1.Huangqi Jianzhongtang Regulates Polarization of Macrophages M1/M2 and Improves Fat Consumption in Cancer Cachexia Mice
Zhiyan FANG ; Haiyan ZHU ; Wenying HUAI ; Cong HUANG ; Ruocong YANG ; Haiyan YU ; Tiane ZHANG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(2):61-69
ObjectiveTo investigate the effects of Huangqi Jianzhongtang (HQJZ) on macrophage polarization and fat consumption in cancer cachexia (CC) mice. MethodsUltra-performance liquid chromatography-quadrupole/electrostatic field Orbitrap high-resolution mass spectrometry (UPLC-Q-Orbitrap HRMS) was used to control the quality of HQJZ. (1) In vitro experiment: HQJZ-containing serum was prepared, and the optimal concentration was determined by cytotoxicity assay. Mouse monocyte-derived macrophages (RAW264.7) were cultured and randomly divided into six groups, including a blank group, a classically activated macrophages (M1) group, an alternatively activated macrophages (M2) group, a HQJZ + blank group, a HQJZ+M1 group, and a HQJZ + M2 group. The relative expression of macrophage marker genes CD86, inducible nitric oxide synthase (iNOS), CD206, and arginase-1 (Arg1) was detected by real-time quantitative polymerase chain reaction (Real-time PCR ). (2) In vivo experiment: Thirty-two BALB/c mice were randomly divided into a control group, a model group, a medroxyprogesterone acetate (MPA) group, and a HQJZ group. Except for the control group, the other mice were injected with CT-26 colon cancer cells to establish a CC model. Mice in the MPA and HQJZ groups were given MPA (0.13 g·kg-1·d-1) or HQJZ (13.13 g·kg-1·d-1) by gavage, respectively, while mice in the control and model groups were given an equal volume of saline by gavage, with interventions continued for 10 d. Real-time PCR was used to detect the expression of macrophage markers (iNOS, Arg1, CD86, CD206) and fat browning-related genes uncoupling protein 1 (UCP1) and peroxisome proliferator-activated receptor γ (PPARγ) in epididymal adipose tissue. Western blot (WB) was used to detect protein expression levels of UCP1 and PPARγ. Micro-computed tomography (micro-CT) was used to measure residual fat volume, and hematoxylin-eosin (HE) staining was used to assess fat browning and calculate pathological scores. ResultsIn vitro, the dominant effective concentration of HQJZ-containing serum was 12.5%. Real-time PCR results showed that, compared with the blank group, Arg1 expression decreased in the HQJZ+blank group (P<0.05), CD206 showed a downward trend without statistical significance, while iNOS and CD86 expression were significantly increased (P<0.05). Compared with the M1 group, Arg1 and CD206 expression decreased in the HQJZ+M1 group (P<0.05). Compared with the M2 group, CD206 expression decreased in the HQJZ+M2 group (P<0.05), CD86 expression increased significantly (P<0.01). In vivo, Real-time PCR results showed that, compared with the control group, CD86 and CD206 expression levels were significantly increased in the model group (P<0.01). Compared with the model group, CD206 expression in the MPA group was significantly decreased (P<0.01). In the HQJZ group, CD206 was significantly decreased (P<0.01). WB results showed that, compared with the model group, protein expression of UCP1 and PPARγ was significantly reduced in the HQJZ group (P<0.05, P<0.01). micro-CT results showed that the total white fat volume in the HQJZ group was greater than that in the model group (P<0.05). HE staining results showed that pathological scores in the HQJZ group were lower than those in the model group (P<0.05). ConclusionHQJZ may inhibit white adipose tissue browning by promoting macrophage M1 polarization and suppressing M2 polarization, thereby delaying fat consumption in CC mice.
2.A proton birdcage coil integrated with interchangeable single loops for multi-nuclear MRI/MRS
ZHANG YI ; QUAN ZHIYAN ; LOU FEIYANG ; FANG YUJIAO ; J.THOMPSON GARTH ; CHEN GAO ; ZHANG XIAOTONG
Journal of Zhejiang University. Science. B 2024;25(2):168-180,后插1-后插4
Energy metabolism is fundamental for life.It encompasses the utilization of carbohydrates,lipids,and proteins for internal processes,while aberrant energy metabolism is implicated in many diseases.In the present study,using three-dimensional(3D)printing from polycarbonate via fused deposition modeling,we propose a multi-nuclear radiofrequency(RF)coil design with integrated 1H birdcage and interchangeable X-nuclei(2H,13C,23Na,and 31P)single-loop coils for magnetic resonance imaging(MRI)/magnetic resonance spectroscopy(MRS).The single-loop coil for each nucleus attaches to an arc bracket that slides unrestrictedly along the birdcage coil inner surface,enabling convenient switching among various nuclei and animal handling.Compared to a commercial 1H birdcage coil,the proposed 1H birdcage coil exhibited superior signal-excitation homogeneity and imaging signal-to-noise ratio(SNR).For X-nuclei study,prominent peaks in spectroscopy for phantom solutions showed excellent SNR,and the static and dynamic peaks of in vivo spectroscopy validated the efficacy of the coil design in structural imaging and energy metabolism detection simultaneously.
