Influenza is an acute viral respiratory infection that has caused high morbidity and mortality worldwide. Influenza A virus (IAV) has been found to activate multiple programmed cell death pathways, including ferroptosis. Ferroptosis is a novel form of programmed cell death in which the accumulation of intracellular iron promotes lipid peroxidation, leading to cell death. However, little is known about how influenza viruses induce ferroptosis in the host cells. In this study, based on network pharmacology, we predicted the mechanism of action of Maxing Shigan decoction (MXSGD) in IAV-induced ferroptosis, and found that this process was related to biological processes, cellular components, molecular function and multiple signaling pathways, where the hypoxia inducible factor-1(HIF-1) signaling pathway plays a significant role. Subsequently, we constructed the mouse lung epithelial (MLE-12) cell model by IAV-infected in vitro cell experiments, and revealed that IAV infection induced cellular ferroptosis that was characterized by mitochondrial damage, increased reactive oxygen species (ROS) release, increased total iron and iron ion contents, decreased expression of ferroptosis marker gene recombinant glutathione peroxidase 4 (GPX4), increased expression of acyl-CoA synthetase long chain family member 4 (ACSL4), and enhanced activation of hypoxia inducible factor-1α (HIF-1α), induced nitric oxide synthase (iNOS) and vascular endothelial growth factor (VEGF) in the HIF-1 signaling pathway. Treatment with MXSGD effectively reduced intracellular viral load, while reducing ROS, total iron and ferrous ion contents, repairing mitochondrial results and inhibiting the expression of cellular ferroptosis and the HIF-1 signaling pathway. Finally, based on animal experiments, it was found that MXSGD effectively alleviated pulmonary congestion, edema and inflammation in IAV-infected mice, and inhibited the expression of ferroptosis-related protein and the HIF-1 signaling pathway in lung tissues.
Animals ; Mice ; Ferroptosis ; Network Pharmacology ; Reactive Oxygen Species ; Vascular Endothelial Growth Factor A ; Influenza A virus ; Iron ; Hypoxia

Humans ; Cockayne Syndrome/genetics* ; Genetic Association Studies ; Phenotype

Objective:To examine the possibility of the differentiation into islet-like cell clusters from the co-culture system of bone marrow mesenchymal stem cells (BMSCs) and islet cells.Methods:Rat BMSCs from the femur and tibia of Wistar rats were isolated and purified taken under aseptic conditions; the surface markers CD 44 and CD 90 expressions of BMSCs were detected by flow cytometry; and alizarin red staining and oil red O staining were used to identify the cells induced in the osteogenic direction and adipogenic direction, respectively. Rat islet cells from the pancreas of Wistar rats were isolated and purified; and dithiazone staining was performed for validation. The basal insulin level of the culture was detected by ELISA method. 5.6mmol/L (low glucose) and 25.0 mmol/L (high glucosa) glucose were added to the culture, respectively, and insulin release was detected by ELISA. 5-generation BMSCs and islet cells were collected and divided randomly into stem cell culture alone group (stem cell group), stem cell-islet co-culture group (co-culture group), and islet culture alone group (islet group). The morphological changes of BMSCs during co-culture were observed using an inverted phase contrast microscope; basal insulin secretion and insulin secretion stimulated by low and high glucose were tested by ELISA. Insulin protein expression in induced islet-like cell masses in co-culture group were detected by immunocytochemical staining. The ultrastructure of islet-like cells was observed by using transmission electron microscopy. Results:The positive rates of CD 44 and CD 90 were 99.48% and 99.50%, respectively; BMSCs were induced the formation of multiple calcium nodules outside the differentiation cells in the osteogenic direction, and many lipid droplets in the cytoplasm of differentiated cells in the adipogenic direction. Dithiazone staining showed that β cells in pancreatic islet were brown red and about 450 islets could be obtained per pancreas with a mean purity up to 80%. The insulin release in the low sugar group and the high sugar group were (7.105±1.551) mIU/ml and (20.231±1.592) mIU/ml, respectively, with a statistically significant difference ( P<0.05). It can be seen that local stem cells began to gather and grow upward into small clumps in the budding manner until finally forming a spherical islet-like cell cluster structure after 7 days of culture in the co-culture group. The basal insulin secretion in the stem cell group was <0.5 mIU/L. In the islet group, insulin secretion peaked on the 5th day and then gradually decreased to about 20% of the highest value on the 13th day. The insulin level of the co-culture group peaked on the 5th day, and the 13th day remained at about 40% of the peak level. There were statistically significant differences on basal insulin secretion on the 8th, 10th and 13th day between islet group and co-culture group (all P value >0.05). There was no statistically significant difference between the insulin release by islet in islet group under the stimulation of low and high sugar and that by islet-like cell cluster in co-culture group. There were a large number of brownish-yellow granules in the islet-like cell clusters after the co-culture for 14 days; and there were more secretory granules and coarse endoplasmic reticulum in the ultrastructure, showing more active protein secretion functions. Conclusions:The co-culture system of BMSCs and islet cells could induce BMSCs into differentiating into islet-like cell clusters, which can express insulin protein and had relatively mature function of insulin secretion.

