This paper summarizes Professor SHI Zaixiang's clinical experience in treating high fever caused by sepsis using Chaihu Guizhi Ganjiang Decoction （柴胡桂枝干姜汤）. He holds that the key pathogenesis of sepsis involves constrained heat in the shaoyang and internal accumulation of water and fluids. The clinical manifestations such as high fever， chills， and alternating sensations of cold and heat are attributed to pathogenic heat constrained in the shaoyang. Meanwhile， soft tissue edema and serous cavity effusions are due to shaoyang dysfunction and internal water retention. In clinical practice， treating sepsis-related high fever requires addressing both the shaoyang-constrained heat and the associated edema and effusions. The therapeutic approach focuses on harmonizing the shaoyang and resolving internal fluids， using Chaihu Guizhi Ganjiang Decoction as the base formula with flexible modifications. Professor SHI emphasizes that this formula shows a rapid antipyretic effect， particularly in cases where multiple anti-infective treatments have failed.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

Objective To explore the analgesic initiation mechanism of"three-manipulations and three-acupoints"of tuina on minor chronic constriction injury(minor CCI)model rats.Methods According to the random number table method,35 SD rats were randomly divided into five groups:normal group,sham group,model group,tuina group,and tuina+MK-801 group.The model group,tuina group,and tuina+MK-801 group were subjected to ligation of the right sciatic nerve trunk to establish a minor CCI rat model.The sham group was only exposed to the right sciatic nerve without ligation,and the normal group was not subjected to any operation.The normal group was not subjected to any intervention measures.On the seventh day after modeling,the model group and the sham group underwent 9 minutes of grasping restraint,while the tuina group underwent one intervention of three-manipulations(point method,dialing method,and kneading method)and three-acupoints(right"Yinmen"(BL37),"Chengshan"(BL57),and"Yanglingquan"(GB34)acupoints)with each manipulation and acupoint intervention for 1 minute for a total of 9 minutes.The tuina+MK-801 group received intrathecal injection of MK-801 from the fifth to seventh days after modeling,with a dose of 6 μg(10 μL)per day,tuina intervention was performed 30 minutes after the last intrathecal injection,and the specific operation of tuina was the same as that of the tuina group.Before modeling,after modeling,and after intervention,each group of rats was subjected to cold sensitivity threshold(CST)and mechanical withdrawal threshold(MWT)testing.After intervention,immunohistochemistry was used to detect the positive expression of cyclic guanosine monophosphate(cGMP)in the spinal dorsal horn(SDH)at L4-6 segments;protein expressions of N-methyl-D-aspartate receptor 1(NMDAR1),neurogenic nitric oxide synthase(nNOS),soluble guanylyl cyclase β(sGCβ),and protein kinase G1(PKG1)in SDH at L4-6 segments were detected by Western blotting;mRNA expressions of NMDAR1,nNOS,sGCβ,cGMP,and PKG1 in SDH at L4-6 segments were detected by real-time PCR.Results Compared with the normal and sham groups,after modeling,CST increased and MWT decreased in the model group,tuina group and tuina+MK-801 group(P＜0.05);after intervention,the positive protein expression of cGMP was increased,the protein expressions of NMDAR1,nNOS,sGCβ,and PKG1 were increased,and mRNA expressions of NMDAR1,nNOS,sGCβ,cGMP,and PKG1 were increased in SDH at L4-6 segments in the model group(P＜0.05).Compared with the model group,after intervention,CST decreased and MWT increased in the tuina group and tuina+MK-801 group(P＜0.05);the positive protein expression of cGMP was decreased,the protein expressions of NMDAR1,nNOS,sGCβ,and PKG1 were decreased,and mRNA expressions of NMDAR1,nNOS,sGCβ,cGMP,and PKG1 were decreased in SDH at L4-6 segments in the tuina group and tuina+MK-801 group(P＜0.05).Conclusion One-time tuina intervention can effectively improve the symptoms of thermal and mechanical hyperalgesia induced by peripheral nerve injury,which may initiate analgesia through the NMDAR1/cGMP/protein kinase G signaling pathway,thereby exerting immediate analgesic effect.

