ObjectiveTo prepare triptolide-Chuanxiong Rhizoma extract ethanol transfersomes（TP-CX@TESs）， conduct its quality evaluation， and investigate its in vitro anti-inflammatory efficacy and the underlying mechanisms. MethodsTP-CX@TESs was prepared via the ultrasonic injection method. With encapsulation efficiency and particle size as evaluation indicators， Box-Behnken design-response surface methodology（BBD-RSM） was employed to optimize the formulation process. The TP-CX@TESs prepared under the optimal process was characterized and evaluated for in vitro transdermal performance. A lipopolysaccharide（LPS）-induced RAW264.7 cell inflammation model was established. After 24 h of drug intervention， the levels of inflammatory factors such as nitric oxide（NO）， interleukin-6（IL-6）， and tumor necrosis factor-α（TNF-α） in the cell supernatant were detected. Western blot was used to determine the protein expression levels of Janus kinase 2（JAK2）， signal transducer and activator of transcription 3（STAT3）， and α7 nicotinic acetylcholine receptor（α7nAChR）， and real-time fluorescence quantitative polymerase chain reaction（Real-time PCR） was applied to measure the mRNA expression levels of JAK2， STAT3， the encoding gene of α7nAChR（CHRNA7）， and nuclear transcription factor-κB（NF-κB）. ResultsResults of BBD-RSM showed that the optimal formulation for preparing TP-CX@TESs was as follows：egg yolk lecithin content of 2.3%， ethanol volume fraction of 30%， and ratio of polysorbate-80 to egg yolk lecithin of 2∶5. Microscopic characterization revealed that TP-CX@TESs exhibited a spherical-like structure with a particle size of （105.60±3.85） nm， a polydispersity index of 0.19±0.03， and a Zeta potential of （-15.89±0.98） mV. The encapsulation efficiencies of triptolide， ferulic acid， and ligustilide were （76.88±4.40）%， （78.84±4.40）%， and （65.88±0.06）%， respectively. Both in vitro release and transdermal penetration of triptolide， ferulic acid， and ligustilide in TP-CX@TESs all followed the first-order kinetic model， showing a certain sustained-release property. Experimental results in RAW264.7 cells indicated that TP-CX@TESs significantly inhibited the release of NO， TNF-α， and IL-6（P<0.01）， remarkably upregulated the protein expression levels of STAT3 and α7nAChR（P<0.01）， increased the mRNA expression level of CHRNA7， and significantly downregulated the mRNA expression level of NF-κB（P<0.05， P<0.01）. ConclusionThe optimized formulation process of TP-CX@TESs is simple and feasible， along with favorable in vitro release property， good transdermal permeability， and excellent in vitro anti-inflammatory activity， the mechanism is related to the inhibition of NF-κB.

ObjectiveTo prepare triptolide-Chuanxiong Rhizoma extract ethanol transfersomes（TP-CX@TESs）， conduct its quality evaluation， and investigate its in vitro anti-inflammatory efficacy and the underlying mechanisms. MethodsTP-CX@TESs was prepared via the ultrasonic injection method. With encapsulation efficiency and particle size as evaluation indicators， Box-Behnken design-response surface methodology（BBD-RSM） was employed to optimize the formulation process. The TP-CX@TESs prepared under the optimal process was characterized and evaluated for in vitro transdermal performance. A lipopolysaccharide（LPS）-induced RAW264.7 cell inflammation model was established. After 24 h of drug intervention， the levels of inflammatory factors such as nitric oxide（NO）， interleukin-6（IL-6）， and tumor necrosis factor-α（TNF-α） in the cell supernatant were detected. Western blot was used to determine the protein expression levels of Janus kinase 2（JAK2）， signal transducer and activator of transcription 3（STAT3）， and α7 nicotinic acetylcholine receptor（α7nAChR）， and real-time fluorescence quantitative polymerase chain reaction（Real-time PCR） was applied to measure the mRNA expression levels of JAK2， STAT3， the encoding gene of α7nAChR（CHRNA7）， and nuclear transcription factor-κB（NF-κB）. ResultsResults of BBD-RSM showed that the optimal formulation for preparing TP-CX@TESs was as follows：egg yolk lecithin content of 2.3%， ethanol volume fraction of 30%， and ratio of polysorbate-80 to egg yolk lecithin of 2∶5. Microscopic characterization revealed that TP-CX@TESs exhibited a spherical-like structure with a particle size of （105.60±3.85） nm， a polydispersity index of 0.19±0.03， and a Zeta potential of （-15.89±0.98） mV. The encapsulation efficiencies of triptolide， ferulic acid， and ligustilide were （76.88±4.40）%， （78.84±4.40）%， and （65.88±0.06）%， respectively. Both in vitro release and transdermal penetration of triptolide， ferulic acid， and ligustilide in TP-CX@TESs all followed the first-order kinetic model， showing a certain sustained-release property. Experimental results in RAW264.7 cells indicated that TP-CX@TESs significantly inhibited the release of NO， TNF-α， and IL-6（P<0.01）， remarkably upregulated the protein expression levels of STAT3 and α7nAChR（P<0.01）， increased the mRNA expression level of CHRNA7， and significantly downregulated the mRNA expression level of NF-κB（P<0.05， P<0.01）. ConclusionThe optimized formulation process of TP-CX@TESs is simple and feasible， along with favorable in vitro release property， good transdermal permeability， and excellent in vitro anti-inflammatory activity， the mechanism is related to the inhibition of NF-κB.

