This paper summarizes Professor SHI Zaixiang's clinical experience in treating high fever caused by sepsis using Chaihu Guizhi Ganjiang Decoction （柴胡桂枝干姜汤）. He holds that the key pathogenesis of sepsis involves constrained heat in the shaoyang and internal accumulation of water and fluids. The clinical manifestations such as high fever， chills， and alternating sensations of cold and heat are attributed to pathogenic heat constrained in the shaoyang. Meanwhile， soft tissue edema and serous cavity effusions are due to shaoyang dysfunction and internal water retention. In clinical practice， treating sepsis-related high fever requires addressing both the shaoyang-constrained heat and the associated edema and effusions. The therapeutic approach focuses on harmonizing the shaoyang and resolving internal fluids， using Chaihu Guizhi Ganjiang Decoction as the base formula with flexible modifications. Professor SHI emphasizes that this formula shows a rapid antipyretic effect， particularly in cases where multiple anti-infective treatments have failed.

OBJECTIVES: To fabricate an injectable composite microsphere hydrogel reinforced with silk fibroin/hyaluronic acid microspheres, achieving synergistic enhance-ment of mechanical robustness and biofunctionality. METHODS: Methacrylated hyaluronic acid (HAMA) and thiolated silk fibroin (TSF) were synthesized. Monodisperse microspheres generated via microfluidics were UV-cured (420 nm) through thiol-ene click reaction. These microspheres were embedded in a TSF/HAMA matrix to form photo-cured composites. The grafting rate of TSF and HAMA was characterized by H1-NMR; particle size distribution of microsphere hydrogels in soybean oil was observed by optical microscopy; gel point of composite microsphere hydrogels was determined by advanced extensional rheometer; microscopic morphology of microsphere hydrogels was observed by scanning electron microscopy; elemental distribution of microsphere hydrogels was detected by X-ray energy dispersive spectroscopy; tunability of composite microsphere hydrogels was observed by inverted confocal microscopy; mechanical properties of composite microsphere hydrogels were tested by compression testing; swelling ratio, degradation rate and water retention rate of composite microsphere hydrogels were measured by gravimetric method. Cytotoxicity of the composite microsphere hydrogels was determined by Calcein-AM/propidium iodide dual staining and CCK-8 assay; cell migration capability was observed by scratch assay. RESULTS: The grafting rates of HAMA and TSF was 48.03% and 17.99%, respectively. Microsphere hydrogels with particle sizes of (43.3±1.2), (78.1±3.0), and (130.8±1.9) μm were prepared. The gel time of the composite microsphere hydrogels was 48-115s. The laser confocal imaging confirmed dynamic regulation characteristics of the composite microsphere hydrogels. The compressive strength of the composite microsphere hydrogels reached 22.7 kPa and maintained structural integrity at 40% strain after 20 compression cycles. The composite microsphere hydrogels exhibited differential deswelling behaviors in simulated physiological environments, and reducing microsphere particle size could significantly enhance its stability under moist conditions. The degradation rate of the composite microsphere hydrogels was (49.1±0.9)% after 200 h, and water retention rate was maintained at 40%-60% after 96 h. Biocompatibility assays confirmed >95% cell viability and unimpaired cell migration abilities. CONCLUSIONS The TSF/HAMA composite microsphere hydrogel developed in this study has characteristics of rapid fabrication, adjustable mechanical properties, enhanced environmental stability and excellent biocom-patibility, thus providing a new material solution for tissue repair and regenerative medicine.
Fibroins/chemistry* ; Hydrogels/chemistry* ; Microspheres ; Hyaluronic Acid/chemistry* ; Humans

Transarterial radioembolization (TARE) is a widely utilized therapeutic approach for hepatocellular carcinoma (HCC), however, the clinical implementation is constrained by the stringent preparation conditions of radioembolization agents. Herein, we incorporated the superstable homogeneous iodinated formulation technology (SHIFT), simultaneously utilizing an enhanced solvent form in a carbon dioxide supercritical fluid environment, to encapsulate radionuclides (such as ¹³¹I,¹⁷⁷Lu, or ¹⁸F) with lipiodol for the preparation of radiolipiodol. The resulting radiolipiodol exhibited exceptional stability and ultra-high labeling efficiency (≥99%) and displayed notable intratumoral radionuclide retention and in vivo stability more than 2 weeks following locoregional injection in subcutaneous tumors in mice and orthotopic liver tumors in rats and rabbits. Given these encouraging findings, ¹⁸F was authorized as a radiotracer in radiolipiodol for clinical trials in HCC patients, and showed a favorable tumor accumulation, with a tumor-to-liver uptake ratio of ≥50 and minimal radionuclide leakage, confirming the feasibility of SHIFT for TARE applications. In the context of transforming from preclinical to clinical screening, the preparation of radiolipiodol by SHIFT represents an innovative physical strategy for radionuclide encapsulation. Hence, this work offers a reliable and efficient approach for TARE in HCC, showing considerable promise for clinical application (ChiCTR2400087731).

