This paper summarizes Professor SHI Zaixiang's clinical experience in treating high fever caused by sepsis using Chaihu Guizhi Ganjiang Decoction （柴胡桂枝干姜汤）. He holds that the key pathogenesis of sepsis involves constrained heat in the shaoyang and internal accumulation of water and fluids. The clinical manifestations such as high fever， chills， and alternating sensations of cold and heat are attributed to pathogenic heat constrained in the shaoyang. Meanwhile， soft tissue edema and serous cavity effusions are due to shaoyang dysfunction and internal water retention. In clinical practice， treating sepsis-related high fever requires addressing both the shaoyang-constrained heat and the associated edema and effusions. The therapeutic approach focuses on harmonizing the shaoyang and resolving internal fluids， using Chaihu Guizhi Ganjiang Decoction as the base formula with flexible modifications. Professor SHI emphasizes that this formula shows a rapid antipyretic effect， particularly in cases where multiple anti-infective treatments have failed.

OBJECTIVE: To analyze the demographic and clinical characteristics of inpatients with osteoporotic vertebral compression fractures (OVCF) and provide a basis for clinical prevention and treatment. METHODS: A retrospective analysis was performed on the clinical data of 744 inpatients diagnosed with OVCF between January 2017 and December 2021 who met the inclusion criteria. Among them, 146 were male and 598 were female, with age ranging from 50 to 95 years (mean, 69.37 years). The demographic characteristics (gender, age, ethnicity, occupation, regional distribution, urban-rural distribution, and seasonal incidence) and clinical features [causes of injury, history of vertebral fractures, smoking and drinking history in males, comorbidities (hypertension, diabetes, coronary atherosclerotic heart disease, cerebral infarction), body mass index (BMI), blood lipid levels, menopausal age in females, vertebral bone mineral density T-value, number of vertebral fractures, and fracture segment distribution] of OVCF patients were analyzed. Multiple linear regression was used to analyze the independent risk factors of vertebral osteoporosis. RESULTS: The demographic analysis indicated that female patients with OVCF were significantly younger than male patients ( P<0.05). Significant differences were observed in the age distribution of OVCF between males and females ( P<0.05), with the highest proportion of male patients in the 70-79 years group (37.0%) and the highest proportion of female patients in the 60-69 years group (40.0%). From 2017 to 2021, the age of onset for OVCF gradually increased, with a similar trend observed for both genders. The distribution of occupations between genders also showed significant differences ( P<0.05); with the top three occupations for males being farmers (48.6%), retirees (24.7%), and workers (13.7%), while for females, the leading occupations were farmers (51.5%), retirees (19.4%), and service workers (10.0%). Female OVCF patients had higher BMI, vertebral bone mineral density T-value, history of vertebral fractures, hypertension prevalence, and blood lipid levels compared to male patients ( P<0.05). No significant difference between the males and the females was found in ethnicity, seasonal distribution, regional distribution, urban-rural distribution, causes of injury, number of vertebral fractures, or prevalence of comorbidities (except hypertension) ( P>0.05). Among the 744 OVCF patients, a total of 1 309 vertebrae were involved, with 628 thoracic vertebrae (48.0%) and 681 lumbar vertebrae (52.0%). The most common fracture segments were L ₁ (22.5%), T ₁₂ (21.2%), followed by L ₂ (12.2%) and T ₁₁ (10.2%). No significant gender difference was observed in the distribution of fracture segments ( P>0.05). Multiple linear regression analysis indicated that older age, female, and lower BMI were independent risk factors for vertebral osteoporosis ( P<0.05). CONCLUSION The age of onset of OVCF patients is increasing year by year. The number of fractured vertebral bodies, age distribution of morbidity, occupational distribution, BMI, history of vertebral fracture, hypertension, and blood lipid levels are related to gender. The occurrence of OVCF is mainly in the thoracolumbar segment. The female, older age, and lower BMI are independent risk factors of osteoporosis.
Humans ; Male ; Female ; Aged ; Middle Aged ; Retrospective Studies ; Spinal Fractures/etiology* ; Aged, 80 and over ; Osteoporotic Fractures/etiology* ; Fractures, Compression/etiology* ; Risk Factors ; Bone Density ; China/epidemiology* ; Osteoporosis/epidemiology* ; Comorbidity ; Inpatients ; Sex Factors ; Age Factors