3.Temporal and spatial stability of the EM/PM molecular subtypes in adult diffuse glioma.
Jing FENG ; Zheng ZHAO ; Yanfei WEI ; Zhaoshi BAO ; Wei ZHANG ; Fan WU ; Guanzhang LI ; Zhiyan SUN ; Yanli TAN ; Jiuyi LI ; Yunqiu ZHANG ; Zejun DUAN ; Xueling QI ; Kai YU ; Zhengmin CONG ; Junjie YANG ; Yaxin WANG ; Yingyu SUN ; Fuchou TANG ; Xiaodong SU ; Chuan FANG ; Tao JIANG ; Xiaolong FAN
Frontiers of Medicine 2023;17(2):240-262
Detailed characterizations of genomic alterations have not identified subtype-specific vulnerabilities in adult gliomas. Mapping gliomas into developmental programs may uncover new vulnerabilities that are not strictly related to genomic alterations. After identifying conserved gene modules co-expressed with EGFR or PDGFRA (EM or PM), we recently proposed an EM/PM classification scheme for adult gliomas in a histological subtype- and grade-independent manner. By using cohorts of bulk samples, paired primary and recurrent samples, multi-region samples from the same glioma, single-cell RNA-seq samples, and clinical samples, we here demonstrate the temporal and spatial stability of the EM and PM subtypes. The EM and PM subtypes, which progress in a subtype-specific mode, are robustly maintained in paired longitudinal samples. Elevated activities of cell proliferation, genomic instability and microenvironment, rather than subtype switching, mark recurrent gliomas. Within individual gliomas, the EM/PM subtype was preserved across regions and single cells. Malignant cells in the EM and PM gliomas were correlated to neural stem cell and oligodendrocyte progenitor cell compartment, respectively. Thus, while genetic makeup may change during progression and/or within different tumor areas, adult gliomas evolve within a neurodevelopmental framework of the EM and PM molecular subtypes. The dysregulated developmental pathways embedded in these molecular subtypes may contain subtype-specific vulnerabilities.
Humans
;
Brain Neoplasms/pathology*
;
Neoplasm Recurrence, Local/metabolism*
;
Glioma/pathology*
;
Neural Stem Cells/pathology*
;
Oligodendrocyte Precursor Cells/pathology*
;
Tumor Microenvironment
4.Thinking on PBL teaching for health inspection and quarantine undergraduate
Fei MO ; Zhiyan NIE ; Linjun CHEN ; Lijun YANG ; Fei XU ; Wenjuan FANG ; Hu ZHAO
Chinese Journal of Medical Education Research 2021;20(9):957-960
This paper discusses from two aspects of case writing and PBL implementation experience. PBL cases should be based on professional requirements and reflect professional characteristics. Health inspection and quarantine cases targeted at application-oriented talent cultivation can be integrated into relevant experimental skills items. At the same time, the forms of case writing are expanded according to the differences of theme forms, which are designed as parallel cases and serial cases, so as to be applicable to the curriculum integration in different areas. In the implementation of PBL teaching, students' learning status is the key to the efficiency of classroom discussion, which determines whether the implementation of PBL is completely autonomous learning or embedded instruction. Teachers should establish cooperative learning atmosphere to improve the efficiency of classroom discussion
5.First-trimester complete blood count combined with maternal characteristics as a predictor of gestational diabetes mellitus
Fang WANG ; Tiange SUN ; Yue LI ; Xinmei HUANG ; Yueyue WU ; Zhiyan YU ; Li SHENG ; Zaoping CHEN ; Rui ZHANG ; Shufei ZANG ; Heyuan DING ; Bingbing ZHA ; Jun LIU
Chinese Journal of Endocrinology and Metabolism 2021;37(12):1049-1055
Objective:To Investigate comprehensive predictive ability of first-trimester complete blood count combined with maternal characteristics for gestational diabetes mellitus (GDM).Methods:From May 2015 to July 2018, 1 412 pregnant women were retrospectively screened at the Fifth People′s Hospital of Shanghai, Fudan University. We recruited 258 women who developed GDM and 1 154 women who had normal glucose level during pregnancy. At the first visit, clinical data and complete blood count result were obtained. GDM prediction models were established through logistic regression analysis of GDM related risk factors and the prediction abilities of each model were compared.Results:Logistic regression analyses identified age, pre-pregnancy body mass index, previous GDM history, family history of diabetes mellitus, the neutrophil-to-lymphocyte ratio, leukocyte, neutrophil, and monocyte counts were significantly independent predictors of GDM. In the entire cohort, the predictive ability of neutrophil and monocyte counts together with maternal basal characteristics model for the development of GDM [areas under the receiver operating characteristic curve (AUC-ROC)=0.809, integrated discrimination improvement (IDI)=0.056, P=0.001] was the best among various models (basal characteristics model, AUC-ROC=0.753; Monocyte count+ basal characteristics model, AUC-ROC=0.764; neutrophil count + basal characteristics model, AUC-ROC=0.775). Similar results obtained by the same way in all pregnant women without previous GDM history. Conclusion:It could improve the prediction of GDM with model incorporated maternal characteristics and first-trimester neutrophil and monocyte counts.
