OBJECTIVE: To analyze the demographic and clinical characteristics of inpatients with osteoporotic vertebral compression fractures (OVCF) and provide a basis for clinical prevention and treatment. METHODS: A retrospective analysis was performed on the clinical data of 744 inpatients diagnosed with OVCF between January 2017 and December 2021 who met the inclusion criteria. Among them, 146 were male and 598 were female, with age ranging from 50 to 95 years (mean, 69.37 years). The demographic characteristics (gender, age, ethnicity, occupation, regional distribution, urban-rural distribution, and seasonal incidence) and clinical features [causes of injury, history of vertebral fractures, smoking and drinking history in males, comorbidities (hypertension, diabetes, coronary atherosclerotic heart disease, cerebral infarction), body mass index (BMI), blood lipid levels, menopausal age in females, vertebral bone mineral density T-value, number of vertebral fractures, and fracture segment distribution] of OVCF patients were analyzed. Multiple linear regression was used to analyze the independent risk factors of vertebral osteoporosis. RESULTS: The demographic analysis indicated that female patients with OVCF were significantly younger than male patients ( P<0.05). Significant differences were observed in the age distribution of OVCF between males and females ( P<0.05), with the highest proportion of male patients in the 70-79 years group (37.0%) and the highest proportion of female patients in the 60-69 years group (40.0%). From 2017 to 2021, the age of onset for OVCF gradually increased, with a similar trend observed for both genders. The distribution of occupations between genders also showed significant differences ( P<0.05); with the top three occupations for males being farmers (48.6%), retirees (24.7%), and workers (13.7%), while for females, the leading occupations were farmers (51.5%), retirees (19.4%), and service workers (10.0%). Female OVCF patients had higher BMI, vertebral bone mineral density T-value, history of vertebral fractures, hypertension prevalence, and blood lipid levels compared to male patients ( P<0.05). No significant difference between the males and the females was found in ethnicity, seasonal distribution, regional distribution, urban-rural distribution, causes of injury, number of vertebral fractures, or prevalence of comorbidities (except hypertension) ( P>0.05). Among the 744 OVCF patients, a total of 1 309 vertebrae were involved, with 628 thoracic vertebrae (48.0%) and 681 lumbar vertebrae (52.0%). The most common fracture segments were L ₁ (22.5%), T ₁₂ (21.2%), followed by L ₂ (12.2%) and T ₁₁ (10.2%). No significant gender difference was observed in the distribution of fracture segments ( P>0.05). Multiple linear regression analysis indicated that older age, female, and lower BMI were independent risk factors for vertebral osteoporosis ( P<0.05). CONCLUSION The age of onset of OVCF patients is increasing year by year. The number of fractured vertebral bodies, age distribution of morbidity, occupational distribution, BMI, history of vertebral fracture, hypertension, and blood lipid levels are related to gender. The occurrence of OVCF is mainly in the thoracolumbar segment. The female, older age, and lower BMI are independent risk factors of osteoporosis.
Humans ; Male ; Female ; Aged ; Middle Aged ; Retrospective Studies ; Spinal Fractures/etiology* ; Aged, 80 and over ; Osteoporotic Fractures/etiology* ; Fractures, Compression/etiology* ; Risk Factors ; Bone Density ; China/epidemiology* ; Osteoporosis/epidemiology* ; Comorbidity ; Inpatients ; Sex Factors ; Age Factors

Transarterial radioembolization (TARE) is a widely utilized therapeutic approach for hepatocellular carcinoma (HCC), however, the clinical implementation is constrained by the stringent preparation conditions of radioembolization agents. Herein, we incorporated the superstable homogeneous iodinated formulation technology (SHIFT), simultaneously utilizing an enhanced solvent form in a carbon dioxide supercritical fluid environment, to encapsulate radionuclides (such as ¹³¹I,¹⁷⁷Lu, or ¹⁸F) with lipiodol for the preparation of radiolipiodol. The resulting radiolipiodol exhibited exceptional stability and ultra-high labeling efficiency (≥99%) and displayed notable intratumoral radionuclide retention and in vivo stability more than 2 weeks following locoregional injection in subcutaneous tumors in mice and orthotopic liver tumors in rats and rabbits. Given these encouraging findings, ¹⁸F was authorized as a radiotracer in radiolipiodol for clinical trials in HCC patients, and showed a favorable tumor accumulation, with a tumor-to-liver uptake ratio of ≥50 and minimal radionuclide leakage, confirming the feasibility of SHIFT for TARE applications. In the context of transforming from preclinical to clinical screening, the preparation of radiolipiodol by SHIFT represents an innovative physical strategy for radionuclide encapsulation. Hence, this work offers a reliable and efficient approach for TARE in HCC, showing considerable promise for clinical application (ChiCTR2400087731).

