BACKGROUND:Relatively or absolutely active bone resorption function of osteoclasts is one of the causative factors of osteoporosis. Therefore,how to inhibit the formation of osteoclasts and reduce the bone resorption activity is a key element in the prevention and treatment of osteoporosis. Liquiritin,which is derived from licorice,plays a role in the clinical treatment of bone diseases,but there are fewer studies addressing the application of liquiritin in osteoporosis and the mechanism is unknown.OBJECTIVE:To confirm,through both in vivo and in vitro experiments,that liquiritin inhibits osteoclast differentiation and alleviates bone loss.METHODS:Cell counting kit-8 was used to detect whether Liquiritin exerts toxic or proliferative effects on mouse bone marrow-derived macrophages,and tartrate-resistant acid phosphatase staining was performed to observe the effect of liquiritin in inhibiting osteoclast differentiation. The affinity of liquiritin binding to proteins related to osteoclast differentiation was verified by network pharmacology. RT-PCR and western blot assays were performed to detect the inhibitory effects of liquiritin on osteoclast-specific protein and gene expression as well as relevant signaling pathways. Finally,the mitigating effect of liquiritin on bone loss was verified in the C57BL/6J mouse osteoporosis model.RESULTS AND CONCLUSION:Liquiritin,at concentrations of 20 μmol/L and below,could inhibit the formation and differentiation of osteoclasts. Concurrently,it exhibited a high affinity with osteoclast-specific proteins such as nuclear factor of activated T-cells 1,Cathepsin K,c-Fos,and matrix metalloproteinase 9,and reduced the relative expression levels of these genes and proteins. Liquiritin could also effectively lower the phosphorylation expression level of JNK in the MAPK signaling pathway at the 15th,30th,45th,and 60th minutes,and it could salvage the degradation of nuclear factor-κB inhibitor α in the nuclear factor-κB signaling pathway at the 60th minute. In vivo experiments demonstrated that liquiritin could mitigate bone loss caused by osteoclasts and improve parameters related to trabecular bone. To conclude,liquiritin possesses the capacity to inhibit osteoclast differentiation and alleviate bone loss,thereby exerting a protective role against osteoporosis.

Immune disorders play a vital role in the tumors,infections and allergic diseases.As a co-inhibitory molecule that has attracted much attention in recent years,programmed cell death protein 1(PD-1)can participate in immunomodulation in various immune diseases by inhibiting the proliferation and activation of type 2 innate lymphoid cells(ILC2s).ILC2s is a newly discovered subgroup of immune cell families,which is involved in tumor immunity,anti-parasitic infection and tissue damage repair by secreting type 2 cytokines.PD-1 is a major immunosuppressive molecule that can regulate the different immunomodulatory effects of ILC2s in different immune diseases.This article reviews the role and mechanism of PD-1 in regulating ILC2s in different diseases.

BACKGROUND:Relatively or absolutely active bone resorption function of osteoclasts is one of the causative factors of osteoporosis. Therefore,how to inhibit the formation of osteoclasts and reduce the bone resorption activity is a key element in the prevention and treatment of osteoporosis. Liquiritin,which is derived from licorice,plays a role in the clinical treatment of bone diseases,but there are fewer studies addressing the application of liquiritin in osteoporosis and the mechanism is unknown.OBJECTIVE:To confirm,through both in vivo and in vitro experiments,that liquiritin inhibits osteoclast differentiation and alleviates bone loss.METHODS:Cell counting kit-8 was used to detect whether Liquiritin exerts toxic or proliferative effects on mouse bone marrow-derived macrophages,and tartrate-resistant acid phosphatase staining was performed to observe the effect of liquiritin in inhibiting osteoclast differentiation. The affinity of liquiritin binding to proteins related to osteoclast differentiation was verified by network pharmacology. RT-PCR and western blot assays were performed to detect the inhibitory effects of liquiritin on osteoclast-specific protein and gene expression as well as relevant signaling pathways. Finally,the mitigating effect of liquiritin on bone loss was verified in the C57BL/6J mouse osteoporosis model.RESULTS AND CONCLUSION:Liquiritin,at concentrations of 20 μmol/L and below,could inhibit the formation and differentiation of osteoclasts. Concurrently,it exhibited a high affinity with osteoclast-specific proteins such as nuclear factor of activated T-cells 1,Cathepsin K,c-Fos,and matrix metalloproteinase 9,and reduced the relative expression levels of these genes and proteins. Liquiritin could also effectively lower the phosphorylation expression level of JNK in the MAPK signaling pathway at the 15th,30th,45th,and 60th minutes,and it could salvage the degradation of nuclear factor-κB inhibitor α in the nuclear factor-κB signaling pathway at the 60th minute. In vivo experiments demonstrated that liquiritin could mitigate bone loss caused by osteoclasts and improve parameters related to trabecular bone. To conclude,liquiritin possesses the capacity to inhibit osteoclast differentiation and alleviate bone loss,thereby exerting a protective role against osteoporosis.

Turning to critical illness is a common stage of various diseases and injuries before death. Patients usually have complex health conditions, while the treatment process involves a wide range of content, along with high requirements for doctor′s professionalism and multi-specialty teamwork, as well as a great demand for time-sensitive treatments. However, this is not matched with critical care professionals and the current state of medical care in China. Telemedicine, which shortens the distance of medical professionals and the gap of disease diagnosis and treatments in various regions through electronic information, can effectively solve the current problem. Therefore, there is an urgent need to develop a standardized, high-quality visualization telemedicine round system .Therefore, experts have been organized to search domestic and foreign literature on telemedicine round for critically ill patients and to form this consensus based on clinical experiences so as to further improve the level of critical care treatments in regions.