OBJECTIVES: To fabricate an injectable composite microsphere hydrogel reinforced with silk fibroin/hyaluronic acid microspheres, achieving synergistic enhance-ment of mechanical robustness and biofunctionality. METHODS: Methacrylated hyaluronic acid (HAMA) and thiolated silk fibroin (TSF) were synthesized. Monodisperse microspheres generated via microfluidics were UV-cured (420 nm) through thiol-ene click reaction. These microspheres were embedded in a TSF/HAMA matrix to form photo-cured composites. The grafting rate of TSF and HAMA was characterized by H1-NMR; particle size distribution of microsphere hydrogels in soybean oil was observed by optical microscopy; gel point of composite microsphere hydrogels was determined by advanced extensional rheometer; microscopic morphology of microsphere hydrogels was observed by scanning electron microscopy; elemental distribution of microsphere hydrogels was detected by X-ray energy dispersive spectroscopy; tunability of composite microsphere hydrogels was observed by inverted confocal microscopy; mechanical properties of composite microsphere hydrogels were tested by compression testing; swelling ratio, degradation rate and water retention rate of composite microsphere hydrogels were measured by gravimetric method. Cytotoxicity of the composite microsphere hydrogels was determined by Calcein-AM/propidium iodide dual staining and CCK-8 assay; cell migration capability was observed by scratch assay. RESULTS: The grafting rates of HAMA and TSF was 48.03% and 17.99%, respectively. Microsphere hydrogels with particle sizes of (43.3±1.2), (78.1±3.0), and (130.8±1.9) μm were prepared. The gel time of the composite microsphere hydrogels was 48-115s. The laser confocal imaging confirmed dynamic regulation characteristics of the composite microsphere hydrogels. The compressive strength of the composite microsphere hydrogels reached 22.7 kPa and maintained structural integrity at 40% strain after 20 compression cycles. The composite microsphere hydrogels exhibited differential deswelling behaviors in simulated physiological environments, and reducing microsphere particle size could significantly enhance its stability under moist conditions. The degradation rate of the composite microsphere hydrogels was (49.1±0.9)% after 200 h, and water retention rate was maintained at 40%-60% after 96 h. Biocompatibility assays confirmed >95% cell viability and unimpaired cell migration abilities. CONCLUSIONS The TSF/HAMA composite microsphere hydrogel developed in this study has characteristics of rapid fabrication, adjustable mechanical properties, enhanced environmental stability and excellent biocom-patibility, thus providing a new material solution for tissue repair and regenerative medicine.
Fibroins/chemistry* ; Hydrogels/chemistry* ; Microspheres ; Hyaluronic Acid/chemistry* ; Humans

Objective To compare the 12-month efficacy and safety of N-butyl cyanoacrylate (NBCA) versus radiofrequency ablation (RFA) in treating great saphenous vein (GSV) insufficiency. Methods A total of 155 patients with GSV insufficiency from five centers were randomly allocated to the NBCA group or RFA group. Postoperative efficacy and safety outcomes were evaluated. Results Immediate postoperative closure rates of the GSV trunk were 100% in both groups. The closure rates of NBCA and RFA group were 98.6% and 98.5% at 3 months, 97.1% and 98.5% at 6 months, 98.1% and 95.9% at 12 months, with no statistically significant differences (P>0.05). After treatment, CEAP classification improved significantly from baseline in both groups. In terms of safety, 1 case of phlebitis, 1 case of ablation-related thrombus extension (ARTE) and 2 cases of calf muscle venous thrombosis(CMVT) occurred in the NBCA group, while 2 cases of limb numbness, 1 case of persistent thigh pain and 2 cases of CMVT in the RFA group. All reported serious adverse events in both groups were assessed as unrelated to the medical device or the trial procedure. Conclusions NBCA demonstrates non-inferior efficacy and safety compared to RFA for treating GSV insufficiency over 12 months.