Objective To analyze the clinical characteristics of 3 patients with Wilson's disease who suffered from skin striae atrophicae after treatment with penicillamine,and to conduct literature review to extensively profile ad-verse events of penicillamine-induced skin changes.Methods A retrospective analysis was performed on the clinical data of 3 patients with Wilson's disease who developed skin striae atrophicae after administration of peni-cillamine in the Department of Pediatrics of Peking Union Medical College Hospital from August 2013 to August 2024,and a literature review was performed.Results Three patients with Wilson's disease all developed skin striae atrophicae after taking penicillamine.Among them,2 patients reduced or stopped using penicillamine short-ly after the appearance of striae atrophicae,and their striae atrophicae improved significantly.After taking penicil-lamine again,their skin changes remained stable.A literature research showed that 48 patients with Wilson's disease experienced penicillamine induced skin changes,and no similar reports of striae atrophicae were found.The reported skin changes included elastosis perforans serpiginosa,skin laxity or wrinkled skin,pseudo-pseudox-anthoma elasticum,increased skin fragility,pigmentation and so on.Among them,24 patients reduced or stopped penicillamine,and 18 patients(75％)had improved or maintained stable skin changes.Conclusions Penicillamine can cause various skin changes in patients with Wilson's disease,including striae atrophicae,which can be improved after reducing or discontinuing taking penicillamine.And skin striae atrophicae can main-tain stable even if they taking penicillamine again.

Objective:To investigate the application of time series models in forecasting pre-hospital emergency ambulance trips in Handan City and develop the LPro ensemble model for improved prediction accuracy to support emergency resource allocation.Methods:Pre-hospital emergency data from Handan Emergency Medical Command Center (2019-2023) were retrospectively analyzed. From 324 799 original records, 289 949 valid records were included after cleaning. The training set (2019-2022: 215 918 records) included 35 527 records in 2019, 52 015 in 2020, 61 836 in 2021, and 66 540 in 2022. The validation set (2023) contained 74 031 records. ARIMA, linear trend seasonal, exponential smoothing, and Prophet models were fitted to the training set. The LPro ensemble model was constructed using MAPE-based weighting (linear trend seasonal model: 0.38, Prophet: 0.62). Performance metrics included MAPE, RMSE, MAE, and R 2. Results:Data showed annual growth (compound annual growth rate 23.27%) and seasonal patterns (October peaks, February troughs). Ambulance dispatches increased annually with monthly cyclical patterns. For 2023 validation predictions: ARIMA (MAPE 8.76%, RMSE 619, MAE 491, R 2 0.4563), linear trend seasonal (MAPE 9.83%, RMSE 671, MAE 545, R 2 0.3608), Prophet (MAPE 8.43%, RMSE 562, MAE 503, R 2 0.5513), exponential smoothing (MAPE 8.08%, RMSE 643, MAE 410, R 2 0.4124). LPro model showed superior performance (MAPE 7.05%, RMSE 491, MAE 393, R 2 0.6570), with 16.37% lower MAPE, 12.63% lower RMSE, 21.87% lower MAE, and 19.17% higher R 2 versus Prophet. Conclusion:The LPro ensemble model substantially enhances prediction accuracy and reliability, offering scientific support for emergency resource optimization and dispatch scheduling in Handan City.

Clinical data of one patient diagnosed with kaposiform hemangioendothelioma (KHE) in the spinal canal and mediastinum at the Children′s Hospital, Zhejiang University School of Medicine in October 2022 were retrospectively analyzed.Additionally, a literature review on mediastinal KHE was performed to summarize prior clinical characteristics and treatments.The patient, a 25-day-old boy, presented with refractory thrombocytopenia.Multiple chest radiographs suggested significant widening of the mediastinum and atypical atelectasis in the left upper lung, and enhanced chest CT and magnetic resonance imaging suggested KHE.After cocktail therapy with Prednisolone, Vincristine and Sirolimus, platelets increased to normal, and coagulation function improved.After 3 months of follow-up, hematologic parameters were stable, the mass became smaller, and no side effects occurred.