BACKGROUND:Osteoporotic vertebral compression fracture is a common fracture secondary to osteoporosis.At present,there is no effective prediction index and method for osteoporotic vertebral compression fracture. OBJECTIVE:To investigate the predictive effect of the comprehensive index of lumbar vertebral body bone strength on osteoporotic vertebral compression fracture. METHODS:233 patients with osteoporosis were divided into a fracture group and a non-fracture group according to whether a vertebral fracture occurred.The demography,body mass index,vertebral bone mineral density and other details were collected.Lateral X-ray films of the lumbar spine were photographed.The vertebral body width,vertebral body length,sacral slope,pelvic tilt,pelvic incidence,lumbar compressive strength index and the lumbar impact strength index were measured,calculated,and analyzed by univariate and multivariate,and the receiver operating characteristic curve was analyzed.The survival analysis was conducted according to the cut-off value. RESULTS AND CONCLUSION:(1)All patients were followed up for 2-4 years,with an average of 3.1 years.During the follow-up period,99 cases(38 cases of L1 vertebral body,61 cases of L2 vertebral body)had fractures(fracture group),and 134 cases(52 cases of L1 vertebral body,82 cases of L2 vertebral body)had no fractures(non-fracture group).Univariate analysis showed that there was no significant difference in age,sex,height,body mass,body mass index and fracture segment between the two groups(P>0.05).(2)Lumbar compressive strength index and lumbar impact strength index in the fracture group were lower than those in the non-fracture group(P<0.05).Pelvic incidence and pelvic tilt in the fracture group were higher than those in the non-fracture group(P<0.05).(3)Multivariate analysis showed that lumbar compressive strength index,lumbar impact strength index and pelvic tilt were risk factors for osteoporotic vertebral compression fractures(P<0.05).(4)Receiver operating characteristic curve analysis showed that the cutoff values of vertebral bone mineral density,lumbar compressive strength index,lumbar impact strength index,pelvic tilt and pelvic incidence were 0.913 5 g/cm2,1.932,0.903,21.5° and 55°,respectively;areas under the curve were 0.630,0.800,0.911,0.633 and 0.568,respectively.(5)According to the survival analysis(with osteoporotic vertebral compression fracture as the end point),the average survival time of the patients with lumbar impact strength index≥0.903 was significantly longer than that of the patients with lumbar impact strength index<0.903(P<0.05).(6)These findings conclude that the comprehensive index of lumbar vertebral body bone strength is more accurate than the bone mineral density of the vertebral body and spine-pelvis sagittal parameters in predicting osteoporotic vertebral compression fractures,which is helpful for early prevention and treatment of osteoporotic vertebral compression fractures.

BACKGROUND:Osteoporosis vertebral compression fracture is a common fracture secondary to osteoporosis,and there is currently a lack of effective predictive indicators and methods for osteoporosis vertebral compression fracture. OBJECTIVE:To investigate the predictive effects of paravertebral muscle degeneration,functional cross-sectional area,and percentage of fat infiltration on osteoporotic vertebral compression fractures. METHODS:The 224 patients with osteoporosis diagnosed from January 2018 to June 2022 were included.They were followed up for more than 2 years.They were divided into fracture group and non-fracture group according to the presence and absence of vertebral fracture.The detailed information of demographics,body mass index,bone mineral density and so on were collected.The functional cross-sectional area and percentage of fat infiltration of bilateral Psoas major muscle and extensor dorsi(Erector spinae muscles muscle and multifidus muscle)at the level of lower endplate of L2 vertebral body were measured and calculated. RESULTS AND CONCLUSION:(1)224 patients were ultimately included,of which 126 had fractures as the fracture group and 98 had no fractures as the non-fracture group.There was no statistically significant difference in age,gender,height,body mass,body mass index,and fracture segment between the two groups(P>0.05).(2)The bone mineral density of the fracture group was significantly lower than that of the non-fracture group(P<0.05).Functional cross-sectional areas of Psoas major muscle and extensor dorsi in the fracture group were significantly lower than those in the non-fracture group(P<0.05).The percentage of fat infiltration of the extensor dorsi in the fracture group was significantly higher than that in the non-fracture group(P<0.05).There was no significant difference in percentage of fat infiltration of Psoas major muscle between the two groups(P>0.05).(3)Receiver operating characteristic analysis showed that the vertebral bone mineral density,percentage of fat infiltration of extensor dorsi,functional cross-sectional area of extensor dorsi and percentage of fat infiltration of Psoas major muscle were 0.903 g/cm2,35.426%,418.875 mm2,and 6.375%,respectively.The areas under curve were 0.634,0.755,0.876,and 0.585,respectively.(4)These findings indicate that paravertebral muscle degeneration is strongly associated with the occurrence of osteoporotic vertebral compression fractures.The functional cross-sectional area of extensor dorsi muscle can effectively predict the occurrence of osteoporotic vertebral compression fractures,which is helpful for early prevention and treatment of osteoporotic vertebral compression fractures.