6.Clinical phenotype and analysis of CHD7 gene variants in three children patients with CHARGE syndrome.
Chinese Journal of Medical Genetics 2021;38(1):42-46
OBJECTIVE:
To explore the genetic basis for three children patients with CHARGE syndrome.
METHODS:
The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.
RESULTS:
All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.
CONCLUSION
Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.
CHARGE Syndrome/genetics*
;
Child
;
DNA Helicases/genetics*
;
DNA-Binding Proteins/genetics*
;
Genetic Variation
;
Humans
;
Mutation
;
Phenotype
7.Genetic and phenotypic analysis of a patient with phosphogylcerate dehydrogenase deficiency.
Chinese Journal of Medical Genetics 2021;38(2):170-173
OBJECTIVE:
To explore the genetic basis for a child with ocular anomaly, microcephaly, growth retardation and intrauterine growth restriction.
METHODS:
The patient underwent ophthalmologic examinations including anterior segment photography, fundus color photography, and fundus fluorescein angiography. The patient and her parents were subjected to whole exome sequencing. Candidate variants were verified by Sanger sequencing and bioinformatic analysis.
RESULTS:
The patient was found to have bilateral persistent pupillary membrane and coloboma of inferior iris, in addition with macular dysplasia and radial pigmentation near the hemal arch of the temporal retina. She was found to have carried compound heterozygous missense variants of the PHGDH gene, namely c.196G>A and c.1177G>A, which were respectively inherited from her father and mother. Bioinformatic analysis suggested both variants to be pathogenic.
CONCLUSION
The patient was diagnosed with phosphoglycerate dehydrogenase deficiency. Above finding has enriched the phenotypic spectrum of the disease with ocular manifestations.
Carbohydrate Metabolism, Inborn Errors/genetics*
;
Child
;
Coloboma
;
Female
;
Humans
;
Microcephaly/genetics*
;
Mutation
;
Phenotype
;
Phosphoglycerate Dehydrogenase/genetics*
;
Psychomotor Disorders/genetics*
;
Seizures/genetics*
;
Whole Exome Sequencing
8.The HOMA-IR cut-off values for diagnosis of insulin resistance and relationship of metabolic syndrome with insulin resistance in elderly people in Minhang District of Shanghai
Yue LI ; Xinmei HUANG ; Yueyue WU ; Heyuan DING ; Bingbing ZHA ; Tiange SUN ; Zaoping CHEN ; Jiong XU ; Min YANG ; Rui ZHANG ; Fang WANG ; Zhiyan YU ; Jun LIU
Chinese Journal of Endocrinology and Metabolism 2019;35(8):672-677
Objective To investigate the threshold values of insulin resistance ( IR) assessed by homeostasis model and the prevalence of IR in elderly people over 60 years old in Minhang district of Shanghai, and to evaluate the relationship between IR and metabolic syndrome ( MS) . Methods A total of 3003 elderly people aged 60 and over in the Jiangchuan community of Minhang District, Shanghai, were recruited, including 1286 males and 1717 females. Blood pressure, waist circumference, BMI, blood routine, serum creatinine, blood lipids, glucose, and fasting insulin were measured in all populations studied. Homeostasis model assessment ( HOMA) was used to estimate IR, and MS, and defined according to three diagnostic criteria including NCEP-ATPIII, IDF, and CDS. Results 75th percentile, 80th percentile and 90th percentile of HOMA values in 268 subjects with normotensive and normal BMI, glucose tolerance were considered as the thresholds of IR. The cut-off values were 2. 78, 3. 01 and 3. 56, respectively. And the prevalence of IR were 50. 0%, 42. 1%, and 27. 2%, respectively. IR level was significantly higher in people with MS. Based on the receiver operating characteristic ( ROC ) curve analysis, HOMA-IR and QUICKI index predicted MS well, and the optimal thresholds for diagnosing MS of HOMA-IR were 3. 17 for NCEP-ATPⅢ, 3. 02 for IDF and 3. 03 for CDS. BMI was the best factor for diagnosing IR among different MS components. Logistic regression analysis showed that gender, WC, BMI, SBP, HDL-C, TG, FBG and WBC were independent risk factors for IR. FBG≥5.84 mmol/L was the most dangerous factor of IR (OR=3.603,P<0.01), followed by WC≥85.4 cm(OR=2.152, P<0.01) and BMI≥24.6 kg/m2(OR=2.150,P<0.01). Conclusion The cut-off values of IR estimated by HOMA and the prevalence of IR were higher in elder subjects than other populations. IR was significantly positively correlated with MS. Excluding the conditions that insulin measurement were affected by external factors, HOMA-IR may predict the risk of MS. The components of MS were relative specific measurements of IR, FBG, BMI and WC were important risk predictors of IR in the elderly.
