This paper summarizes Professor SHI Zaixiang's clinical experience in treating high fever caused by sepsis using Chaihu Guizhi Ganjiang Decoction （柴胡桂枝干姜汤）. He holds that the key pathogenesis of sepsis involves constrained heat in the shaoyang and internal accumulation of water and fluids. The clinical manifestations such as high fever， chills， and alternating sensations of cold and heat are attributed to pathogenic heat constrained in the shaoyang. Meanwhile， soft tissue edema and serous cavity effusions are due to shaoyang dysfunction and internal water retention. In clinical practice， treating sepsis-related high fever requires addressing both the shaoyang-constrained heat and the associated edema and effusions. The therapeutic approach focuses on harmonizing the shaoyang and resolving internal fluids， using Chaihu Guizhi Ganjiang Decoction as the base formula with flexible modifications. Professor SHI emphasizes that this formula shows a rapid antipyretic effect， particularly in cases where multiple anti-infective treatments have failed.

OBJECTIVES: To fabricate an injectable composite microsphere hydrogel reinforced with silk fibroin/hyaluronic acid microspheres, achieving synergistic enhance-ment of mechanical robustness and biofunctionality. METHODS: Methacrylated hyaluronic acid (HAMA) and thiolated silk fibroin (TSF) were synthesized. Monodisperse microspheres generated via microfluidics were UV-cured (420 nm) through thiol-ene click reaction. These microspheres were embedded in a TSF/HAMA matrix to form photo-cured composites. The grafting rate of TSF and HAMA was characterized by H1-NMR; particle size distribution of microsphere hydrogels in soybean oil was observed by optical microscopy; gel point of composite microsphere hydrogels was determined by advanced extensional rheometer; microscopic morphology of microsphere hydrogels was observed by scanning electron microscopy; elemental distribution of microsphere hydrogels was detected by X-ray energy dispersive spectroscopy; tunability of composite microsphere hydrogels was observed by inverted confocal microscopy; mechanical properties of composite microsphere hydrogels were tested by compression testing; swelling ratio, degradation rate and water retention rate of composite microsphere hydrogels were measured by gravimetric method. Cytotoxicity of the composite microsphere hydrogels was determined by Calcein-AM/propidium iodide dual staining and CCK-8 assay; cell migration capability was observed by scratch assay. RESULTS: The grafting rates of HAMA and TSF was 48.03% and 17.99%, respectively. Microsphere hydrogels with particle sizes of (43.3±1.2), (78.1±3.0), and (130.8±1.9) μm were prepared. The gel time of the composite microsphere hydrogels was 48-115s. The laser confocal imaging confirmed dynamic regulation characteristics of the composite microsphere hydrogels. The compressive strength of the composite microsphere hydrogels reached 22.7 kPa and maintained structural integrity at 40% strain after 20 compression cycles. The composite microsphere hydrogels exhibited differential deswelling behaviors in simulated physiological environments, and reducing microsphere particle size could significantly enhance its stability under moist conditions. The degradation rate of the composite microsphere hydrogels was (49.1±0.9)% after 200 h, and water retention rate was maintained at 40%-60% after 96 h. Biocompatibility assays confirmed >95% cell viability and unimpaired cell migration abilities. CONCLUSIONS The TSF/HAMA composite microsphere hydrogel developed in this study has characteristics of rapid fabrication, adjustable mechanical properties, enhanced environmental stability and excellent biocom-patibility, thus providing a new material solution for tissue repair and regenerative medicine.