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

Objective:To explore the potential of integrating virtual surgery with three-dimensional (3D) printed guides in the surgical management of mandibular benign tumors and subsequent reconstruction of bone defects.Methods:A retrospective analysis was conducted on the clinical data of patients who underwent computer-assisted resection and vascularized fibular flap reconstruction for benign mandibular tumors at the Department of Oral and Maxillofacial Surgery, First Affiliated Hospital of Zhengzhou University, from June 2013 to December 2020. According to the utilization of guide plates for mandibular and fibular osteotomy during surgical procedures or not, the patients were categorized into two cohorts: a guide plate cohort and a non-guide plate cohort. In the guide plate group, custom-designed gudie plates based on virtual surgical plans were fabricated using 3D printing technology and employed intraoperatively; In the non-guide plate group, surgery was exclusively performed based on virtual surgical plan and prebent titanium plate without any supplementary plating. The measured outcomes included fibular flap osteotomy, operation duration, and clinical flap survival. Computed tomography images obtained one week post-surgery were utilized to assess the intersegmental commissure degree between fibular segments as well as between fibular segments and mandible, commissure degree between fibular segments and prebent titanium plate, and condyle position. The satisfaction of patients with their facial appearance was evaluated 6 months after the surgery using a visual analogue scale. Statistical analysis was conducted using SPSS 21.0 software. Independent sample t-tests was utilized to compare the duration of operation and and postoperative evaluation of facial appearance, the Chi-square tests was utilized for condyle position, commissure degrees among interactions involving fibular segments, prebent titanium plates, bone segments( P<0.05 denoted statistical significance). Results:A total of 30 patients were enrolled, comprising 17 males and 13 females, with a median age of 24 years (16-64 years). The preparation process of fibular flaps proceeded smoothly. The required length of fibula was measured as (14.1 ± 1.9) cm (5.7-18.1 cm), while the number of fibular segments ranged from 2 to 4, averaging at approximately 2.9 ± 0.6. The mandibular defects were repaired using a single-layer fibula in 12 cases, a vascularized folded fibula in 7 cases and a combination of vascularized and non-vascularized fibula in 11 cases. The operation time for the guide plate group was recorded as ( 335.9 ± 64.0) min (240-433 min), while it was observed to be (470.7 ± 140.5 ) min (280-680 min) for the non-guide plate group.The postoperative follow-up duration ranged from 9 to 23 months, with an average period of 11 months. All fibular flaps demonstrated clinical survival. The number of patients with good commissure degree between fibular and mandibular segments, between prebent titanium plate and fibular and mandibular segments and the position of condyle were 15, 15 and 13 cases in guide plate group, 10, 13 and 11 cases in non-guide plate group respectively. The statistical analysis revealed a significant difference ( P<0.05) in the degree of commissure between the fibular and the mandibular segments (15/15 vs. 10/15) in the two groups. Both groups exhibited high levels of satisfaction regarding their postoperative facial appearance at the 6 months follow-up, observed to be 9.6±0.5 and 9.3±0.5 respectively, and the statisticla analysis revealed non-significant difference ( P>0.05). Conclusion:The integration of virtual surgery with 3D printed guide plates can effectively reduce operative time and improve precision in the repair and reconstruction of free-fibular flaps following resection of benign tumors of the mandible.