Objective:To investigate the application of time series models in forecasting pre-hospital emergency ambulance trips in Handan City and develop the LPro ensemble model for improved prediction accuracy to support emergency resource allocation.Methods:Pre-hospital emergency data from Handan Emergency Medical Command Center (2019-2023) were retrospectively analyzed. From 324 799 original records, 289 949 valid records were included after cleaning. The training set (2019-2022: 215 918 records) included 35 527 records in 2019, 52 015 in 2020, 61 836 in 2021, and 66 540 in 2022. The validation set (2023) contained 74 031 records. ARIMA, linear trend seasonal, exponential smoothing, and Prophet models were fitted to the training set. The LPro ensemble model was constructed using MAPE-based weighting (linear trend seasonal model: 0.38, Prophet: 0.62). Performance metrics included MAPE, RMSE, MAE, and R 2. Results:Data showed annual growth (compound annual growth rate 23.27%) and seasonal patterns (October peaks, February troughs). Ambulance dispatches increased annually with monthly cyclical patterns. For 2023 validation predictions: ARIMA (MAPE 8.76%, RMSE 619, MAE 491, R 2 0.4563), linear trend seasonal (MAPE 9.83%, RMSE 671, MAE 545, R 2 0.3608), Prophet (MAPE 8.43%, RMSE 562, MAE 503, R 2 0.5513), exponential smoothing (MAPE 8.08%, RMSE 643, MAE 410, R 2 0.4124). LPro model showed superior performance (MAPE 7.05%, RMSE 491, MAE 393, R 2 0.6570), with 16.37% lower MAPE, 12.63% lower RMSE, 21.87% lower MAE, and 19.17% higher R 2 versus Prophet. Conclusion:The LPro ensemble model substantially enhances prediction accuracy and reliability, offering scientific support for emergency resource optimization and dispatch scheduling in Handan City.

Glutamate-ammonia ligase (GLUL, also known as glutamine synthetase) is a crucial enzyme that catalyzes ammonium and glutamate into glutamine in the ATP-dependent condensation. Although GLUL plays a critical role in multiple cancers, the expression and function of GLUL in gastric cancer remain unclear. In the present study, we have found that the expression level of GLUL was significantly lower in gastric cancer tissues compared with adjacent normal tissues, and correlated with N stage and TNM stage, and low GLUL expression predicted poor survival for gastric cancer patients. Knockdown of GLUL promoted the growth, migration, invasion and metastasis of gastric cancer cells in vitro and in vivo, and vice versa, which was independent of its enzyme activity. Mechanistically, GLUL competed with β-Catenin to bind to N-Cadherin, increased the stability of N-Cadherin and decreased the stability of β-Catenin by alerting their ubiquitination. Furthermore, there were lower N-Cadherin and higher β-Catenin expression levels in gastric cancer tissues compared with adjacent normal tissues. GLUL protein expression was correlated with that of N-Cadherin, and could be the independent prognostic factor in gastric cancer. Our findings reveal that GLUL stabilizes N-Cadherin by antagonizing β-Catenin to inhibit the progress of gastric cancer.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

In recent years, exosomes had been recognized as a potential cell-free therapeutic tool in the field of regenerative medicine due to their easy accessibility, low immunogenicity, and good therapeutic effect. As paracrine products of cells, exosomes not only have the functions of their donor cells but also involve fewer ethical disputes. They are more stable than traditional stem cell therapy, and easy to store, transport and sterilize, which are gradually applied in the field of oral regenerative medicine. This article provides a review of the general properties of exosomes and their application in the field of oral regeneration, with a view to exploring new pathways for functional regeneration of the stomatognathic system.