Fibroins/chemistry* ; Hydrogels/chemistry* ; Microspheres ; Hyaluronic Acid/chemistry* ; Humans

Transarterial radioembolization (TARE) is a widely utilized therapeutic approach for hepatocellular carcinoma (HCC), however, the clinical implementation is constrained by the stringent preparation conditions of radioembolization agents. Herein, we incorporated the superstable homogeneous iodinated formulation technology (SHIFT), simultaneously utilizing an enhanced solvent form in a carbon dioxide supercritical fluid environment, to encapsulate radionuclides (such as ¹³¹I,¹⁷⁷Lu, or ¹⁸F) with lipiodol for the preparation of radiolipiodol. The resulting radiolipiodol exhibited exceptional stability and ultra-high labeling efficiency (≥99%) and displayed notable intratumoral radionuclide retention and in vivo stability more than 2 weeks following locoregional injection in subcutaneous tumors in mice and orthotopic liver tumors in rats and rabbits. Given these encouraging findings, ¹⁸F was authorized as a radiotracer in radiolipiodol for clinical trials in HCC patients, and showed a favorable tumor accumulation, with a tumor-to-liver uptake ratio of ≥50 and minimal radionuclide leakage, confirming the feasibility of SHIFT for TARE applications. In the context of transforming from preclinical to clinical screening, the preparation of radiolipiodol by SHIFT represents an innovative physical strategy for radionuclide encapsulation. Hence, this work offers a reliable and efficient approach for TARE in HCC, showing considerable promise for clinical application (ChiCTR2400087731).

Over the past decade, mitochondrial dysfunction has been investigated as a key contributor to acute and chronic kidney disease. However, the precise molecular mechanisms linking mitochondrial damage to kidney disease remain elusive. The recent insights into the cyclic guanosine monophosphate-adenosine monophosphate (GMP-AMP) synthetase (cGAS)-stimulator of interferon gene (STING) signaling pathway have revealed its involvement in many renal diseases. One of these findings is that mitochondrial DNA (mtDNA) induces inflammatory responses via the cGAS-STING pathway. Herein, we provide an overview of the mechanisms underlying mtDNA release following mitochondrial damage, focusing specifically on the association between mtDNA release-activated cGAS-STING signaling and the development of kidney diseases. Furthermore, we summarize the latest findings of cGAS-STING signaling pathway in cell, with a particular emphasis on its downstream signaling related to kidney diseases. This review intends to enhance our understanding of the intricate relationship among the cGAS-STING pathway, kidney diseases, and mitochondrial dysfunction.

Objective:To explore the potential of integrating virtual surgery with three-dimensional (3D) printed guides in the surgical management of mandibular benign tumors and subsequent reconstruction of bone defects.Methods:A retrospective analysis was conducted on the clinical data of patients who underwent computer-assisted resection and vascularized fibular flap reconstruction for benign mandibular tumors at the Department of Oral and Maxillofacial Surgery, First Affiliated Hospital of Zhengzhou University, from June 2013 to December 2020. According to the utilization of guide plates for mandibular and fibular osteotomy during surgical procedures or not, the patients were categorized into two cohorts: a guide plate cohort and a non-guide plate cohort. In the guide plate group, custom-designed gudie plates based on virtual surgical plans were fabricated using 3D printing technology and employed intraoperatively; In the non-guide plate group, surgery was exclusively performed based on virtual surgical plan and prebent titanium plate without any supplementary plating. The measured outcomes included fibular flap osteotomy, operation duration, and clinical flap survival. Computed tomography images obtained one week post-surgery were utilized to assess the intersegmental commissure degree between fibular segments as well as between fibular segments and mandible, commissure degree between fibular segments and prebent titanium plate, and condyle position. The satisfaction of patients with their facial appearance was evaluated 6 months after the surgery using a visual analogue scale. Statistical analysis was conducted using SPSS 21.0 software. Independent sample t-tests was utilized to compare the duration of operation and and postoperative evaluation of facial appearance, the Chi-square tests was utilized for condyle position, commissure degrees among interactions involving fibular segments, prebent titanium plates, bone segments( P<0.05 denoted statistical significance). Results:A total of 30 patients were enrolled, comprising 17 males and 13 females, with a median age of 24 years (16-64 years). The preparation process of fibular flaps proceeded smoothly. The required length of fibula was measured as (14.1 ± 1.9) cm (5.7-18.1 cm), while the number of fibular segments ranged from 2 to 4, averaging at approximately 2.9 ± 0.6. The mandibular defects were repaired using a single-layer fibula in 12 cases, a vascularized folded fibula in 7 cases and a combination