Objective To establish the UPLC fingerprint chromatogram combined with chemometric analysis for the quality evaluation of classical formula Linggui Zhugan Decoction.Methods SHIMADZU Shim-Pack GIST C18 column(100 mm×2.1 mm,2.0 μm)was used with acetonitrile-0.1%phosphoric acid aqueous solution as mobile phase,gradient elution;flow rate was 0.2 mL/min;the detection wavelength was 266 nm for the first 30 minutes and 235 nm for the last 36 minutes;the column temperature was 30℃.The UPLC fingerprint of Linggui Zhugan Decoction was established by Similarity Evaluation System for Chromatographic Fingerprint of TCM(2012.130723 version),and the common peak was determined and the similarity evaluation was carried out.Based on the peak area determination results of the common peak of the fingerprint,the quality of different batches of Linggui Zhugan Decoction was evaluated by chemometrics such as clustering analysis and principal component analysis.Results A total of 24 common peaks were confirmed and 14 components were identified by using reference substances.The similarity of 10 batches of Linggui Zhugan Decoction samples was greater than 0.950,which could be divided into two categories by chemometrics,and the principal component 1-4 were the main factors affecting its quality evaluation.OPLS-DA identified 6 differential markers.Conclusion The fingerprint research method established in the study is simple,reliable and reproducible.Through the method of fingerprint combined with chemometrics analysis,the differences between Linggui Zhugan Decoction from different origins of medicinal materials are identified,which provides a reference for the internal quality evaluation of Linggui Zhugan Decoction.

Objective By observing the effects of"three methods and three points"tuina technique on the expression of interleukin-17F(IL-17F),interleukin-17 receptor C(IL-17RC),activator 1 of nuclear transcription factor-κB(Act1),tumour necrosis factor receptor-associated factor 6(TRAF6)and M1 microglial cell expression in the spinal dorsal horn of rats with mild chronic compressive injury(minor CCI)model,we explored the immediate analgesic mechanism of tuina on peripheral neuropathic pain(pNP).Methods Thirty-six SD rats were divided into the sham group,the model group and the tuina group according to the random number method,twelve rats in each group,and the minor CCI model was replicated by ligating the right sciatic nerve.The rats in the tuina group were subjected to pointing,plucking and kneading at the BL37,BL57 and GB34 points on the affected side using a tuina simulator,while the sham group and the model group were only grasped and restrained,and were intervened for one time.The mechanical pain test and cold plate test were used to evaluate the response of rats to mechanical stimulation and cold stimulation after immediate intervention.The protein expression of IL-17F and TRAF6 in the spinal dorsal horn of rats in each group was detected by Western blotting.The mRNA expression of IL-17F,IL-17RC,Act1 and TRAF6 in the spinal dorsal horn of rats in each group was detected by real-time PCR.The average fluorescence intensity of M1 microglia in the spinal dorsal horn of rats in each group was detected by immunofluorescence.Results Behavioral results showed that before intervention,compared with the sham group,paw mechanical withdraw threshold(PMWT)decreased and cold sensitivity threshold(CST)increased in the model group and the tuina group;after tuina intervention,PMWT in the tuina group was increased,and CST was decreased compared with the model group;after intervention,PMWT in the tuina group was increased,while CST was decreased(P＜0.05).RT-PCR results showed that compared with the sham group,mRNA expression levels of IL-17F,IL-17RC,TRAF6 and Act1 in the spinal dorsal horn of the model group were increased;compared with model group,the mRNA expression levels of above indexes in the tuina group were decreased(P＜0.05).Western boltting results showed that compared with the sham group,the expression levels of IL-17F and TRAF6 protein in the spinal dorsal horn of the model group were increased;compared with the model group,the expression levels of IL-17F and TRAF6 protein in the tuina group decreased(P＜O.05).Immunofluorescence results showed that the mean fluorescence intensity of CD40 in the spinal dorsal horn of model group was enhanced compared with the sham group;compared with the model group,the mean fluorescence intensity of CD40 in the tuina group was decreased(P＜0.05).Conclusion The"three methods and three points"tuina technique can produce immediate analgesia by inhibiting the expression of IL-17F,IL-17RC,Act1,TRAF6 and the activation of M1 microglia in the dorsal horn of the spinal cord after one intervention.