Objective To establish the UPLC fingerprint chromatogram combined with chemometric analysis for the quality evaluation of classical formula Linggui Zhugan Decoction.Methods SHIMADZU Shim-Pack GIST C18 column(100 mm×2.1 mm,2.0 μm)was used with acetonitrile-0.1%phosphoric acid aqueous solution as mobile phase,gradient elution;flow rate was 0.2 mL/min;the detection wavelength was 266 nm for the first 30 minutes and 235 nm for the last 36 minutes;the column temperature was 30℃.The UPLC fingerprint of Linggui Zhugan Decoction was established by Similarity Evaluation System for Chromatographic Fingerprint of TCM(2012.130723 version),and the common peak was determined and the similarity evaluation was carried out.Based on the peak area determination results of the common peak of the fingerprint,the quality of different batches of Linggui Zhugan Decoction was evaluated by chemometrics such as clustering analysis and principal component analysis.Results A total of 24 common peaks were confirmed and 14 components were identified by using reference substances.The similarity of 10 batches of Linggui Zhugan Decoction samples was greater than 0.950,which could be divided into two categories by chemometrics,and the principal component 1-4 were the main factors affecting its quality evaluation.OPLS-DA identified 6 differential markers.Conclusion The fingerprint research method established in the study is simple,reliable and reproducible.Through the method of fingerprint combined with chemometrics analysis,the differences between Linggui Zhugan Decoction from different origins of medicinal materials are identified,which provides a reference for the internal quality evaluation of Linggui Zhugan Decoction.

Objective By observing the effects of"three methods and three points"tuina technique on the expression of interleukin-17F(IL-17F),interleukin-17 receptor C(IL-17RC),activator 1 of nuclear transcription factor-κB(Act1),tumour necrosis factor receptor-associated factor 6(TRAF6)and M1 microglial cell expression in the spinal dorsal horn of rats with mild chronic compressive injury(minor CCI)model,we explored the immediate analgesic mechanism of tuina on peripheral neuropathic pain(pNP).Methods Thirty-six SD rats were divided into the sham group,the model group and the tuina group according to the random number method,twelve rats in each group,and the minor CCI model was replicated by ligating the right sciatic nerve.The rats in the tuina group were subjected to pointing,plucking and kneading at the BL37,BL57 and GB34 points on the affected side using a tuina simulator,while the sham group and the model group were only grasped and restrained,and were intervened for one time.The mechanical pain test and cold plate test were used to evaluate the response of rats to mechanical stimulation and cold stimulation after immediate intervention.The protein expression of IL-17F and TRAF6 in the spinal dorsal horn of rats in each group was detected by Western blotting.The mRNA expression of IL-17F,IL-17RC,Act1 and TRAF6 in the spinal dorsal horn of rats in each group was detected by real-time PCR.The average fluorescence intensity of M1 microglia in the spinal dorsal horn of rats in each group was detected by immunofluorescence.Results Behavioral results showed that before intervention,compared with the sham group,paw mechanical withdraw threshold(PMWT)decreased and cold sensitivity threshold(CST)increased in the model group and the tuina group;after tuina intervention,PMWT in the tuina group was increased,and CST was decreased compared with the model group;after intervention,PMWT in the tuina group was increased,while CST was decreased(P＜0.05).RT-PCR results showed that compared with the sham group,mRNA expression levels of IL-17F,IL-17RC,TRAF6 and Act1 in the spinal dorsal horn of the model group were increased;compared with model group,the mRNA expression levels of above indexes in the tuina group were decreased(P＜0.05).Western boltting results showed that compared with the sham group,the expression levels of IL-17F and TRAF6 protein in the spinal dorsal horn of the model group were increased;compared with the model group,the expression levels of IL-17F and TRAF6 protein in the tuina group decreased(P＜O.05).Immunofluorescence results showed that the mean fluorescence intensity of CD40 in the spinal dorsal horn of model group was enhanced compared with the sham group;compared with the model group,the mean fluorescence intensity of CD40 in the tuina group was decreased(P＜0.05).Conclusion The"three methods and three points"tuina technique can produce immediate analgesia by inhibiting the expression of IL-17F,IL-17RC,Act1,TRAF6 and the activation of M1 microglia in the dorsal horn of the spinal cord after one intervention.