of vascularized and non-vascularized fibula in 11 cases. The operation time for the guide plate group was recorded as ( 335.9 ± 64.0) min (240-433 min), while it was observed to be (470.7 ± 140.5 ) min (280-680 min) for the non-guide plate group.The postoperative follow-up duration ranged from 9 to 23 months, with an average period of 11 months. All fibular flaps demonstrated clinical survival. The number of patients with good commissure degree between fibular and mandibular segments, between prebent titanium plate and fibular and mandibular segments and the position of condyle were 15, 15 and 13 cases in guide plate group, 10, 13 and 11 cases in non-guide plate group respectively. The statistical analysis revealed a significant difference ( P<0.05) in the degree of commissure between the fibular and the mandibular segments (15/15 vs. 10/15) in the two groups. Both groups exhibited high levels of satisfaction regarding their postoperative facial appearance at the 6 months follow-up, observed to be 9.6±0.5 and 9.3±0.5 respectively, and the statisticla analysis revealed non-significant difference ( P>0.05). Conclusion:The integration of virtual surgery with 3D printed guide plates can effectively reduce operative time and improve precision in the repair and reconstruction of free-fibular flaps following resection of benign tumors of the mandible.

Objective:To explore the potential of integrating virtual surgery with three-dimensional (3D) printed guides in the surgical management of mandibular benign tumors and subsequent reconstruction of bone defects.Methods:A retrospective analysis was conducted on the clinical data of patients who underwent computer-assisted resection and vascularized fibular flap reconstruction for benign mandibular tumors at the Department of Oral and Maxillofacial Surgery, First Affiliated Hospital of Zhengzhou University, from June 2013 to December 2020. According to the utilization of guide plates for mandibular and fibular osteotomy during surgical procedures or not, the patients were categorized into two cohorts: a guide plate cohort and a non-guide plate cohort. In the guide plate group, custom-designed gudie plates based on virtual surgical plans were fabricated using 3D printing technology and employed intraoperatively; In the non-guide plate group, surgery was exclusively performed based on virtual surgical plan and prebent titanium plate without any supplementary plating. The measured outcomes included fibular flap osteotomy, operation duration, and clinical flap survival. Computed tomography images obtained one week post-surgery were utilized to assess the intersegmental commissure degree between fibular segments as well as between fibular segments and mandible, commissure degree between fibular segments and prebent titanium plate, and condyle position. The satisfaction of patients with their facial appearance was evaluated 6 months after the surgery using a visual analogue scale. Statistical analysis was conducted using SPSS 21.0 software. Independent sample t-tests was utilized to compare the duration of operation and and postoperative evaluation of facial appearance, the Chi-square tests was utilized for condyle position, commissure degrees among interactions involving fibular segments, prebent titanium plates, bone segments( P<0.05 denoted statistical significance). Results:A total of 30 patients were enrolled, comprising 17 males and 13 females, with a median age of 24 years (16-64 years). The preparation process of fibular flaps proceeded smoothly. The required length of fibula was measured as (14.1 ± 1.9) cm (5.7-18.1 cm), while the number of fibular segments ranged from 2 to 4, averaging at approximately 2.9 ± 0.6. The mandibular defects were repaired using a single-layer fibula in 12 cases, a vascularized folded fibula in 7 cases and a combination of vascularized and non-vascularized fibula in 11 cases. The operation time for the guide plate group was recorded as ( 335.9 ± 64.0) min (240-433 min), while it was observed to be (470.7 ± 140.5 ) min (280-680 min) for the non-guide plate group.The postoperative follow-up duration ranged from 9 to 23 months, with an average period of 11 months. All fibular flaps demonstrated clinical survival. The number of patients with good commissure degree between fibular and mandibular segments, between prebent titanium plate and fibular and mandibular segments and the position of condyle were 15, 15 and 13 cases in guide plate group, 10, 13 and 11 cases in non-guide plate group respectively. The statistical analysis revealed a significant difference ( P<0.05) in the degree of commissure between the fibular and the mandibular segments (15/15 vs. 10/15) in the two groups. Both groups exhibited high levels of satisfaction regarding their postoperative facial appearance at the 6 months follow-up, observed to be 9.6±0.5 and 9.3±0.5 respectively, and the statisticla analysis revealed non-significant difference ( P>0.05). Conclusion:The integration of virtual surgery with 3D printed guide plates can effectively reduce operative time and improve precision in the repair and reconstruction of free-fibular flaps following resection of benign tumors of the mandible.

