AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

The innate immune system can be boosted in response to subsequent triggers by pre-exposure to microbes or microbial products, known as “trained immunity”. Compared to classical immune memory, innate trained immunity has several different features. Firstly, the molecules involved in trained immunity differ from those involved in classical immune memory. Innate trained immunity mainly involves innate immune cells (e.g., myeloid immune cells, natural killer cells, innate lymphoid cells) and their effector molecules (e.g., pattern recognition receptor (PRR), various cytokines), as well as some kinds of non-immune cells (e.g., microglial cells). Secondly, the increased responsiveness to secondary stimuli during innate trained immunity is not specific to a particular pathogen, but influences epigenetic reprogramming in the cell through signaling pathways, leading to the sustained changes in genes transcriptional process, which ultimately affects cellular physiology without permanent genetic changes (e.g., mutations or recombination). Finally, innate trained immunity relies on an altered functional state of innate immune cells that could persist for weeks to months after initial stimulus removal. An appropriate inducer could induce trained immunity in innate lymphocytes, such as exogenous stimulants (including vaccines) and endogenous stimulants, which was firstly discovered in bone marrow derived immune cells. However, mature bone marrow derived immune cells are short-lived cells, that may not be able to transmit memory phenotypes to their offspring and provide long-term protection. Therefore, trained immunity is more likely to be relied on long-lived cells, such as epithelial stem cells, mesenchymal stromal cells and non-immune cells such as fibroblasts. Epigenetic reprogramming is one of the key molecular mechanisms that induces trained immunity, including DNA modifications, non-coding RNAs, histone modifications and chromatin remodeling. In addition to epigenetic reprogramming, different cellular metabolic pathways are involved in the regulation of innate trained immunity, including aerobic glycolysis, glutamine catabolism, cholesterol metabolism and fatty acid synthesis, through a series of intracellular cascade responses triggered by the recognition of PRR specific ligands. In the view of evolutionary, trained immunity is beneficial in enhancing protection against secondary infections with an induction in the evolutionary protective process against infections. Therefore, innate trained immunity plays an important role in therapy against diseases such as tumors and infections, which has signature therapeutic effects in these diseases. In organ transplantation, trained immunity has been associated with acute rejection, which prolongs the survival of allografts. However, trained immunity is not always protective but pathological in some cases, and dysregulated trained immunity contributes to the development of inflammatory and autoimmune diseases. Trained immunity provides a novel form of immune memory, but when inappropriately activated, may lead to an attack on tissues, causing autoinflammation. In autoimmune diseases such as rheumatoid arthritis and atherosclerosis, trained immunity may lead to enhance inflammation and tissue lesion in diseased regions. In Alzheimer’s disease and Parkinson’s disease, trained immunity may lead to over-activation of microglial cells, triggering neuroinflammation even nerve injury. This paper summarizes the basis and mechanisms of innate trained immunity, including the different cell types involved, the impacts on diseases and the effects as a therapeutic strategy to provide novel ideas for different diseases.

ObjectiveTo investigate the processing technology of calcined Haematitum based on the concept of quality by design（QbD） and to assess its health risk. MethodsTaking whole iron content， Fe²⁺ dissolution content and looseness as critical quality attributes（CQAs）， and calcination temperature， calcination time， spreading thickness and particle size as critical process parameters（CPPs） determined by the failure mode and effect analysis（FMEA）， the processing technology of calcined Haematitum was optimized by orthogonal test combined with analytic hierarchy process-criteria importance through intercriteria correlation（AHP-CRITIC） hybrid weighting method. The contents of heavy metals and harmful elements were determined by inductively coupled plasma mass spectrometry， and the health risk assessment was carried out by daily exposure（EXP）， target hazard quotient（THQ） and lifetime cancer risk（LCR）， and the theoretical value of the maximum limit was deduced. ResultsThe optimal processing technology for calcined Haematitum was calcination at 650 ℃， calcination time of 1 h， particle size of 0.2-0.5 cm， spreading thickness of 1 cm， and vinegar quenching for 1 time［Haematitum-vinegar（10：3）］. The contents of 5 heavy metals and harmful elements in 13 batches of calcined Haematitum were all decreased with reductions of up to 5-fold. The cumulative THQ of 2 batches of samples was>1， while the cumulative THQ of all batches of Haematitum was>1. The LCR of As in 1 batches of Haematitum was 1×10^-6-1×10^-4， and the LCR of the rest was<1×10^-6， and the LCRs of calcined Haematitum were all<1×10^-6， indicating that the carcinogenic risk of calcined Haematitum was low， but special attention should still be paid to Haematitum medicinal materials. Preliminary theoretical values of the maximum limits of Cu， As， Cd， Pb and Hg were formulated as 1 014， 25， 17， 27， 7 mg·kg^-1. ConclusionThe optimized processing technology of calcined Haematitum is stable and feasible， and the contents of heavy metals and harmful elements are reduced after processing. Preliminary theoretical values of the maximum limits of Cu， As， Cd， Pb and Hg are formulated to provide a scientific basis for the formulation of standards for the limits of harmful elements in Haematitum.