Objective:To explore the potential of integrating virtual surgery with three-dimensional (3D) printed guides in the surgical management of mandibular benign tumors and subsequent reconstruction of bone defects.Methods:A retrospective analysis was conducted on the clinical data of patients who underwent computer-assisted resection and vascularized fibular flap reconstruction for benign mandibular tumors at the Department of Oral and Maxillofacial Surgery, First Affiliated Hospital of Zhengzhou University, from June 2013 to December 2020. According to the utilization of guide plates for mandibular and fibular osteotomy during surgical procedures or not, the patients were categorized into two cohorts: a guide plate cohort and a non-guide plate cohort. In the guide plate group, custom-designed gudie plates based on virtual surgical plans were fabricated using 3D printing technology and employed intraoperatively; In the non-guide plate group, surgery was exclusively performed based on virtual surgical plan and prebent titanium plate without any supplementary plating. The measured outcomes included fibular flap osteotomy, operation duration, and clinical flap survival. Computed tomography images obtained one week post-surgery were utilized to assess the intersegmental commissure degree between fibular segments as well as between fibular segments and mandible, commissure degree between fibular segments and prebent titanium plate, and condyle position. The satisfaction of patients with their facial appearance was evaluated 6 months after the surgery using a visual analogue scale. Statistical analysis was conducted using SPSS 21.0 software. Independent sample t-tests was utilized to compare the duration of operation and and postoperative evaluation of facial appearance, the Chi-square tests was utilized for condyle position, commissure degrees among interactions involving fibular segments, prebent titanium plates, bone segments( P<0.05 denoted statistical significance). Results:A total of 30 patients were enrolled, comprising 17 males and 13 females, with a median age of 24 years (16-64 years). The preparation process of fibular flaps proceeded smoothly. The required length of fibula was measured as (14.1 ± 1.9) cm (5.7-18.1 cm), while the number of fibular segments ranged from 2 to 4, averaging at approximately 2.9 ± 0.6. The mandibular defects were repaired using a single-layer fibula in 12 cases, a vascularized folded fibula in 7 cases and a combination of vascularized and non-vascularized fibula in 11 cases. The operation time for the guide plate group was recorded as ( 335.9 ± 64.0) min (240-433 min), while it was observed to be (470.7 ± 140.5 ) min (280-680 min) for the non-guide plate group.The postoperative follow-up duration ranged from 9 to 23 months, with an average period of 11 months. All fibular flaps demonstrated clinical survival. The number of patients with good commissure degree between fibular and mandibular segments, between prebent titanium plate and fibular and mandibular segments and the position of condyle were 15, 15 and 13 cases in guide plate group, 10, 13 and 11 cases in non-guide plate group respectively. The statistical analysis revealed a significant difference ( P<0.05) in the degree of commissure between the fibular and the mandibular segments (15/15 vs. 10/15) in the two groups. Both groups exhibited high levels of satisfaction regarding their postoperative facial appearance at the 6 months follow-up, observed to be 9.6±0.5 and 9.3±0.5 respectively, and the statisticla analysis revealed non-significant difference ( P>0.05). Conclusion:The integration of virtual surgery with 3D printed guide plates can effectively reduce operative time and improve precision in the repair and reconstruction of free-fibular flaps following resection of benign tumors of the mandible.