Objective By observing the effects of"three methods and three points"tuina technique on the expression of interleukin-17F(IL-17F),interleukin-17 receptor C(IL-17RC),activator 1 of nuclear transcription factor-κB(Act1),tumour necrosis factor receptor-associated factor 6(TRAF6)and M1 microglial cell expression in the spinal dorsal horn of rats with mild chronic compressive injury(minor CCI)model,we explored the immediate analgesic mechanism of tuina on peripheral neuropathic pain(pNP).Methods Thirty-six SD rats were divided into the sham group,the model group and the tuina group according to the random number method,twelve rats in each group,and the minor CCI model was replicated by ligating the right sciatic nerve.The rats in the tuina group were subjected to pointing,plucking and kneading at the BL37,BL57 and GB34 points on the affected side using a tuina simulator,while the sham group and the model group were only grasped and restrained,and were intervened for one time.The mechanical pain test and cold plate test were used to evaluate the response of rats to mechanical stimulation and cold stimulation after immediate intervention.The protein expression of IL-17F and TRAF6 in the spinal dorsal horn of rats in each group was detected by Western blotting.The mRNA expression of IL-17F,IL-17RC,Act1 and TRAF6 in the spinal dorsal horn of rats in each group was detected by real-time PCR.The average fluorescence intensity of M1 microglia in the spinal dorsal horn of rats in each group was detected by immunofluorescence.Results Behavioral results showed that before intervention,compared with the sham group,paw mechanical withdraw threshold(PMWT)decreased and cold sensitivity threshold(CST)increased in the model group and the tuina group;after tuina intervention,PMWT in the tuina group was increased,and CST was decreased compared with the model group;after intervention,PMWT in the tuina group was increased,while CST was decreased(P＜0.05).RT-PCR results showed that compared with the sham group,mRNA expression levels of IL-17F,IL-17RC,TRAF6 and Act1 in the spinal dorsal horn of the model group were increased;compared with model group,the mRNA expression levels of above indexes in the tuina group were decreased(P＜0.05).Western boltting results showed that compared with the sham group,the expression levels of IL-17F and TRAF6 protein in the spinal dorsal horn of the model group were increased;compared with the model group,the expression levels of IL-17F and TRAF6 protein in the tuina group decreased(P＜O.05).Immunofluorescence results showed that the mean fluorescence intensity of CD40 in the spinal dorsal horn of model group was enhanced compared with the sham group;compared with the model group,the mean fluorescence intensity of CD40 in the tuina group was decreased(P＜0.05).Conclusion The"three methods and three points"tuina technique can produce immediate analgesia by inhibiting the expression of IL-17F,IL-17RC,Act1,TRAF6 and the activation of M1 microglia in the dorsal horn of the spinal cord after one intervention.

