ObjectiveTo investigate the effects of Huangqi Jianzhongtang （HQJZ） on macrophage polarization and fat consumption in cancer cachexia （CC） mice. MethodsUltra-performance liquid chromatography-quadrupole/electrostatic field Orbitrap high-resolution mass spectrometry （UPLC-Q-Orbitrap HRMS） was used to control the quality of HQJZ. （1） In vitro experiment： HQJZ-containing serum was prepared， and the optimal concentration was determined by cytotoxicity assay. Mouse monocyte-derived macrophages （RAW264.7） were cultured and randomly divided into six groups， including a blank group， a classically activated macrophages （M1） group， an alternatively activated macrophages （M2） group， a HQJZ + blank group， a HQJZ+M1 group， and a HQJZ + M2 group. The relative expression of macrophage marker genes CD86， inducible nitric oxide synthase （iNOS）， CD206， and arginase-1 （Arg1） was detected by real-time quantitative polymerase chain reaction （Real-time PCR ）. （2） In vivo experiment： Thirty-two BALB/c mice were randomly divided into a control group， a model group， a medroxyprogesterone acetate （MPA） group， and a HQJZ group. Except for the control group， the other mice were injected with CT-26 colon cancer cells to establish a CC model. Mice in the MPA and HQJZ groups were given MPA （0.13 g·kg^-1·d^-1） or HQJZ （13.13 g·kg^-1·d^-1） by gavage， respectively， while mice in the control and model groups were given an equal volume of saline by gavage， with interventions continued for 10 d. Real-time PCR was used to detect the expression of macrophage markers （iNOS， Arg1， CD86， CD206） and fat browning-related genes uncoupling protein 1 （UCP1） and peroxisome proliferator-activated receptor γ （PPARγ） in epididymal adipose tissue. Western blot （WB） was used to detect protein expression levels of UCP1 and PPARγ. Micro-computed tomography （micro-CT） was used to measure residual fat volume， and hematoxylin-eosin （HE） staining was used to assess fat browning and calculate pathological scores. ResultsIn vitro， the dominant effective concentration of HQJZ-containing serum was 12.5%. Real-time PCR results showed that， compared with the blank group， Arg1 expression decreased in the HQJZ+blank group （P<0.05）， CD206 showed a downward trend without statistical significance， while iNOS and CD86 expression were significantly increased （P<0.05）. Compared with the M1 group， Arg1 and CD206 expression decreased in the HQJZ+M1 group （P<0.05）. Compared with the M2 group， CD206 expression decreased in the HQJZ+M2 group （P<0.05）， CD86 expression increased significantly （P<0.01）. In vivo， Real-time PCR results showed that， compared with the control group， CD86 and CD206 expression levels were significantly increased in the model group （P<0.01）. Compared with the model group， CD206 expression in the MPA group was significantly decreased （P<0.01）. In the HQJZ group， CD206 was significantly decreased （P<0.01）. WB results showed that， compared with the model group， protein expression of UCP1 and PPARγ was significantly reduced in the HQJZ group （P<0.05， P<0.01）. micro-CT results showed that the total white fat volume in the HQJZ group was greater than that in the model group （P<0.05）. HE staining results showed that pathological scores in the HQJZ group were lower than those in the model group （P<0.05）. ConclusionHQJZ may inhibit white adipose tissue browning by promoting macrophage M1 polarization and suppressing M2 polarization， thereby delaying fat consumption in CC mice.