Objective:To explore the potential of integrating virtual surgery with three-dimensional (3D) printed guides in the surgical management of mandibular benign tumors and subsequent reconstruction of bone defects.Methods:A retrospective analysis was conducted on the clinical data of patients who underwent computer-assisted resection and vascularized fibular flap reconstruction for benign mandibular tumors at the Department of Oral and Maxillofacial Surgery, First Affiliated Hospital of Zhengzhou University, from June 2013 to December 2020. According to the utilization of guide plates for mandibular and fibular osteotomy during surgical procedures or not, the patients were categorized into two cohorts: a guide plate cohort and a non-guide plate cohort. In the guide plate group, custom-designed gudie plates based on virtual surgical plans were fabricated using 3D printing technology and employed intraoperatively; In the non-guide plate group, surgery was exclusively performed based on virtual surgical plan and prebent titanium plate without any supplementary plating. The measured outcomes included fibular flap osteotomy, operation duration, and clinical flap survival. Computed tomography images obtained one week post-surgery were utilized to assess the intersegmental commissure degree between fibular segments as well as between fibular segments and mandible, commissure degree between fibular segments and prebent titanium plate, and condyle position. The satisfaction of patients with their facial appearance was evaluated 6 months after the surgery using a visual analogue scale. Statistical analysis was conducted using SPSS 21.0 software. Independent sample t-tests was utilized to compare the duration of operation and and postoperative evaluation of facial appearance, the Chi-square tests was utilized for condyle position, commissure degrees among interactions involving fibular segments, prebent titanium plates, bone segments( P<0.05 denoted statistical significance). Results:A total of 30 patients were enrolled, comprising 17 males and 13 females, with a median age of 24 years (16-64 years). The preparation process of fibular flaps proceeded smoothly. The required length of fibula was measured as (14.1 ± 1.9) cm (5.7-18.1 cm), while the number of fibular segments ranged from 2 to 4, averaging at approximately 2.9 ± 0.6. The mandibular defects were repaired using a single-layer fibula in 12 cases, a vascularized folded fibula in 7 cases and a combination of vascularized and non-vascularized fibula in 11 cases. The operation time for the guide plate group was recorded as ( 335.9 ± 64.0) min (240-433 min), while it was observed to be (470.7 ± 140.5 ) min (280-680 min) for the non-guide plate group.The postoperative follow-up duration ranged from 9 to 23 months, with an average period of 11 months. All fibular flaps demonstrated clinical survival. The number of patients with good commissure degree between fibular and mandibular segments, between prebent titanium plate and fibular and mandibular segments and the position of condyle were 15, 15 and 13 cases in guide plate group, 10, 13 and 11 cases in non-guide plate group respectively. The statistical analysis revealed a significant difference ( P<0.05) in the degree of commissure between the fibular and the mandibular segments (15/15 vs. 10/15) in the two groups. Both groups exhibited high levels of satisfaction regarding their postoperative facial appearance at the 6 months follow-up, observed to be 9.6±0.5 and 9.3±0.5 respectively, and the statisticla analysis revealed non-significant difference ( P>0.05). Conclusion:The integration of virtual surgery with 3D printed guide plates can effectively reduce operative time and improve precision in the repair and reconstruction of free-fibular flaps following resection of benign tumors of the mandible.

Over the past decade, mitochondrial dysfunction has been investigated as a key contributor to acute and chronic kidney disease. However, the precise molecular mechanisms linking mitochondrial damage to kidney disease remain elusive. The recent insights into the cyclic guanosine monophosphate-adenosine monophosphate (GMP-AMP) synthetase (cGAS)-stimulator of interferon gene (STING) signaling pathway have revealed its involvement in many renal diseases. One of these findings is that mitochondrial DNA (mtDNA) induces inflammatory responses via the cGAS-STING pathway. Herein, we provide an overview of the mechanisms underlying mtDNA release following mitochondrial damage, focusing specifically on the association between mtDNA release-activated cGAS-STING signaling and the development of kidney diseases. Furthermore, we summarize the latest findings of cGAS-STING signaling pathway in cell, with a particular emphasis on its downstream signaling related to kidney diseases. This review intends to enhance our understanding of the intricate relationship among the cGAS-STING pathway, kidney diseases, and mitochondrial dysfunction.