Objective To explore the analgesic initiation mechanism of"three-manipulations and three-acupoints"of tuina on minor chronic constriction injury(minor CCI)model rats.Methods According to the random number table method,35 SD rats were randomly divided into five groups:normal group,sham group,model group,tuina group,and tuina+MK-801 group.The model group,tuina group,and tuina+MK-801 group were subjected to ligation of the right sciatic nerve trunk to establish a minor CCI rat model.The sham group was only exposed to the right sciatic nerve without ligation,and the normal group was not subjected to any operation.The normal group was not subjected to any intervention measures.On the seventh day after modeling,the model group and the sham group underwent 9 minutes of grasping restraint,while the tuina group underwent one intervention of three-manipulations(point method,dialing method,and kneading method)and three-acupoints(right"Yinmen"(BL37),"Chengshan"(BL57),and"Yanglingquan"(GB34)acupoints)with each manipulation and acupoint intervention for 1 minute for a total of 9 minutes.The tuina+MK-801 group received intrathecal injection of MK-801 from the fifth to seventh days after modeling,with a dose of 6 μg(10 μL)per day,tuina intervention was performed 30 minutes after the last intrathecal injection,and the specific operation of tuina was the same as that of the tuina group.Before modeling,after modeling,and after intervention,each group of rats was subjected to cold sensitivity threshold(CST)and mechanical withdrawal threshold(MWT)testing.After intervention,immunohistochemistry was used to detect the positive expression of cyclic guanosine monophosphate(cGMP)in the spinal dorsal horn(SDH)at L4-6 segments;protein expressions of N-methyl-D-aspartate receptor 1(NMDAR1),neurogenic nitric oxide synthase(nNOS),soluble guanylyl cyclase β(sGCβ),and protein kinase G1(PKG1)in SDH at L4-6 segments were detected by Western blotting;mRNA expressions of NMDAR1,nNOS,sGCβ,cGMP,and PKG1 in SDH at L4-6 segments were detected by real-time PCR.Results Compared with the normal and sham groups,after modeling,CST increased and MWT decreased in the model group,tuina group and tuina+MK-801 group(P＜0.05);after intervention,the positive protein expression of cGMP was increased,the protein expressions of NMDAR1,nNOS,sGCβ,and PKG1 were increased,and mRNA expressions of NMDAR1,nNOS,sGCβ,cGMP,and PKG1 were increased in SDH at L4-6 segments in the model group(P＜0.05).Compared with the model group,after intervention,CST decreased and MWT increased in the tuina group and tuina+MK-801 group(P＜0.05);the positive protein expression of cGMP was decreased,the protein expressions of NMDAR1,nNOS,sGCβ,and PKG1 were decreased,and mRNA expressions of NMDAR1,nNOS,sGCβ,cGMP,and PKG1 were decreased in SDH at L4-6 segments in the tuina group and tuina+MK-801 group(P＜0.05).Conclusion One-time tuina intervention can effectively improve the symptoms of thermal and mechanical hyperalgesia induced by peripheral nerve injury,which may initiate analgesia through the NMDAR1/cGMP/protein kinase G signaling pathway,thereby exerting immediate analgesic effect.

Objective To establish the UPLC fingerprint chromatogram combined with chemometric analysis for the quality evaluation of classical formula Linggui Zhugan Decoction.Methods SHIMADZU Shim-Pack GIST C18 column(100 mm×2.1 mm,2.0 μm)was used with acetonitrile-0.1%phosphoric acid aqueous solution as mobile phase,gradient elution;flow rate was 0.2 mL/min;the detection wavelength was 266 nm for the first 30 minutes and 235 nm for the last 36 minutes;the column temperature was 30℃.The UPLC fingerprint of Linggui Zhugan Decoction was established by Similarity Evaluation System for Chromatographic Fingerprint of TCM(2012.130723 version),and the common peak was determined and the similarity evaluation was carried out.Based on the peak area determination results of the common peak of the fingerprint,the quality of different batches of Linggui Zhugan Decoction was evaluated by chemometrics such as clustering analysis and principal component analysis.Results A total of 24 common peaks were confirmed and 14 components were identified by using reference substances.The similarity of 10 batches of Linggui Zhugan Decoction samples was greater than 0.950,which could be divided into two categories by chemometrics,and the principal component 1-4 were the main factors affecting its quality evaluation.OPLS-DA identified 6 differential markers.Conclusion The fingerprint research method established in the study is simple,reliable and reproducible.Through the method of fingerprint combined with chemometrics analysis,the differences between Linggui Zhugan Decoction from different origins of medicinal materials are identified,which provides a reference for the internal quality evaluation of Linggui Zhugan Decoction.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.