Objective:To investigate the relationship between serum insulin-like growth factor-1 (IGF-1) levels and intracranial or extracranial atherosclerosis in patients with cerebral small vessel disease (CSVD).Methods:A total of 407 patients with CSVD admitted to Xiangya Hospital of Central South University between July 2021 and September 2023 were enrolled in the study. Carotid duplex ultrasound was used to measure the internal diameter, intima-media thickness (IMT), vascular wall thickness, plaque property score, stenosis index, and stenosis ratio of the bilateral common carotid arteries, internal carotid arteries, external carotid arteries, and vertebral arteries. Magnetic resonance angiography was used to assess the degree of stenosis in intracranial arteries. Patients were divided into 4 groups based on the serum IGF-1 levels (low level group:≤5.21 ng/ml, medium level group:>5.21 ng/ml and ≤10.73 ng/ml, high level group:>10.73 ng/ml and ≤24.26 ng/ml, extremely high level group:>24.26 ng/ml). The IMT of the common carotid artery, carotid plaques, diameters of various cervical vascular lumens, carotid artery diameter stenosis, and intracranial artery stenosis in 4 groups of the patients were compared. The relationship between IGF-1 and intracranial and extracranial atherosclerosis was analyzed by univariate Logistic regression analysis and multivariate Logistic regression analysis.Results:There were inter group differences among the 4 groups in internal carotid artery diameter [low level group 5.45 (0.50) mm vs medium level group 5.32 (0.55) mm vs high level group 5.30 (0.55) mm vs extremely high level group 5.30 (0.50) mm; H=8.210, P=0.042]. The carotid IMT [low level group 0.80 (0.05) mm vs medium level group 0.80 (0.05) mm vs high level group 0.83 (0.03) mm vs extremely high level group 0.83 (0.09) mm; H=8.107, P=0.044], the proportion of carotid artery vascular wall thickening [low level group 52.9%(54/102) vs medium level group 48.0%(49/102) vs high level group 68.3%(69/101) vs extremely high level group 60.8%(62/102); χ2=9.889, P=0.020], the carotid artery plaque property score [low level group 1 (2) vs medium level group 2 (2) vs high level group 2 (2) vs extremely high level group 2 (2); H=8.913, P=0.030] and the proportion of anterior cerebral artery stenosis [low level group 2.9%(3/102) vs medium level group 2.0%(2/102) vs high level group 4.0%(4/101) vs extremely high level group 10.8%(11/102); χ2=10.473, P=0.014] had inter group differences among the 4 groups, and the differences were statistically significant. Univariate Logistic regression analysis indicated that carotid artery vascular wall thickening ( OR=1.197, 95% CI 1.003-1.429, P=0.046), anterior cerebral artery stenosis ( OR=1.814, 95% CI 1.148-2.867, P=0.011), and basilar artery stenosis ( OR=1.530, 95% CI 1.084-2.159, P=0.015) were correlated with IGF-1 levels. Multivariate Logistic regression analysis revealed that after adjusting for age, gender, low-density lipoprotein cholesterol (LDL-C), and C-reactive protein, IGF-1 was positively correlated with the carotid artery vascular wall thickening ( OR=1.311, 95% CI 1.014-1.696, P=0.039); after adjusting for age, IGF-1 was positively correlated with the anterior cerebral artery stenosis ( OR=2.130, 95% CI 1.201-3.776, P=0.010); after adjusting for gender, low-density lipoprotein cholesterol, and cholesterol levels, IGF-1 was positively correlated with basilar artery stenosis ( OR=1.688, 95% CI 1.063-2.681, P=0.027). Conclusions:There is an association between IGF-1 levels and intracranial and extracranial atherosclerosis in patients with CSVD. IGF-1 may play a role in the development and progression of atherosclerosis in CSVD.

Objective:To investigate the relationship between serum insulin-like growth factor-1 (IGF-1) levels and intracranial or extracranial atherosclerosis in patients with cerebral small vessel disease (CSVD).Methods:A total of 407 patients with CSVD admitted to Xiangya Hospital of Central South University between July 2021 and September 2023 were enrolled in the study. Carotid duplex ultrasound was used to measure the internal diameter, intima-media thickness (IMT), vascular wall thickness, plaque property score, stenosis index, and stenosis ratio of the bilateral common carotid arteries, internal carotid arteries, external carotid arteries, and vertebral arteries. Magnetic resonance angiography was used to assess the degree of stenosis in intracranial arteries. Patients were divided into 4 groups based on the serum IGF-1 levels (low level group:≤5.21 ng/ml, medium level group:>5.21 ng/ml and ≤10.73 ng/ml, high level group:>10.73 ng/ml and ≤24.26 ng/ml, extremely high level group:>24.26 ng/ml). The IMT of the common carotid artery, carotid plaques, diameters of various cervical vascular lumens, carotid artery diameter stenosis, and intracranial artery stenosis in 4 groups of the patients were compared. The relationship between IGF-1 and intracranial and extracranial atherosclerosis was analyzed by univariate Logistic regression analysis and multivariate Logistic regression analysis.Results:There were inter group differences among the 4 groups in internal carotid artery diameter [low level group 5.45 (0.50) mm vs medium level group 5.32 (0.55) mm vs high level group 5.30 (0.55) mm vs extremely high level group 5.30 (0.50) mm; H=8.210, P=0.042]. The carotid IMT [low level group 0.80 (0.05) mm vs medium level group 0.80 (0.05) mm vs high level group 0.83 (0.03) mm vs extremely high level group 0.83 (0.09) mm; H=8.107, P=0.044], the proportion of carotid artery vascular wall thickening [low level group 52.9%(54/102) vs medium level group 48.0%(49/102) vs high level group 68.3%(69/101) vs extremely high level group 60.8%(62/102); χ2=9.889, P=0.020], the carotid artery plaque property score [low level group 1 (2) vs medium level group 2 (2) vs high level group 2 (2) vs extremely high level group 2 (2); H=8.913, P=0.030] and the proportion of anterior cerebral artery stenosis [low level group 2.9%(3/102) vs medium level group 2.0%(2/102) vs high level group 4.0%(4/101) vs extremely high level group 10.8%(11/102); χ2=10.473, P=0.014] had inter group differences among the 4 groups, and the differences were statistically significant. Univariate Logistic regression analysis indicated that carotid artery vascular wall thickening ( OR=1.197, 95% CI 1.003-1.429, P=0.046), anterior cerebral artery stenosis ( OR=1.814, 95% CI 1.148-2.867, P=0.011), and basilar artery stenosis ( OR=1.530, 95% CI 1.084-2.159, P=0.015) were correlated with IGF-1 levels. Multivariate Logistic regression analysis revealed that after adjusting for age, gender, low-density lipoprotein cholesterol (LDL-C), and C-reactive protein, IGF-1 was positively correlated with the carotid artery vascular wall thickening ( OR=1.311, 95% CI 1.014-1.696, P=0.039); after adjusting for age, IGF-1 was positively correlated with the anterior cerebral artery stenosis ( OR=2.130, 95% CI 1.201-3.776, P=0.010); after adjusting for gender, low-density lipoprotein cholesterol, and cholesterol levels, IGF-1 was positively correlated with basilar artery stenosis ( OR=1.688, 95% CI 1.063-2.681, P=0.027). Conclusions:There is an association between IGF-1 levels and intracranial and extracranial atherosclerosis in patients with CSVD. IGF-1 may play a role in the development and progression of atherosclerosis in CSVD.