Objective : To explore the effect of Wilms′ tumor 1-associated protein(WTAP) on tissue collagen deposition in pulmonary fibrosis caused by bleomycin. Methods : 60 mice were randomly divided into four groups: control group(Control group), Bleomycin-induced pulmonary fibrosis group(BLM group), pulmonary fibrosis lentivirus empty vector control group(BLM+LV-NC group), pulmonary fibrosis WTAP lentivirus group virus group(BLM+LV-WTAP group). Experimental pulmonary fibrosis mouse model was established by subcutaneous injection of bleomycin(35 mg/kg) into the abdomen, twice a week for a total of 8 times. After modeling, Western Blot was used to detect the protein expression of fibrosis-related markers α-smooth muscle actin(α-SMA), type I collagen(Collagen Ⅰ), fibronectin(Fibronectin), and WTAP protein. Masson staining and Sirius Red staining were used to detect collagen deposition. RT-qPCR was used to detect WTAP mRNA expression, WTAP lentivirus infection effect, and Collagen Ⅰ mRNA expression. Results: Compared with the Control group, the expression of pulmonary fibrosis markers α-SMA(P<0.001), Collagen Ⅰ(P<0.001), and Fibronectin(P<0.01) protein in the BLM group all increased. Masson staining(P<0.001) and Sirius Red staining(P<0.001) confirmed that significant collagen deposition occurred in the lung tissue of the BLM group. In addition, the expression of WTAP protein in the lung tissue of the BLM group increased(P<0.01). Compared with the Control group, the expression of WTAP mRNA in the BLM group increased(P<0.001). Compared with the BLM+LV-NC group, the expression of WTAP mRNA in the tissues of the BLM+LV-WTAP group decreased(P<0.001), proving that virus infection is effective. After infection with WTAP lentivirus, collagen fiber deposition decreased(P<0.001), Collagen Ⅰ mRNA(P<0.001) level decreased, and protein(P<0.001) expression decreased in the BLM+LV-WTAP group. Conclusion Knocking down of WTAP can reduce collagen deposition in bleomycin-induced pulmonary fibrosis tissue in mice and improve experimental pulmonary fibrosis.

Objective: To investigate the effect of sirtuin 2(SIRT2) on the proliferation and migration of cardiac fibroblasts(CFs)in C57BL/6 mice under angiotensin II(Ang Ⅱ) stimulation. Methods : The hearts were taken from 1 to 2 days C57BL/6 milk mice. After cutting and digesting, CFs were extracted by different adhesion centrifugation. After CFs attachment, the cells were cultured under control medium and Ang Ⅱ(100 nmol/L) medium and treated using OE-SIRT2 plasmid to overexpression the SIRT2 gene. RT-qPCR was used to detect mRNA expression of SIRT2 proliferating cell nuclear antigen(PCNA), periostin(POSTN)and type Ⅰ collagen procollagen A1(Col1A1), Western blot assay was used to measure the protein expression levels of SIRT2, PCNA, POSTN and Col1A1, CCK-8 assay and EdU assay were used to evaluate CFs proliferation rate, Transwell experiment was used to assess CFs migration activity. Results: Compared with control group, Ang Ⅱ stimulation led to down-regulation of SIRT2 expression in CFs, increased collagen expression, and promoted CFs proliferation and migration. The expression of SIRT2 was up regulated in CFs treated with OE-SIRT2 plasmid under Ang Ⅱ stimulation, Col1A1, POSTN and PCNA expression was down regulated, and CFs proliferation and migration ability decreased. Conclusion Overexpression of SIRT2 can inhibit the proliferation and migration of CFs under Ang Ⅱ stimulation, indicating that SIRT2 may be a key regulatory point in the onset and progression of cardiac fibrosis.

Holoprosencephaly (HPE) is a prevalent malformation of the human forebrain, with an increasing annual prevalence in China. Its etiology remains unclear, and its diagnosis and treatment are challenging due to the heterogeneity of clinical manifestations. This article summarizes and expounds the etiology, clinical manifestations, imaging and genetic diagnosis, as well as medical and surgical treatment of HPE. The aim is to enhance medical personnels’ understanding of this disease, and to facilitate early diagnosis and treatment of patients with HPE.

Holoprosencephaly (HPE) is a prevalent malformation of the human forebrain, with an increasing annual prevalence in China. Its etiology remains unclear, and its diagnosis and treatment are challenging due to the heterogeneity of clinical manifestations. This article summarizes and expounds the etiology, clinical manifestations, imaging and genetic diagnosis, as well as medical and surgical treatment of HPE. The aim is to enhance medical personnels’ understanding of this disease, and to facilitate early diagnosis and treatment of patients with HPE.