BACKGROUND:Osteoporotic vertebral compression fracture is a common fracture secondary to osteoporosis.At present,there is no effective prediction index and method for osteoporotic vertebral compression fracture. OBJECTIVE:To investigate the predictive effect of the comprehensive index of lumbar vertebral body bone strength on osteoporotic vertebral compression fracture. METHODS:233 patients with osteoporosis were divided into a fracture group and a non-fracture group according to whether a vertebral fracture occurred.The demography,body mass index,vertebral bone mineral density and other details were collected.Lateral X-ray films of the lumbar spine were photographed.The vertebral body width,vertebral body length,sacral slope,pelvic tilt,pelvic incidence,lumbar compressive strength index and the lumbar impact strength index were measured,calculated,and analyzed by univariate and multivariate,and the receiver operating characteristic curve was analyzed.The survival analysis was conducted according to the cut-off value. RESULTS AND CONCLUSION:(1)All patients were followed up for 2-4 years,with an average of 3.1 years.During the follow-up period,99 cases(38 cases of L1 vertebral body,61 cases of L2 vertebral body)had fractures(fracture group),and 134 cases(52 cases of L1 vertebral body,82 cases of L2 vertebral body)had no fractures(non-fracture group).Univariate analysis showed that there was no significant difference in age,sex,height,body mass,body mass index and fracture segment between the two groups(P>0.05).(2)Lumbar compressive strength index and lumbar impact strength index in the fracture group were lower than those in the non-fracture group(P<0.05).Pelvic incidence and pelvic tilt in the fracture group were higher than those in the non-fracture group(P<0.05).(3)Multivariate analysis showed that lumbar compressive strength index,lumbar impact strength index and pelvic tilt were risk factors for osteoporotic vertebral compression fractures(P<0.05).(4)Receiver operating characteristic curve analysis showed that the cutoff values of vertebral bone mineral density,lumbar compressive strength index,lumbar impact strength index,pelvic tilt and pelvic incidence were 0.913 5 g/cm2,1.932,0.903,21.5° and 55°,respectively;areas under the curve were 0.630,0.800,0.911,0.633 and 0.568,respectively.(5)According to the survival analysis(with osteoporotic vertebral compression fracture as the end point),the average survival time of the patients with lumbar impact strength index≥0.903 was significantly longer than that of the patients with lumbar impact strength index<0.903(P<0.05).(6)These findings conclude that the comprehensive index of lumbar vertebral body bone strength is more accurate than the bone mineral density of the vertebral body and spine-pelvis sagittal parameters in predicting osteoporotic vertebral compression fractures,which is helpful for early prevention and treatment of osteoporotic vertebral compression fractures.

BACKGROUND:Osteoporosis vertebral compression fracture is a common fracture secondary to osteoporosis,and there is currently a lack of effective predictive indicators and methods for osteoporosis vertebral compression fracture. OBJECTIVE:To investigate the predictive effects of paravertebral muscle degeneration,functional cross-sectional area,and percentage of fat infiltration on osteoporotic vertebral compression fractures. METHODS:The 224 patients with osteoporosis diagnosed from January 2018 to June 2022 were included.They were followed up for more than 2 years.They were divided into fracture group and non-fracture group according to the presence and absence of vertebral fracture.The detailed information of demographics,body mass index,bone mineral density and so on were collected.The functional cross-sectional area and percentage of fat infiltration of bilateral Psoas major muscle and extensor dorsi(Erector spinae muscles muscle and multifidus muscle)at the level of lower endplate of L2 vertebral body were measured and calculated. RESULTS AND CONCLUSION:(1)224 patients were ultimately included,of which 126 had fractures as the fracture group and 98 had no fractures as the non-fracture group.There was no statistically significant difference in age,gender,height,body mass,body mass index,and fracture segment between the two groups(P>0.05).(2)The bone mineral density of the fracture group was significantly lower than that of the non-fracture group(P<0.05).Functional cross-sectional areas of Psoas major muscle and extensor dorsi in the fracture group were significantly lower than those in the non-fracture group(P<0.05).The percentage of fat infiltration of the extensor dorsi in the fracture group was significantly higher than that in the non-fracture group(P<0.05).There was no significant difference in percentage of fat infiltration of Psoas major muscle between the two groups(P>0.05).(3)Receiver operating characteristic analysis showed that the vertebral bone mineral density,percentage of fat infiltration of extensor dorsi,functional cross-sectional area of extensor dorsi and percentage of fat infiltration of Psoas major muscle were 0.903 g/cm2,35.426%,418.875 mm2,and 6.375%,respectively.The areas under curve were 0.634,0.755,0.876,and 0.585,respectively.(4)These findings indicate that paravertebral muscle degeneration is strongly associated with the occurrence of osteoporotic vertebral compression fractures.The functional cross-sectional area of extensor dorsi muscle can effectively predict the occurrence of osteoporotic vertebral compression fractures,which is helpful for early prevention and treatment of osteoporotic vertebral compression fractures.