Energy metabolism is fundamental for life.It encompasses the utilization of carbohydrates,lipids,and proteins for internal processes,while aberrant energy metabolism is implicated in many diseases.In the present study,using three-dimensional(3D)printing from polycarbonate via fused deposition modeling,we propose a multi-nuclear radiofrequency(RF)coil design with integrated 1H birdcage and interchangeable X-nuclei(2H,13C,23Na,and 31P)single-loop coils for magnetic resonance imaging(MRI)/magnetic resonance spectroscopy(MRS).The single-loop coil for each nucleus attaches to an arc bracket that slides unrestrictedly along the birdcage coil inner surface,enabling convenient switching among various nuclei and animal handling.Compared to a commercial 1H birdcage coil,the proposed 1H birdcage coil exhibited superior signal-excitation homogeneity and imaging signal-to-noise ratio(SNR).For X-nuclei study,prominent peaks in spectroscopy for phantom solutions showed excellent SNR,and the static and dynamic peaks of in vivo spectroscopy validated the efficacy of the coil design in structural imaging and energy metabolism detection simultaneously.

Detailed characterizations of genomic alterations have not identified subtype-specific vulnerabilities in adult gliomas. Mapping gliomas into developmental programs may uncover new vulnerabilities that are not strictly related to genomic alterations. After identifying conserved gene modules co-expressed with EGFR or PDGFRA (EM or PM), we recently proposed an EM/PM classification scheme for adult gliomas in a histological subtype- and grade-independent manner. By using cohorts of bulk samples, paired primary and recurrent samples, multi-region samples from the same glioma, single-cell RNA-seq samples, and clinical samples, we here demonstrate the temporal and spatial stability of the EM and PM subtypes. The EM and PM subtypes, which progress in a subtype-specific mode, are robustly maintained in paired longitudinal samples. Elevated activities of cell proliferation, genomic instability and microenvironment, rather than subtype switching, mark recurrent gliomas. Within individual gliomas, the EM/PM subtype was preserved across regions and single cells. Malignant cells in the EM and PM gliomas were correlated to neural stem cell and oligodendrocyte progenitor cell compartment, respectively. Thus, while genetic makeup may change during progression and/or within different tumor areas, adult gliomas evolve within a neurodevelopmental framework of the EM and PM molecular subtypes. The dysregulated developmental pathways embedded in these molecular subtypes may contain subtype-specific vulnerabilities.
Humans ; Brain Neoplasms/pathology* ; Neoplasm Recurrence, Local/metabolism* ; Glioma/pathology* ; Neural Stem Cells/pathology* ; Oligodendrocyte Precursor Cells/pathology* ; Tumor Microenvironment

This paper discusses from two aspects of case writing and PBL implementation experience. PBL cases should be based on professional requirements and reflect professional characteristics. Health inspection and quarantine cases targeted at application-oriented talent cultivation can be integrated into relevant experimental skills items. At the same time, the forms of case writing are expanded according to the differences of theme forms, which are designed as parallel cases and serial cases, so as to be applicable to the curriculum integration in different areas. In the implementation of PBL teaching, students' learning status is the key to the efficiency of classroom discussion, which determines whether the implementation of PBL is completely autonomous learning or embedded instruction. Teachers should establish cooperative learning atmosphere to improve the efficiency of classroom discussion