ObjectiveBased on the concept of quality by design（QbD）， the processing process of calcined Pyritum was optimized， and its X-ray diffraction（XRD） fingerprint was established. MethodsThe safety， effectiveness and quality controllability of calcined Pyritum were taken as the quality profile（QTPP）， the color， hardness， metallic luster， phase composition， the contents of heavy metals and hazardous elements were taken as the critical quality attributes（CQAs）， and the calcination temperature， calcination time， paving thickness and particle size were determined as the critical process parameters（CPPs）. Differential thermal analysis， X-ray diffraction（XRD） and inductively coupled plasma mass spectrometry（ICP-MS） were used to analyze the correlation between the calcination temperature and CQAs of calcined Pyritum. Then， based on the criteria importance through intercriteria correlation（CRITIC）-entropy weight method， the optimal processing process of calcined Pyritum was optimized by orthogonal test. Powder XRD was used to analyze the phase of calcined Pyritum samples processed according to the best process， and the mean and median maps of calcined Pyritum were established by the superposition of geometric topological figures， and similarity evaluation and cluster analysis were carried out. ResultsThe results of single factor experiments showed that the physical phase of Pyritum changed from FeS₂ to Fe₇S₈ during the process of temperature increase， the color gradually deepened from dark yellow， and the contents of heavy metals and harmful elements decreased. The optimized processing process of calcined Pyritum was as follows：calcination temperature at 750 ℃， calcination time of 2.5 h， paving thickness of 3 cm， particle size of 0.8-1.2 cm， vinegar quenching 1 time［Pyritum-vinegar（10∶3）］. After calcination， the internal structure of Pyritum was honeycomb-shaped， which was conducive to the dissolution of active ingredients. XRD fingerprints of 13 batches of calcined Pyritum characterized by 10 common peaks were established. The similarities of the relative peak intensities of the XRD fingerprints of the analyzed samples were>0.96， and it could effectively distinguish the raw products and unqualified products. ConclusionTemperature is the main factor affecting the quality of calcined Pyritum. After processing， the dissolution of the effective components in Pyritum increases， and the contents of heavy metals and harmful substances decrease， reflecting the function of processing to increase efficiency and reduce toxicity. The optimized processing process is stable and feasible， and the established XRD fingerprint can be used as one of the quality control standards of calcined Pyritum.