Immune cells are formed by the proliferation and differentiation of hematopoietic stem cells in the bone marrow,in-cluding lymphocytes,macrophages,etc,which participate in the immune defense,immune stability and immune monitoring of the body,and are an indispensable basic component of the immune system.Basic helix-loop-helix family member E40(BHLHE40)has been shown to play an important role in adipogenesis,tumorigenesis,circadian rhythm and hypoxia response.Recently,it was found that BHLHE40 plays a key role in the cell cycle,proliferation and cytokine production of immune cells.This article will review the discovery,naming,structure,and mechanism of BHLHE40 in various periods,as well as it's research progress in immune cells,in order to provide new target for the treatment of immune-related diseases at the genetic level.

Immune cells are formed by the proliferation and differentiation of hematopoietic stem cells in the bone marrow,in-cluding lymphocytes,macrophages,etc,which participate in the immune defense,immune stability and immune monitoring of the body,and are an indispensable basic component of the immune system.Basic helix-loop-helix family member E40(BHLHE40)has been shown to play an important role in adipogenesis,tumorigenesis,circadian rhythm and hypoxia response.Recently,it was found that BHLHE40 plays a key role in the cell cycle,proliferation and cytokine production of immune cells.This article will review the discovery,naming,structure,and mechanism of BHLHE40 in various periods,as well as it's research progress in immune cells,in order to provide new target for the treatment of immune-related diseases at the genetic level.

Immune disorders play a vital role in the tumors,infections and allergic diseases.As a co-inhibitory molecule that has attracted much attention in recent years,programmed cell death protein 1(PD-1)can participate in immunomodulation in various immune diseases by inhibiting the proliferation and activation of type 2 innate lymphoid cells(ILC2s).ILC2s is a newly discovered subgroup of immune cell families,which is involved in tumor immunity,anti-parasitic infection and tissue damage repair by secreting type 2 cytokines.PD-1 is a major immunosuppressive molecule that can regulate the different immunomodulatory effects of ILC2s in different immune diseases.This article reviews the role and mechanism of PD-1 in regulating ILC2s in different diseases.

Turning to critical illness is a common stage of various diseases and injuries before death. Patients usually have complex health conditions, while the treatment process involves a wide range of content, along with high requirements for doctor′s professionalism and multi-specialty teamwork, as well as a great demand for time-sensitive treatments. However, this is not matched with critical care professionals and the current state of medical care in China. Telemedicine, which shortens the distance of medical professionals and the gap of disease diagnosis and treatments in various regions through electronic information, can effectively solve the current problem. Therefore, there is an urgent need to develop a standardized, high-quality visualization telemedicine round system .Therefore, experts have been organized to search domestic and foreign literature on telemedicine round for critically ill patients and to form this consensus based on clinical experiences so as to further improve the level of critical care treatments in regions.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

BACKGROUND:Osteoporotic vertebral compression fracture is a common fracture secondary to osteoporosis.At present,there is no effective prediction index and method for osteoporotic vertebral compression fracture. OBJECTIVE:To investigate the predictive effect of the comprehensive index of lumbar vertebral body bone strength on osteoporotic vertebral compression fracture. METHODS:233 patients with osteoporosis were divided into a fracture group and a non-fracture group according to whether a vertebral fracture occurred.The demography,body mass index,vertebral bone mineral density and other details were collected.Lateral X-ray films of the lumbar spine were photographed.The vertebral body width,vertebral body length,sacral slope,pelvic tilt,pelvic incidence,lumbar compressive strength index and the lumbar impact strength index were measured,calculated,and analyzed by univariate and multivariate,and the receiver operating characteristic curve was analyzed.The survival analysis was conducted according to the cut-off value. RESULTS AND CONCLUSION:(1)All patients were followed up for 2-4 years,with an average of 3.1 years.During the follow-up period,99 cases(38 cases of L1 vertebral body,61 cases of L2 vertebral body)had fractures(fracture group),and 134 cases(52 cases of L1 vertebral body,82 cases of L2 vertebral body)had no fractures(non-fracture group).Univariate analysis showed that there was no significant difference in age,sex,height,body mass,body mass index and fracture segment between the two groups(P>0.05).(2)Lumbar compressive strength index and lumbar impact strength index in the fracture group were lower than those in the non-fracture group(P<0.05).Pelvic incidence and pelvic tilt in the fracture group were higher than those in the non-fracture group(P<0.05).(3)Multivariate analysis showed that lumbar compressive strength index,lumbar impact strength index and pelvic tilt were risk factors for osteoporotic vertebral compression fractures(P<0.05).(4)Receiver operating characteristic curve analysis showed that the cutoff values of vertebral bone mineral density,lumbar compressive strength index,lumbar impact strength index,pelvic tilt and pelvic incidence were 0.913 5 g/cm2,1.932,0.903,21.5° and 55°,respectively;areas under the curve were 0.630,0.800,0.911,0.633 and 0.568,respectively.(5)According to the survival analysis(with osteoporotic vertebral compression fracture as the end point),the average survival time of the patients with lumbar impact strength index≥0.903 was significantly longer than that of the patients with lumbar impact strength index<0.903(P<0.05).(6)These findings conclude that the comprehensive index of lumbar vertebral body bone strength is more accurate than the bone mineral density of the vertebral body and spine-pelvis sagittal parameters in predicting osteoporotic vertebral compression fractures,which is helpful for early prevention and treatment of osteoporotic vertebral compression fractures.