Objective:To explore the clinical characteristics of pneumocystis carinii pneumonia (PCP) after kidney transplantation.Methods:From January 2020 to January 2022, clinical data were retrospectively reviewed for 13 renal transplant recipients with pneumocystis pneumonia diagnosed by metagenomics next generation sequencing (mNGS). There were 3 females and 10 males with an age range of (46±10) years.The median time of postoperative onset was 10(2-21) months; The major clinical manifestations included fever ( n=11), cough ( n=7), expectoration ( n=6) and dyspnea ( n=11). Paired t-test was employed for analyzing the laboratory results at admission and discharge. Results:The diagnosis was confirmed by the detection of NGS in alveolar lavage fluid or venous blood.The levels of G test, LDH test, total T lymphocyte absolute count (CD3+ Abs), inhibitory/cytotoxic T lymphocyte count (CD3+ CD8+ Abs) and auxiliary/induced T lymphocyte absolute count (CD3+ CD4+ Abs) were (543.27±440.49) pg/ml, (529.98±222.43)U/L and (191.92±119.42)/μl, (87.33±50.59)/μl and (106.92±87.42)/μl at admission and (69.58±50.21) pg/ml, (285.38±46.62 U/L), (888.58±672.99)/μl, (336.83±305.21)/μl and (520.08±388.76)/μl at discharge.The differences were statistically significant ( P<0.001, P=0.002, 0.006, 0.017, 0.005). All of them received compound sulfamethoxazole and caspofungin.Except for one death due to septic shock after 21-day treatment, 12 cases were cured. Conclusions:mNGS test is one of the important tool for an early diagnosis of PCP.Combined use of compound sulfamethoxazole and caspofungin is an effective anti-infective regimen.And immune function monitoring is vital for adjusting antibiotic and immunosuppressive regimens.

Objective To summarize the cardiac rehabilitation referral system.Methods The literatures about the construction of cardiac rehabilitation referral systems were retrieved from the databases of CNKI, Wanfang Date, PubMed and Web of Science, and cardiac rehabilitation websites.Results For some foreign countries, the referrals of cardiac rehabilitation mainly based on electronic medical record management system, internet platform, chronic care model, and hospitals and communities. For China, referral system is trying to build based on the medical conjoined system.Conclusion Referral, as the first step, plays an important role in participating in cardiac rehabilitation for patients. The cardiac rehabilitation referral system needs to be improved in China, referred the ways of developed countries.