ObjectiveTo investigate the processing technology of calcined Haematitum based on the concept of quality by design（QbD） and to assess its health risk. MethodsTaking whole iron content， Fe²⁺ dissolution content and looseness as critical quality attributes（CQAs）， and calcination temperature， calcination time， spreading thickness and particle size as critical process parameters（CPPs） determined by the failure mode and effect analysis（FMEA）， the processing technology of calcined Haematitum was optimized by orthogonal test combined with analytic hierarchy process-criteria importance through intercriteria correlation（AHP-CRITIC） hybrid weighting method. The contents of heavy metals and harmful elements were determined by inductively coupled plasma mass spectrometry， and the health risk assessment was carried out by daily exposure（EXP）， target hazard quotient（THQ） and lifetime cancer risk（LCR）， and the theoretical value of the maximum limit was deduced. ResultsThe optimal processing technology for calcined Haematitum was calcination at 650 ℃， calcination time of 1 h， particle size of 0.2-0.5 cm， spreading thickness of 1 cm， and vinegar quenching for 1 time［Haematitum-vinegar（10：3）］. The contents of 5 heavy metals and harmful elements in 13 batches of calcined Haematitum were all decreased with reductions of up to 5-fold. The cumulative THQ of 2 batches of samples was>1， while the cumulative THQ of all batches of Haematitum was>1. The LCR of As in 1 batches of Haematitum was 1×10^-6-1×10^-4， and the LCR of the rest was<1×10^-6， and the LCRs of calcined Haematitum were all<1×10^-6， indicating that the carcinogenic risk of calcined Haematitum was low， but special attention should still be paid to Haematitum medicinal materials. Preliminary theoretical values of the maximum limits of Cu， As， Cd， Pb and Hg were formulated as 1 014， 25， 17， 27， 7 mg·kg^-1. ConclusionThe optimized processing technology of calcined Haematitum is stable and feasible， and the contents of heavy metals and harmful elements are reduced after processing. Preliminary theoretical values of the maximum limits of Cu， As， Cd， Pb and Hg are formulated to provide a scientific basis for the formulation of standards for the limits of harmful elements in Haematitum.

ObjectiveBased on the concept of quality by design（QbD）， the processing process of calcined Pyritum was optimized， and its X-ray diffraction（XRD） fingerprint was established. MethodsThe safety， effectiveness and quality controllability of calcined Pyritum were taken as the quality profile（QTPP）， the color， hardness， metallic luster， phase composition， the contents of heavy metals and hazardous elements were taken as the critical quality attributes（CQAs）， and the calcination temperature， calcination time， paving thickness and particle size were determined as the critical process parameters（CPPs）. Differential thermal analysis， X-ray diffraction（XRD） and inductively coupled plasma mass spectrometry（ICP-MS） were used to analyze the correlation between the calcination temperature and CQAs of calcined Pyritum. Then， based on the criteria importance through intercriteria correlation（CRITIC）-entropy weight method， the optimal processing process of calcined Pyritum was optimized by orthogonal test. Powder XRD was used to analyze the phase of calcined Pyritum samples processed according to the best process， and the mean and median maps of calcined Pyritum were established by the superposition of geometric topological figures， and similarity evaluation and cluster analysis were carried out. ResultsThe results of single factor experiments showed that the physical phase of Pyritum changed from FeS₂ to Fe₇S₈ during the process of temperature increase， the color gradually deepened from dark yellow， and the contents of heavy metals and harmful elements decreased. The optimized processing process of calcined Pyritum was as follows：calcination temperature at 750 ℃， calcination time of 2.5 h， paving thickness of 3 cm， particle size of 0.8-1.2 cm， vinegar quenching 1 time［Pyritum-vinegar（10∶3）］. After calcination， the internal structure of Pyritum was honeycomb-shaped， which was conducive to the dissolution of active ingredients. XRD fingerprints of 13 batches of calcined Pyritum characterized by 10 common peaks were established. The similarities of the relative peak intensities of the XRD fingerprints of the analyzed samples were>0.96， and it could effectively distinguish the raw products and unqualified products. ConclusionTemperature is the main factor affecting the quality of calcined Pyritum. After processing， the dissolution of the effective components in Pyritum increases， and the contents of heavy metals and harmful substances decrease， reflecting the function of processing to increase efficiency and reduce toxicity. The optimized processing process is stable and feasible， and the established XRD fingerprint can be used as one of the quality control standards of calcined Pyritum.