Objective:To explore the potential of integrating virtual surgery with three-dimensional (3D) printed guides in the surgical management of mandibular benign tumors and subsequent reconstruction of bone defects.Methods:A retrospective analysis was conducted on the clinical data of patients who underwent computer-assisted resection and vascularized fibular flap reconstruction for benign mandibular tumors at the Department of Oral and Maxillofacial Surgery, First Affiliated Hospital of Zhengzhou University, from June 2013 to December 2020. According to the utilization of guide plates for mandibular and fibular osteotomy during surgical procedures or not, the patients were categorized into two cohorts: a guide plate cohort and a non-guide plate cohort. In the guide plate group, custom-designed gudie plates based on virtual surgical plans were fabricated using 3D printing technology and employed intraoperatively; In the non-guide plate group, surgery was exclusively performed based on virtual surgical plan and prebent titanium plate without any supplementary plating. The measured outcomes included fibular flap osteotomy, operation duration, and clinical flap survival. Computed tomography images obtained one week post-surgery were utilized to assess the intersegmental commissure degree between fibular segments as well as between fibular segments and mandible, commissure degree between fibular segments and prebent titanium plate, and condyle position. The satisfaction of patients with their facial appearance was evaluated 6 months after the surgery using a visual analogue scale. Statistical analysis was conducted using SPSS 21.0 software. Independent sample t-tests was utilized to compare the duration of operation and and postoperative evaluation of facial appearance, the Chi-square tests was utilized for condyle position, commissure degrees among interactions involving fibular segments, prebent titanium plates, bone segments( P<0.05 denoted statistical significance). Results:A total of 30 patients were enrolled, comprising 17 males and 13 females, with a median age of 24 years (16-64 years). The preparation process of fibular flaps proceeded smoothly. The required length of fibula was measured as (14.1 ± 1.9) cm (5.7-18.1 cm), while the number of fibular segments ranged from 2 to 4, averaging at approximately 2.9 ± 0.6. The mandibular defects were repaired using a single-layer fibula in 12 cases, a vascularized folded fibula in 7 cases and a combination of vascularized and non-vascularized fibula in 11 cases. The operation time for the guide plate group was recorded as ( 335.9 ± 64.0) min (240-433 min), while it was observed to be (470.7 ± 140.5 ) min (280-680 min) for the non-guide plate group.The postoperative follow-up duration ranged from 9 to 23 months, with an average period of 11 months. All fibular flaps demonstrated clinical survival. The number of patients with good commissure degree between fibular and mandibular segments, between prebent titanium plate and fibular and mandibular segments and the position of condyle were 15, 15 and 13 cases in guide plate group, 10, 13 and 11 cases in non-guide plate group respectively. The statistical analysis revealed a significant difference ( P<0.05) in the degree of commissure between the fibular and the mandibular segments (15/15 vs. 10/15) in the two groups. Both groups exhibited high levels of satisfaction regarding their postoperative facial appearance at the 6 months follow-up, observed to be 9.6±0.5 and 9.3±0.5 respectively, and the statisticla analysis revealed non-significant difference ( P>0.05). Conclusion:The integration of virtual surgery with 3D printed guide plates can effectively reduce operative time and improve precision in the repair and reconstruction of free-fibular flaps following resection of benign tumors of the mandible.

Over the past decade, mitochondrial dysfunction has been investigated as a key contributor to acute and chronic kidney disease. However, the precise molecular mechanisms linking mitochondrial damage to kidney disease remain elusive. The recent insights into the cyclic guanosine monophosphate-adenosine monophosphate (GMP-AMP) synthetase (cGAS)-stimulator of interferon gene (STING) signaling pathway have revealed its involvement in many renal diseases. One of these findings is that mitochondrial DNA (mtDNA) induces inflammatory responses via the cGAS-STING pathway. Herein, we provide an overview of the mechanisms underlying mtDNA release following mitochondrial damage, focusing specifically on the association between mtDNA release-activated cGAS-STING signaling and the development of kidney diseases. Furthermore, we summarize the latest findings of cGAS-STING signaling pathway in cell, with a particular emphasis on its downstream signaling related to kidney diseases. This review intends to enhance our understanding of the intricate relationship among the cGAS-STING pathway, kidney diseases, and mitochondrial dysfunction.