Objective To explore the analgesic initiation mechanism of three-manipulation and three-acupoint tuina in model rats with minor chronic constriction injury(CCI).Methods Fifty-six SD rats were divided randomly into eight groups:normal group,sham group,model 1 group,model 2 group,tuina 1 group,tuina 2 group,tuina 1+transient receptor potential vanilloid-1(TRPV1)antagonist group,and tuina 2+transient receptor potential ankyrin 1(TRPA1)antagonist group.The model,tuina,and tuina+antagonist groups were established with minor CCI models.The tuina and tuina+antagonist groups received the three-method three-point intervention(point method,dial method,kneading method,Yinmen point,Chengshan point,Yanglingquan point)7 days after modeling.The model and sham groups were subjected to grasping restraint,and the normal group received no intervention.After the respective interventions,each group was tested for changes in mechanical withdrawal threshold(MWT)and thermal withdrawal latency(TWL)to detect different types of pain.The nitric oxide(NO)content of the dorsal root ganglion(DRG)was determined by the nitrate reductase method,and changes in protein and gene expression levels of components of the TRPV1/TRPA1-NO-cGMP-protein kinase G(PKG)signaling pathway in the DRG of each group were determined by enzyme-linked immunosorbent assay,Western blot,and qPCR.Results Compared with the model group,MWT and TWL were prolonged in the tuina 1 and tuina 2 groups.Expression levels of TRPV1,TRPA1,NO,soluble guanylate cyclase-β,cGMP,and PKG1 in the DRG were significantly decreased in the tuina 1,tuina 2,tuina 1+TRPV1 antagonist,and tuina 2+TRPA1 antagonist groups.Conclusions Tuina can effectively improve the symptoms of thermal and mechanical hyperalgesia caused by peripheral nerve injury after one-time intervention.Tuina can exert immediate and continuous analgesic effects via the TRPV1/TRPA1-NO-cGMP-PKG signaling pathway.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

Objective To explore the analgesic initiation mechanism of"three-manipulations and three-acupoints"of tuina on minor chronic constriction injury(minor CCI)model rats.Methods According to the random number table method,35 SD rats were randomly divided into five groups:normal group,sham group,model group,tuina group,and tuina+MK-801 group.The model group,tuina group,and tuina+MK-801 group were subjected to ligation of the right sciatic nerve trunk to establish a minor CCI rat model.The sham group was only exposed to the right sciatic nerve without ligation,and the normal group was not subjected to any operation.The normal group was not subjected to any intervention measures.On the seventh day after modeling,the model group and the sham group underwent 9 minutes of grasping restraint,while the tuina group underwent one intervention of three-manipulations(point method,dialing method,and kneading method)and three-acupoints(right"Yinmen"(BL37),"Chengshan"(BL57),and"Yanglingquan"(GB34)acupoints)with each manipulation and acupoint intervention for 1 minute for a total of 9 minutes.The tuina+MK-801 group received intrathecal injection of MK-801 from the fifth to seventh days after modeling,with a dose of 6 μg(10 μL)per day,tuina intervention was performed 30 minutes after the last intrathecal injection,and the specific operation of tuina was the same as that of the tuina group.Before modeling,after modeling,and after intervention,each group of rats was subjected to cold sensitivity threshold(CST)and mechanical withdrawal threshold(MWT)testing.After intervention,immunohistochemistry was used to detect the positive expression of cyclic guanosine monophosphate(cGMP)in the spinal dorsal horn(SDH)at L4-6 segments;protein expressions of N-methyl-D-aspartate receptor 1(NMDAR1),neurogenic nitric oxide synthase(nNOS),soluble guanylyl cyclase β(sGCβ),and protein kinase G1(PKG1)in SDH at L4-6 segments were detected by Western blotting;mRNA expressions of NMDAR1,nNOS,sGCβ,cGMP,and PKG1 in SDH at L4-6 segments were detected by real-time PCR.Results Compared with the normal and sham groups,after modeling,CST increased and MWT decreased in the model group,tuina group and tuina+MK-801 group(P＜0.05);after intervention,the positive protein expression of cGMP was increased,the protein expressions of NMDAR1,nNOS,sGCβ,and PKG1 were increased,and mRNA expressions of NMDAR1,nNOS,sGCβ,cGMP,and PKG1 were increased in SDH at L4-6 segments in the model group(P＜0.05).Compared with the model group,after intervention,CST decreased and MWT increased in the tuina group and tuina+MK-801 group(P＜0.05);the positive protein expression of cGMP was decreased,the protein expressions of NMDAR1,nNOS,sGCβ,and PKG1 were decreased,and mRNA expressions of NMDAR1,nNOS,sGCβ,cGMP,and PKG1 were decreased in SDH at L4-6 segments in the tuina group and tuina+MK-801 group(P＜0.05).Conclusion One-time tuina intervention can effectively improve the symptoms of thermal and mechanical hyperalgesia induced by peripheral nerve injury,which may initiate analgesia through the NMDAR1/cGMP/protein kinase G signaling pathway,thereby exerting immediate analgesic effect.