Based on copper death, this study investigates the effect and mechanism of Shenmai Injection on isoproterenol(ISO)-induced myocardial fibrosis(MF) in rats. SPF-grade male SD rats were randomly divided into a normal group, model group, captopril(5 mg·kg~(-1)) positive control group, and Shenmai Injection low(6 mL·kg~(-1)), medium(9 mL·kg~(-1)), and high(12 mL·kg~(-1)) dose groups. Except for the normal group, the rats in the other groups were subcutaneously injected with ISO(5 mg·kg~(-1)) once a day for 10 consecutive days to establish an MF model. Starting from the second day after successful modeling, intraperitoneal injections of the respective treatments were administered for 28 consecutive days. Hematoxylin-eosin(HE) and Masson staining were used to observe pathological changes and fibrosis levels in the myocardial tissue. Colorimetry was employed to detect serum Cu~(2+) concentration in rats. The levels of inflammatory cytokines interleukin-6(IL-6), interleukin-1β(IL-1β), interleukin-18(IL-18), tumor necrosis factor-α(TNF-α), as well as mitochondrial energy metabolites adenosine triphosphate(ATP), adenosine diphosphate(ADP), and adenosine monophosphate(AMP) in serum were measured using enzyme-linked immunosorbent assay(ELISA). Western blot was performed to detect the expression of collagen Ⅰ(Col-Ⅰ), collagen Ⅲ(Col-Ⅲ), and copper death-related proteins dihydrolipoamide acetyltransferase(DLAT), ferredoxin 1(FDX1), lipoic acid synthetase(LIAS), and heat shock protein 70(HSP70) in myocardial tissue. Immunofluorescence was used to detect the expression of DLAT, FDX1, and HSP70, while immunohistochemistry was conducted to examine the expressions of DLAT, FDX1, LIAS, and HSP70. The results showed that, compared to the model group, the myocardial structure disorder and collagen fiber deposition in the drug treatment groups were significantly improved, the cardiac index level was reduced, serum Cu~(2+), IL-6, IL-1β, IL-18, TNF-α, ADP, and AMP levels were significantly decreased, ATP levels were significantly increased, and the expressions of Col-Ⅰ, Col-Ⅲ, and HSP70 proteins in myocardial tissue were significantly reduced, while the expressions of DLAT, FDX1, and LIAS proteins were significantly elevated. In conclusion, Shenmai Injection effectively alleviates myocardial structure disorder and interstitial collagen fiber deposition in ISO-induced MF rats, promotes copper excretion, and reduces copper death in the ISO-induced rat MF model.
Animals ; Male ; Drugs, Chinese Herbal/administration & dosage* ; Rats, Sprague-Dawley ; Rats ; Myocardium/metabolism* ; Drug Combinations ; Fibrosis/metabolism* ; Copper/blood* ; Cardiomyopathies/genetics* ; Humans

Guided by the concept of quality by design(QbD), this study optimizes the calcination and quenching process of calcined Magnetitum and establishes the XRD characteristic spectra of calcined Magnetitum, providing a scientific basis for the formulation of quality standards. Based on the processing methods and quality requirements of Magnetitum in the Chinese Pharmacopoeia, the critical process parameters(CPPs) identified were calcination temperature, calcination time, particle size, laying thickness, and the number of vinegar quenching cycles. The critical quality attributes(CQAs) included Fe mass fraction, Fe~(2+) dissolution, and surface color. The weight coefficients were determined by combining Analytic Hierarchy Process(AHP) and the criteria importance though intercrieria correlation(CRITIC) method, and the calcination process was optimized using orthogonal experimentation. Surface color was selected as a CQA, and based on the principle of color value, the surface color of calcined Magnetitum was objectively quantified. The vinegar quenching process was then optimized to determine the best processing conditions. X-ray diffraction(XRD) was used to establish the characteristic spectra of calcined Magnetitum, and methods such as similarity evaluation, cluster analysis, and orthogonal partial least squares-discriminant analysis(OPLS-DA) were used to evaluate the quality of the spectra. The optimized calcined Magnetitum preparation process was found to be calcination at 750 ℃ for 1 h, with a laying thickness of 4 cm, a particle size of 0.4-0.8 cm, and one vinegar quenching cycle(Magnetitum-vinegar ratio 10∶3), which was stable and feasible. The XRD characteristic spectra analysis method, featuring 9 common peaks as fingerprint information, was established. The average correlation coefficient ranged from 0.839 5-0.988 1, and the average angle cosine ranged from 0.914 4 to 0.995 6, indicating good similarity. Cluster analysis results showed that Magnetitum and calcined Magnetitum could be grouped together, with similar compositions. OPLS-DA discriminant analysis identified three key characteristic peaks, with Fe_2O_3 being the distinguishing component between the two. The final optimized processing method is stable and feasible, and the XRD characteristic spectra of calcined Magnetitum was initially established, providing a reference for subsequent quality control and the formulation of quality standards for calcined Magnetitum.
X-Ray Diffraction/methods* ; Drugs, Chinese Herbal/chemistry* ; Quality Control ; Particle Size