OBJECTIVE: To explore the genetic basis for three children patients with CHARGE syndrome. METHODS: The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing. RESULTS: All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo. CONCLUSION Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.
CHARGE Syndrome/genetics* ; Child ; DNA Helicases/genetics* ; DNA-Binding Proteins/genetics* ; Genetic Variation ; Humans ; Mutation ; Phenotype

OBJECTIVE: To explore the genetic basis for a child with ocular anomaly, microcephaly, growth retardation and intrauterine growth restriction. METHODS: The patient underwent ophthalmologic examinations including anterior segment photography, fundus color photography, and fundus fluorescein angiography. The patient and her parents were subjected to whole exome sequencing. Candidate variants were verified by Sanger sequencing and bioinformatic analysis. RESULTS: The patient was found to have bilateral persistent pupillary membrane and coloboma of inferior iris, in addition with macular dysplasia and radial pigmentation near the hemal arch of the temporal retina. She was found to have carried compound heterozygous missense variants of the PHGDH gene, namely c.196G>A and c.1177G>A, which were respectively inherited from her father and mother. Bioinformatic analysis suggested both variants to be pathogenic. CONCLUSION The patient was diagnosed with phosphoglycerate dehydrogenase deficiency. Above finding has enriched the phenotypic spectrum of the disease with ocular manifestations.
Carbohydrate Metabolism, Inborn Errors/genetics* ; Child ; Coloboma ; Female ; Humans ; Microcephaly/genetics* ; Mutation ; Phenotype ; Phosphoglycerate Dehydrogenase/genetics* ; Psychomotor Disorders/genetics* ; Seizures/genetics* ; Whole Exome Sequencing

Objective:To Investigate comprehensive predictive ability of first-trimester complete blood count combined with maternal characteristics for gestational diabetes mellitus (GDM).Methods:From May 2015 to July 2018, 1 412 pregnant women were retrospectively screened at the Fifth People′s Hospital of Shanghai, Fudan University. We recruited 258 women who developed GDM and 1 154 women who had normal glucose level during pregnancy. At the first visit, clinical data and complete blood count result were obtained. GDM prediction models were established through logistic regression analysis of GDM related risk factors and the prediction abilities of each model were compared.Results:Logistic regression analyses identified age, pre-pregnancy body mass index, previous GDM history, family history of diabetes mellitus, the neutrophil-to-lymphocyte ratio, leukocyte, neutrophil, and monocyte counts were significantly independent predictors of GDM. In the entire cohort, the predictive ability of neutrophil and monocyte counts together with maternal basal characteristics model for the development of GDM [areas under the receiver operating characteristic curve (AUC-ROC)=0.809, integrated discrimination improvement (IDI)=0.056, P=0.001] was the best among various models (basal characteristics model, AUC-ROC=0.753; Monocyte count+ basal characteristics model, AUC-ROC=0.764; neutrophil count + basal characteristics model, AUC-ROC=0.775). Similar results obtained by the same way in all pregnant women without previous GDM history. Conclusion:It could improve the prediction of GDM with model incorporated maternal characteristics and first-trimester neutrophil and monocyte counts.

This paper reports a case of a male patient with diabetes for more than 20 years who came to see doctor due to weakness, poor appetite and significantly elevated blood glucose. At first, it was considered that the poor blood glucose control of diabetes was the reason, and the possibility of diabetes related complications already existed. Hospital routine examination indicated a globulin increase and immunologic examination indicated that IgM was mainly increased. Subsequent imageological diagnosis revealed a small amount of bilateral pleural effusion, and after 2 weeks of hypoglycemic treatment, the blood glucose was significantly improved, but the symptoms still existed. In combination with the patient′s laboratory examination, considering the combination of blood system diseases, the hematology department was invited for consultation. Immunoelectrophoresis, bone marrow cytology, and flow cytometry were further conducted, and the patient was diagnosed with Waldenstrom macroglobulinebia. Bortezomib + dexamethasone regimen was given for chemotherapy. Currently, the patient has received 1 course of chemotherapy, and the symptoms of poor appetite were significantly improved. Coexistence of diabetes mellitus and Waldenstrom macroglobulinebia is very rare in clinical practice, and it is easy to be misdiagnosed as a complication of diabetes mellitus, both of which can be manifested as poor appetite, weakness, peripheral neuropathy and other symptoms. When diabetic patients have abnormal immunoglobulin increases and other abnormal test results that cannot be well explained by diabetes, other potential disorders, such as hematological diseases, should be considered to avoid missed diagnosis.