Objective:To examine the technique and effect of combined thoracic and abdominal organ clusters resection.Methods:From February 2019 to August 2021, totally 50 cases of combined thoracoabdominal organ cluster resection were completed at Transplant Medical Center, the Second Affiliated Hospital of Guangxi Medical University from donation after brain death donors. There were 47 males and 3 females, aging (34.8±12.3) years (range: 5 to 55 years). The length of hospital stay( M(IQR)) was 4(4) days (range: 2 to 43 days), the length of tube time was 4(2) days (range: 1 to 43 days). Through the midsternal incision and the abdominal grand cross incision, the cold perfusion was performing simultaneously when the perfusion lines of each target organ was established respectively. The combined resection was performed with the diaphragm as the boundary and the organ cluster as the unit. The heart and lung were separated on site and sent to the transplant hospital, and the abdominal organ cluster was directly preserved and returned to our hospital for further separation and repair. Results:Totaly 21 hearts, 47 pairs of lungs, 49 livers, 47 pairs of kidneys and 11 pancreas were harvested by this surgical treatment. The resection time was (32.6±6.5) minutes (range: 19 to 50 minutes), with no hot ischemia time. There was no accidental injury that affected organ quality and function. Heart transplantation was performed in 17 cases, combined heart-kidney transplantation in 2 cases, double lung transplantation in 43 cases, single lung transplantation in 6 cases, liver transplantation in 41 cases, combined liver-pancreas-duodenal cluster transplantation in 1 case, combined liver-kidney transplantation in 3 cases, combined pancreas-kidney transplantation in 9 cases, and kidney transplantation in 74 cases.Conclusion:Simultaneous perfusion and combined resection of thoracic and abdominal organ clusters for donation after brain death donors are feasible and effective.

Objective:To examine the technique and effect of combined thoracic and abdominal organ clusters resection.Methods:From February 2019 to August 2021, totally 50 cases of combined thoracoabdominal organ cluster resection were completed at Transplant Medical Center, the Second Affiliated Hospital of Guangxi Medical University from donation after brain death donors. There were 47 males and 3 females, aging (34.8±12.3) years (range: 5 to 55 years). The length of hospital stay( M(IQR)) was 4(4) days (range: 2 to 43 days), the length of tube time was 4(2) days (range: 1 to 43 days). Through the midsternal incision and the abdominal grand cross incision, the cold perfusion was performing simultaneously when the perfusion lines of each target organ was established respectively. The combined resection was performed with the diaphragm as the boundary and the organ cluster as the unit. The heart and lung were separated on site and sent to the transplant hospital, and the abdominal organ cluster was directly preserved and returned to our hospital for further separation and repair. Results:Totaly 21 hearts, 47 pairs of lungs, 49 livers, 47 pairs of kidneys and 11 pancreas were harvested by this surgical treatment. The resection time was (32.6±6.5) minutes (range: 19 to 50 minutes), with no hot ischemia time. There was no accidental injury that affected organ quality and function. Heart transplantation was performed in 17 cases, combined heart-kidney transplantation in 2 cases, double lung transplantation in 43 cases, single lung transplantation in 6 cases, liver transplantation in 41 cases, combined liver-pancreas-duodenal cluster transplantation in 1 case, combined liver-kidney transplantation in 3 cases, combined pancreas-kidney transplantation in 9 cases, and kidney transplantation in 74 cases.Conclusion:Simultaneous perfusion and combined resection of thoracic and abdominal organ clusters for donation after brain death donors are feasible and effective.

"Early clinical practice, multiple clinical practice and repeated clinical practice" is the mainstream of the reform of higher medical education in the 21st century. Based on the shortages of the current medical education model, a university started to reform from both theoretical teaching and practical teaching, and constructed a teaching model of "early clinical practice, multiple clinical practice and repeated clinical practice" that fits China's reality. And the teaching effect was evaluated questionnaire survey and OSCE tests. The results showed that this teaching model could promote the all-round development of medical students' knowledge, ability and quality.

One hundred and eighty three women with high risk of breast cancer identified in Baoding First Central Hospital from June 2007 to June 2014,were enrolled in the study.In these 183 cases,41 received preventive therapy (22.4％),142 did not.Factors associated with acceptance of chemoprevention included older age,menopause,comorbidities,lower level education,being married,higher BMI,having high level hyperplasia of ductal epthelia and counseling to breast specialists (P ＜ O.05);whilenot informed by doctors was the main reason for failed taking preventive agents(95.1％,135/142).Thirteen of 41 women receiving chemoprevention discontinued the therapy (31.7％);no-insurance,no side-effects and higher BMI were related to the discontinuing (P ＜ 0.05).The 1-,2-,3-,and 5-year adherence rates of chemoprevention was 86.1％ (31/36),65.4％ (17/26),59.1％ (13/22),8/13 and 5/10,respectively.The results show that chemoprevention rate is low among Chinese women at high risk of breast cancer,and the long-term adherence to preventive therapy is poor.Corresponding measures should be taken to strengthen the chemoprevention of breast cancer.

Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.