In most types of erectile dysfunction, particularly in advanced stages, typical pathological features observed are reduced parenchymal cells coupled with increased tissue fibrosis. However, the current treatment methods have shown limited success in reversing these pathologic changes. Recent research has revealed that changes in autophagy levels, along with alterations in apoptosis and fibrosis-related proteins, are linked to the progression of erectile dysfunction, suggesting a significant association. Autophagy, known to significantly affect cell fate and tissue fibrosis, is currently being explored as a potential treatment modality for erectile dysfunction. However, these present studies are still in their nascent stage, and there are limited experimental data available. This review analyzes erectile dysfunction from a pathological perspective. It provides an in-depth overview of how autophagy is involved in the apoptotic processes of smooth muscle and endothelial cells and its role in the fibrotic processes occurring in the cavernosum. This study aimed to develop a theoretical framework for the potential effectiveness of autophagy in preventing and treating erectile dysfunction, thus encouraging further investigation among researchers in this area.
Male ; Humans ; Autophagy/physiology* ; Apoptosis/physiology* ; Erectile Dysfunction/physiopathology* ; Fibrosis ; Penis/pathology* ; Animals ; Endothelial Cells/pathology* ; Myocytes, Smooth Muscle/pathology*

OBJECTIVE: To evaluate the efficacy and safety of Shexiang Tongxin Dropping Pill (STDP) in treating stable angina patients with phlegm-heat and blood-stasis syndrome by exercise duration and metabolic equivalents. METHODS: This multicenter, randomized, double-blind, placebo-controlled clinical trial enrolled stable angina patients with phlegm-heat and blood-stasis syndrome from 22 hospitals. They were randomized 1:1 to STDP (35 mg/pill, 6 pills per day) or placebo for 56 days. The primary outcome was the exercise duration and metabolic equivalents (METs) assessed by the standard Bruce exercise treadmill test after 56 days of treatment. The secondary outcomes included the total angina symptom score, Chinese medicine (CM) symptom scores, Seattle Angina Questionnaire (SAQ) scores, changes in ST-T on electrocardiogram and adverse events (AEs). RESULTS: This trial enrolled 309 patients, including 155 and 154 in the STDP and placebo groups, respectively. STDP significantly prolonged exercise duration with an increase of 51.0 s, compared to a decrease of 12.0 s with placebo (change rate: -11.1% vs. 3.2%, P<0.01). The increase in METs was significantly greater in the STDP group than in the placebo group (change: -0.4 vs. 0.0, change rate: -5.0% vs. 0.0%, P<0.01). The improvement of total angina symptom scores (25.0% vs. 0.0%), CM symptom scores (38.7% vs. 11.8%), reduction of nitroglycerin consumption (100.0% vs. 11.3%), and all domains of SAQ, were significantly greater with STDP than placebo (all P<0.01). The changes in Q-T intervals at 28 and 56 days from baseline were similar between the two groups (both P>0.05). Twenty-five participants (16.3%) with STDP and 16 (10.5%) with placebo experienced AEs (P=0.131), with no serious AEs observed. CONCLUSION STDP could improve exercise tolerance in patients with stable angina and phlegm-heat and blood stasis syndrome, with a favorable safety profile. (Registration No. ChiCTR-IPR-15006020).
Humans ; Double-Blind Method ; Drugs, Chinese Herbal/adverse effects* ; Male ; Female ; Middle Aged ; Angina, Stable/physiopathology* ; Aged ; Syndrome ; Treatment Outcome ; Placebos ; Tablets