Detailed characterizations of genomic alterations have not identified subtype-specific vulnerabilities in adult gliomas. Mapping gliomas into developmental programs may uncover new vulnerabilities that are not strictly related to genomic alterations. After identifying conserved gene modules co-expressed with EGFR or PDGFRA (EM or PM), we recently proposed an EM/PM classification scheme for adult gliomas in a histological subtype- and grade-independent manner. By using cohorts of bulk samples, paired primary and recurrent samples, multi-region samples from the same glioma, single-cell RNA-seq samples, and clinical samples, we here demonstrate the temporal and spatial stability of the EM and PM subtypes. The EM and PM subtypes, which progress in a subtype-specific mode, are robustly maintained in paired longitudinal samples. Elevated activities of cell proliferation, genomic instability and microenvironment, rather than subtype switching, mark recurrent gliomas. Within individual gliomas, the EM/PM subtype was preserved across regions and single cells. Malignant cells in the EM and PM gliomas were correlated to neural stem cell and oligodendrocyte progenitor cell compartment, respectively. Thus, while genetic makeup may change during progression and/or within different tumor areas, adult gliomas evolve within a neurodevelopmental framework of the EM and PM molecular subtypes. The dysregulated developmental pathways embedded in these molecular subtypes may contain subtype-specific vulnerabilities.
Humans ; Brain Neoplasms/pathology* ; Neoplasm Recurrence, Local/metabolism* ; Glioma/pathology* ; Neural Stem Cells/pathology* ; Oligodendrocyte Precursor Cells/pathology* ; Tumor Microenvironment

OBJECTIVE: To explore the genetic basis for three children patients with CHARGE syndrome. METHODS: The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing. RESULTS: All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo. CONCLUSION Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.
CHARGE Syndrome/genetics* ; Child ; DNA Helicases/genetics* ; DNA-Binding Proteins/genetics* ; Genetic Variation ; Humans ; Mutation ; Phenotype

OBJECTIVE: To explore the genetic basis for a child with ocular anomaly, microcephaly, growth retardation and intrauterine growth restriction. METHODS: The patient underwent ophthalmologic examinations including anterior segment photography, fundus color photography, and fundus fluorescein angiography. The patient and her parents were subjected to whole exome sequencing. Candidate variants were verified by Sanger sequencing and bioinformatic analysis. RESULTS: The patient was found to have bilateral persistent pupillary membrane and coloboma of inferior iris, in addition with macular dysplasia and radial pigmentation near the hemal arch of the temporal retina. She was found to have carried compound heterozygous missense variants of the PHGDH gene, namely c.196G>A and c.1177G>A, which were respectively inherited from her father and mother. Bioinformatic analysis suggested both variants to be pathogenic. CONCLUSION The patient was diagnosed with phosphoglycerate dehydrogenase deficiency. Above finding has enriched the phenotypic spectrum of the disease with ocular manifestations.
Carbohydrate Metabolism, Inborn Errors/genetics* ; Child ; Coloboma ; Female ; Humans ; Microcephaly/genetics* ; Mutation ; Phenotype ; Phosphoglycerate Dehydrogenase/genetics* ; Psychomotor Disorders/genetics* ; Seizures/genetics* ; Whole Exome Sequencing

Objective To summarize the computed tomographic (CT) manifestations of pulmonary aspergillosis after organ transplantation and compare different signs between pulmonary aspergillosis and bacterial pneumonia.Methods CT images of pulmonary aspergillosis (n =62) and bacterial pneumonia (n =68) in post-transplantation patients were reviewed.The signs were categorized with consolidation,mass,large nodule (≥1crn),small nodule and bud-in-tree pattern.Some detailed useful differentiating signs such as halo sign,air bronchogram sign,reversed halo sign,hypodensity sign and cavitation were also analyzed.Results CT patterns of pulmonary aspergillosis included consolidation,mass,large nodule,small nodule and bud-in-tree pattern.The most common was large nodule (75.8％),followed by consolidation (48.4％)and mass (29.0％).And small nodule (16.1 ％) and bud-in-tree (12.9％) patterns were concurrent.For consolidation pattern,the proportion of bacterial pneumonia (69.1％) was the larger;For mass pattern,the proportion of pulmonary aspergillosis (29.0％) was the larger.For large nodule pattern,there was no difference.The detail sign of large nodule in two groups had no difference In detailed signs of consolidation pattern,air bronchogram sign was more often seen in bacterial pneumonia while cavitation was more frequently found in pulmonary aspergillosis.In detailed signs of mass pattern,pulmonary aspergillosis often has single lesion (66.7％),cavitation (83.3％)and air crescent sign (77.8％) is more common.The proportion of halo sign was 30.7％.Conclusions CT manifestations of pulmonary aspergillosis are diverse after organ transplantation.There is some difference and yet overlap with bacterial pneumonia.