Objective:To compare the therapeutic effects of partial nephrectomy (PN) and cryoablation (CA) in patients with stage cT 1N 0M 0 renal cell carcinoma (RCC). Methods:A retrospective analysis was conducted on clinical data of patients with stage cT 1N 0M 0 RCC who underwent CA and PN treatment at The First Affiliated Hospital of Naval Medical University and Shanghai Ninth People's Hospital between March 2011 and December 2019. There were 50 cases in the CA group (36 from The First Affiliated Hospital of Naval Medical University and 14 from the Shanghai Ninth People's Hospital), and 1 323 cases in the PN group (all from The First Affiliated Hospital of Naval Medical University). PN included open surgery, laparoscopic surgery, or robotic surgery performed under general anesthesia through the abdominal or retroperitoneal approach. CA included laparoscopic surgery under general anesthesia and percutaneous treatment guided by CT or ultrasound under local anesthesia. Propensity score matching was performed based on baseline data of the patients to obtain balanced samples between the two groups using a 1∶2 nearest-neighbor matching method. After matching, comparisons were made between the two groups in terms of perioperative conditions, overall survival (OS), and recurrence-free survival (RFS). Results:After PSM, patient distributions were closely balanced in baseline data such as gender (male/female: 28/19 cases in CA group and 58/36 cases in PN group), age [66.0(53.0, 75.0) years vs. 59.5(50.0, 69.3) years], body mass index[ (24.1 ± 6.4) kg/m 2 vs. (24.1 ± 3.1) kg/m 2], Charlson comorbidity index [1(0, 2) vs. 1(0, 2)], history of malignant tumors [19.1% (9/47) vs. 17.0% (16/94)], preoperative estimated glomerular filtration rate (eGFR) [85.2(65.5, 97.1) ml/(min·1.73m 2) vs. 87.0(73.4, 100.4) ml/(min·1.73m 2)], and R. E.N.A.L. score [6(5, 7) vs. 7(6, 8)] between CA(n=47) and PN(n=94) group. There were significant differences in operative time [97.5(81.2, 117.5) min vs. 145.0(110.2, 185.0) min, P<0.001], estimated blood loss [85.0(50.0, 100.0) ml vs. 100.0(75.0, 200.0)ml, P=0.021], length of hospital stay [3.0(2.0, 4.0) days vs. 7.6(5.0, 9.0) days, P<0.001] between the CA and the PN group. No significant differences were observed in the incidence of postoperative complications [4.3% (2/47) vs. 5.3% (5/94), P=0.784], the eGFR within one week after surgery [83.7(65.6, 106.6) ml/(min·1.73m 2) vs. 83.2(66.7, 97.7) ml/(min·1.73m 2), P=0.645], the median follow-up time [ 93 (67, 126) months vs. 85 (68, 139) months, P=0.955], the RFS rate[81.8% vs. 96.8%, P=0.074], or the OS rate [85.7% vs. 97.8%, P=0.190] between the CA and the PN group. Conclusions:For patients with cT 1N 0M 0 stage RCC, CA and PN demonstrate comparable oncologic treatment efficacy, while CA offering the advantages of shorter surgical time, shorter hospital stay, and less blood loss.

Focal therapy for renal cell carcinoma is a precision treatment technique that directly targets and destroys cancerous lesions while preserving the maximum amount of surrounding healthy kidney tissue through localized intervention. It is primarily indicated for early-stage renal cell carcinoma in patients with tumors ≤4 cm in diameter (T 1a), particularly for those at higher surgical risk. Compared to traditional radical nephrectomy and partial nephrectomy, focal therapy offers several advantages, including lower physical demands on the patient, minimally invasive nature, reduced risk of complications, and faster recovery. The focal therapy techniques currently utilized in clinical practice include cryoablation, radiofrequency ablation, microwave ablation, irreversible electroporation, high-intensity focused ultrasound, and stereotactic body radiotherapy. This article reviews the principles of various focal therapy techniques, patient selection, and the oncological outcomes, complications, and renal function preservation associated with these focal therapies.

Objective To explore the analgesic initiation mechanism of three-manipulation and three-acupoint tuina in model rats with minor chronic constriction injury(CCI).Methods Fifty-six SD rats were divided randomly into eight groups:normal group,sham group,model 1 group,model 2 group,tuina 1 group,tuina 2 group,tuina 1+transient receptor potential vanilloid-1(TRPV1)antagonist group,and tuina 2+transient receptor potential ankyrin 1(TRPA1)antagonist group.The model,tuina,and tuina+antagonist groups were established with minor CCI models.The tuina and tuina+antagonist groups received the three-method three-point intervention(point method,dial method,kneading method,Yinmen point,Chengshan point,Yanglingquan point)7 days after modeling.The model and sham groups were subjected to grasping restraint,and the normal group received no intervention.After the respective interventions,each group was tested for changes in mechanical withdrawal threshold(MWT)and thermal withdrawal latency(TWL)to detect different types of pain.The nitric oxide(NO)content of the dorsal root ganglion(DRG)was determined by the nitrate reductase method,and changes in protein and gene expression levels of components of the TRPV1/TRPA1-NO-cGMP-protein kinase G(PKG)signaling pathway in the DRG of each group were determined by enzyme-linked immunosorbent assay,Western blot,and qPCR.Results Compared with the model group,MWT and TWL were prolonged in the tuina 1 and tuina 2 groups.Expression levels of TRPV1,TRPA1,NO,soluble guanylate cyclase-β,cGMP,and PKG1 in the DRG were significantly decreased in the tuina 1,tuina 2,tuina 1+TRPV1 antagonist,and tuina 2+TRPA1 antagonist groups.Conclusions Tuina can effectively improve the symptoms of thermal and mechanical hyperalgesia caused by peripheral nerve injury after one-time intervention.Tuina can exert immediate and continuous analgesic effects via the TRPV1/TRPA1-NO-cGMP-PKG signaling pathway.