9. Coexistence of diabetes mellitus and Waldenstrom macroglobulinebia: One case report
Fangyuan CHEN ; Yueyue WU ; Xinmei HUANG ; Zhiyan YU ; Rui ZHANG ; Fang WANG ; Tiange SUN ; Heyuan DING ; Jun LIU
Chinese Journal of Endocrinology and Metabolism 2019;35(9):789-791
This paper reports a case of a male patient with diabetes for more than 20 years who came to see doctor due to weakness, poor appetite and significantly elevated blood glucose. At first, it was considered that the poor blood glucose control of diabetes was the reason, and the possibility of diabetes related complications already existed. Hospital routine examination indicated a globulin increase and immunologic examination indicated that IgM was mainly increased. Subsequent imageological diagnosis revealed a small amount of bilateral pleural effusion, and after 2 weeks of hypoglycemic treatment, the blood glucose was significantly improved, but the symptoms still existed. In combination with the patient′s laboratory examination, considering the combination of blood system diseases, the hematology department was invited for consultation. Immunoelectrophoresis, bone marrow cytology, and flow cytometry were further conducted, and the patient was diagnosed with Waldenstrom macroglobulinebia. Bortezomib + dexamethasone regimen was given for chemotherapy. Currently, the patient has received 1 course of chemotherapy, and the symptoms of poor appetite were significantly improved. Coexistence of diabetes mellitus and Waldenstrom macroglobulinebia is very rare in clinical practice, and it is easy to be misdiagnosed as a complication of diabetes mellitus, both of which can be manifested as poor appetite, weakness, peripheral neuropathy and other symptoms. When diabetic patients have abnormal immunoglobulin increases and other abnormal test results that cannot be well explained by diabetes, other potential disorders, such as hematological diseases, should be considered to avoid missed diagnosis.
10.A comparative study of tumor-associated macrophages isolation in colorectal carcinoma by Ficoll-Hy-paque density gradient centrifugation and Percoll density gradient centrifugation
Fang YANG ; Feifan WU ; Xiaoyan WANG ; Zhiyan HU ; Zuguo LI
The Journal of Practical Medicine 2015;(9):1394-1398
Objective Percoll density gradient centrifugation and Ficoll-Hypaque density gradient cen-trifugation, which are frequently-used methods for separation of tumor-associated macrophages (TAMs) from solid carcinoma were compared, in order to find an effective way to separate TAMs from colorectal carcinoma (CRC). Furthermore, we studied the best adherence time of separating macrophage among mononuclear cells. Methods specimens were collected from CRC patients , after digesting into single cells , TAMs were separated from the same specimen by 100% Ficoll, 35% percoll and 25% combined with 65% percoll respectively. After these pre-liminary separation, the collected cells were purified a second time by adherence separation. The purity of TAMs were detected by immunofluorescence. Results TAMs purity from Ficoll-Hypaque density gradient centrifugation was 80.18%, statistically higher than that from Percoll density gradient centrifugations (54.33% and 10.93% re-spectively). Conclusion Compared to Percoll density gradient centrifugation, Ficoll-Hypaque density gradient centrifugation is a more effective and simple way to isolate TAMs from colorectal carcinoma , suggesting it can be wildly used in clinical and basic medical research. 2-4 hours is the best adherence time for isolating macrophage.

Result Analysis
Print
Save
E-mail