disease management is still a ma-jor challenge in China.This study summarizes the current chronic disease management models,family doctor contract service models,and new digital health technologies in China.It expounds the connection between the three and explores the advantages of new digital health technologies in chronic disease management and family doctor contract services,aiming to provide a solid theoretical foundation for improving the level of chronic disease management.

AIM To study the chemical constituents from ethyl acetate fraction of Balanophora harlandii Hook.f.and their tyrosinase inhibitory activity.METHODS Separation and purification were performed using silica gel,MCI,ODS,Sephadex LH-20 and semi-preparative HPLC,then the structures of obtained compounds were identified by physicochemical properties and spectral data.The monophenolase inhibitory activity was determined by the tyrosinase-catalyzed oxidation of L-tyrosine.RESULTS Twenty-four compounds were isolated and identified as sesamin(1),methyl caffeate(2),quercetin(3),5,7-dihydroxychromanone(4),methyl 3,4-dihydroxybenzoate(5),esculetin(6),kaempferol(7),naringenin(8),pyrogallic acid(9),pinosylvin(10),methyl propionate(11),caffeic acid(12),saccharinol(13),ferulic acid(14),trans-p-hydroxycinnamic acid(15),cinnamic acid(16),vanillic acid(17),vanillin(18),4-hydroxyacetophenone(19),4-hydroxybenzaldehyde(20),apigenin(21),(-)-isolariciresinol(22),(-)-secoisolariciresinol(23)and meso-2,3-di(3′,4′-methylenedioxybenzyl)butane-1,4-diol(24).The IC50 values of compounds 3,5,7,8,19,and 20 ranged from(0.246 5±0.028 3)to(1.278 2±0.021 3)mmol/L.CONCLUSION Compounds 1-9、11、15、17-21、24 are isolated from this plant for the first time,and 1,6,9,17-19,24 are first isolated from genus Balanophora.Compounds 3、5、7、8、19 and 20 have tyrosinase inhibitory activity.

Objective To explore the relationship between triglyceride-glucose(TyG)index and hypertension in patients with cerebral hemorrhage.Methods A total of 1718 patients with cere-bral hemorrhage admitted to our hospital from January,2013 to May,2023 were enrolled in this study.According to the TyG index quartile,437 cases were assigned into Q1 group(≤8.375),424 cases into Q2 group(TyG index 8.376～8.737),429 cases into Q3 group(TyG index 8.738～9.087),and 428 cases into Q4 group(≥9.088).The general clinical data were compared in the four groups.Logistic regression analysis was used to study the correlation between TyG index and hy-pertension.Results There were significant differences among the four groups in terms of age,hy-pertension,diabetes,SBP,DBP,TC,TG,HDL-C,LDL-C,FBG,glycated hemoglobin and TyG in-dex(P＜0.05,P＜0.01).Logistic regression analysis showed that when the TyG index was a con-tinuous variable,it was significantly correlated with the risk of hypertension(OR=1.999,95％CI:1.393-2.869,P=0.001).When the index was used as a categorical variable,with Q1as a ref-erence,TyG index in Q3 and Q4 was associated with an increase in OR of hypertension(OR=1.869,95％CI:1.220-2.865,P=0.004;OR=1.844,95％CI:1.125-3.020,P=0.015).After ad-justing cofounders,the association of TyG index and risk of hypertension was stronger in the fe-males(OR=2.618,95％CI:1.312-5.221,P=0.006)than the males(OR=1.783,95％CI:1.151-2.761,P=0.010),and in the patients ≥65 years old(OR=3.277,95％CI:1.600-6.741,P=0.001)than those＜65 years old(OR=1.782,95％CI:1.076-2.949,P=0.025).Conclusion TyG index is closely associated with hypertension in patients with cerebral hemorrhage,especially in women and elderly.

Aim To investigate the mechanism by which sufentanil(Suf)improved hypoxia-reoxygen-ation(H/R)-induced myocardial cell injury by regula-ting hypoxia inducible factor-1α(HIF-1α)and KC-NQ1 opposite strand/antisense transcript 1(Kcnq1ot1).Methods Bioinformatics analysis was conducted to predict the interaction between HIF-1αand Kcnq1ot1.Subsequently,H9c2 cells were divided into multiple treatment groups:Ctrl group,H/R group,and Suf group.Further grouping was based on different transfection conditions,including oe-HIF-1α group,oe-HIF-1α+Suf group,sh-HIF-1α group,and sh-HIF-1α+Kcnq1ot1 group.Cell viability was detected u-sing the MTT assay,cell apoptosis was detected using the TUNEL assay,and the concentrations of CK-MB and HBDH in cell supernatants were measured using ELISA.HIF-1α protein expression in cellswas deter-mined by Western blot,and the mRNA expression level of Kcnq1ot1 was measured by reverse transcription quantitative PCR(RT-qPCR).Additionally,a rat model of myocardial is chemia reperfusion was con-structed to evaluate the therapeutic potential of Suf for myocardial ischemia reperfusion injury in vivo.Results The results of bioinformatics analysis showed a direct interaction between HIF-1α and Kcnq1ot1.Compared with the Ctrl group,the H/R group showed significantly reduced H9c2 cell viability,increased cell apoptosis,and significantly upregulated concentrations of CK-MB and HBDH,along with significantly enhanced expres-sion of HIF-1α and Kcnq1ot1(all P＜0.05).When H9c2 cells were transfected with oe-HIF-1 α,cell via-bility further decreased,apoptosis was worsened,and CK-MB and HBDH concentrations further increased(all P＜0.05);however,these adverse effects were significantly inhibited when combined with Suf inter-vention(all P＜0.05).Additionally,compared with the H/R group,the sh-HIF-1α group showed signifi-cantly improved cell viability,reduced apoptosis and decreased CK-MB and HBDH concentrations(all P＜0.05);however,these improvements were partially re-versed upon transfection with Kcnq1ot1(all P＜0.05).Animal experiments confirmed that Suf could improve myocardial ischemia-reperfusion injury in myo-cardial ischemia-reperfusion injury rats.Conclusions Suf improves myocardial H/R injury by inhibiting the HIF-1α-Kcnq1ot1.

Age-related macular degeneration(AMD)is a critical ophthalmic condition characterized by substantial vis-ual impairment.Retinal neuroinflammation is one of the fundamental pathophysiological features of AMD.The NOD-like re-ceptor protein 3(NLRP3)inflammasome plays a crucial role in regulating neuroinflammation.It has been demonstrated that the activation of NLRP3 inflammasome is closely correlated with mitochondrial dysfunction,the increased production of reactive oxygen species(ROS),and the anomalous expulsion of mitochondrial DNA in the progression of AMD.There-fore,inhibitors targeting the NLRP3 inflammasome may become a new approach with great potential for AMD treatment.This article rigorously examines the role of mitochondrial impairment and NLRP3 inflammasome signaling in the pathogene-sis of AMD,highlighting current research advancements and prospective trajectories in this evolving field.

Aim To explore the in vitro anti-human triple-negative breast cancer(TNBC)effect and mech-anism of Austocystin R.Methods MTT assay was used to evaluate the anti-tumor potential of Austocystin R for various human tumor cells and normal cells.Flow cytometry was employed to evaluate the influence on cell cycle progression.mRFP-GFP-LC3 adenovirus transfection was used to evaluate the autophagic flux process.Western blot assay was used to verify the effect of Austocystin R on the expression of related pro-teins.Results The results showed that Austocystin R significantly inhibited the proliferation of multiple tumor cells in a dose-dependent manner,especially for the MDA-MB-231 cells with an IC50 of 1.45μmol·L-1.In addition,Austocystin R increased the protein expression of PTEN,p53,p-p53,p27,p21,and down-regulated the expression of p-PI3K,p-AKT and p-mTOR.Austocystin R can significantly increase the proportion of S-phase MDA-MB-231 cells,inhibit the expression of Cyclin D1,CDK4,CDK6,Rb,Cyclin B1 and CDK1,and promote the expression of Cyclin E1 and CDK2.Austocystin R can promote the autophagic flux process of MDA-MB-231 cells,promote the expres-sion of LC3 Ⅰ/Ⅱ,p-Beclin-1,p-ULK1,HMGB-1 and Atg 14 proteins,and inhibit the expression of Beclin-1,ULK1,p62,ATG 3,ATG 4B,ATG 5,ATG 7,ATG 12,ATG 13 and ATG 16L1 proteins.Conclusion Austo-cystin R can exhibit its anti-TNBC activity by inhibi-ting the PI3K/AKT/mTOR signaling pathway,blocking the cell cycle at the S phase and inducing autophagic cell death.