1.Effect and Mechanism of Icariin on Improving Spermatogenesis in Exercise-induced Fatigue Model Mice Through Regucalcin
Kunyang TANG ; Min XIAO ; Xiaocui JIANG ; Xiaoxue TAO ; Yue ZOU ; Chunchun ZHAO ; Zhipeng FANG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(8):117-127
ObjectiveThis paper aims to investigate the effects of icariin on spermatogenesis in mice with exercise-induced fatigue and explore the underlying mechanisms. MethodsICR male mice were screened by swimming and randomly divided into normal group, model group, vitamin C group, icariin groups with low, medium, and high doses, and medium-dose icariin+N-nitro-L-arginine methyl ester (L-NAME) group, with 10 mice per group. Except for the normal group, all the other groups underwent weighted swimming training to establish an exercise-induced fatigue model. No gavage was administered during the first two weeks of the weighted training. From week three to four, the icariin groups with low, medium, and high doses received 0.03, 0.06, and 0.12 g·kg-1 icariin via gavage, respectively. The vitamin C group received 0.2 g·kg-1 vitamin C. The L-NAME group received 0.06 g·kg-1 icariin and 0.01 g·kg-1 L-NAME via intraperitoneal injection. The normal and model groups received equivalent physiological saline. After the experiment, body weight and the last exhaustive swimming time were recorded. Blood urea nitrogen (BUN), lactate (LA), lactate dehydrogenase (LDH), malondialdehyde (MDA), testicular testosterone (T), testicular Ca2+/Mg2+-adenosine triphosphatase (ATPase) (micro-assay), and the levels of testicular cyclic guanosine monophosphate (cGMP) were measured by using kits. Sperm CD46 levels were detected by flow cytometry. Testicular seminiferous tubules were observed via hematoxylin-eosin (HE) staining, and the testicular morphometric score (TMS) was used to evaluate the spermatogenic function. Protein expression of regucalcin (RGN, SMP30), cGMP-dependent protein kinase 1 (PKG), and cGMP-dependent protein kinase anchoring protein (GKAP1) was detected by Western blot. Testicular regucalcin expression was examined by immunofluorescence (IF). The epididymal sperm quality of mice was observed under a microscope. Fluorescence-stained sections of stimulated by retinoic acid gene 8 (STRA8), synaptonemal complex protein 3 (SCP3), and transition protein 1(TNP1) in testicular seminiferous tubules were assessed by immunohistochemistry (IHC). ResultsCompared with the normal group, the model group showed decreased body weight and exhaustive swimming time (P<0.01), significantly increased fatigue markers (LA, LDH, and BUN) and lipid peroxidation product MDA (P<0.01), reduced testicular RGN, PKG, GKAP1, testosterone, Ca2+/Mg2+-ATPase, and cGMP levels (P<0.01), decreased sperm motility, sperm count, and TMS scores, and downregulated the expression of STRA8, SCP3, and TNP1. Compared with the model group, the icariin group with high dose exhibited increased exhaustive swimming time (P<0.01), reduced LA, LDH, BUN, and MDA levels (P<0.01), elevated superoxide dismutase (SOD) (P<0.01), upregulated testicular RGN, PKG, GKAP1, testosterone, Ca2+/Mg2+-ATPase, and cGMP levels (P<0.01), improved sperm motility, sperm count, and TMS scores, and enhanced STRA8, SCP3, and TNP1 expression. Compared with the L-NAME group, the icariin group with medium dose showed increased expression of STRA8, SCP3, and TNP1 in the testicular tissue (P<0.01) and elevated cGMP and GKAP1 levels (P<0.01). ConclusionExercise-induced fatigue reduces the expression of RGN and cGMP/PKG/GKAP1 in mice, thereby causing abnormal spermatogenesis and impairing reproductive function in mice. Icariin ameliorates spermatogenic dysfunction in exercise-induced fatigue mice by promoting the expression of RGN and cGMP/PKG/GKAP1, thereby mitigating the damage of exercise-induced fatigue to the reproductive system.
2.Effect and Mechanism of Icariin on Improving Spermatogenesis in Exercise-induced Fatigue Model Mice Through Regucalcin
Kunyang TANG ; Min XIAO ; Xiaocui JIANG ; Xiaoxue TAO ; Yue ZOU ; Chunchun ZHAO ; Zhipeng FANG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(8):117-127
ObjectiveThis paper aims to investigate the effects of icariin on spermatogenesis in mice with exercise-induced fatigue and explore the underlying mechanisms. MethodsICR male mice were screened by swimming and randomly divided into normal group, model group, vitamin C group, icariin groups with low, medium, and high doses, and medium-dose icariin+N-nitro-L-arginine methyl ester (L-NAME) group, with 10 mice per group. Except for the normal group, all the other groups underwent weighted swimming training to establish an exercise-induced fatigue model. No gavage was administered during the first two weeks of the weighted training. From week three to four, the icariin groups with low, medium, and high doses received 0.03, 0.06, and 0.12 g·kg-1 icariin via gavage, respectively. The vitamin C group received 0.2 g·kg-1 vitamin C. The L-NAME group received 0.06 g·kg-1 icariin and 0.01 g·kg-1 L-NAME via intraperitoneal injection. The normal and model groups received equivalent physiological saline. After the experiment, body weight and the last exhaustive swimming time were recorded. Blood urea nitrogen (BUN), lactate (LA), lactate dehydrogenase (LDH), malondialdehyde (MDA), testicular testosterone (T), testicular Ca2+/Mg2+-adenosine triphosphatase (ATPase) (micro-assay), and the levels of testicular cyclic guanosine monophosphate (cGMP) were measured by using kits. Sperm CD46 levels were detected by flow cytometry. Testicular seminiferous tubules were observed via hematoxylin-eosin (HE) staining, and the testicular morphometric score (TMS) was used to evaluate the spermatogenic function. Protein expression of regucalcin (RGN, SMP30), cGMP-dependent protein kinase 1 (PKG), and cGMP-dependent protein kinase anchoring protein (GKAP1) was detected by Western blot. Testicular regucalcin expression was examined by immunofluorescence (IF). The epididymal sperm quality of mice was observed under a microscope. Fluorescence-stained sections of stimulated by retinoic acid gene 8 (STRA8), synaptonemal complex protein 3 (SCP3), and transition protein 1(TNP1) in testicular seminiferous tubules were assessed by immunohistochemistry (IHC). ResultsCompared with the normal group, the model group showed decreased body weight and exhaustive swimming time (P<0.01), significantly increased fatigue markers (LA, LDH, and BUN) and lipid peroxidation product MDA (P<0.01), reduced testicular RGN, PKG, GKAP1, testosterone, Ca2+/Mg2+-ATPase, and cGMP levels (P<0.01), decreased sperm motility, sperm count, and TMS scores, and downregulated the expression of STRA8, SCP3, and TNP1. Compared with the model group, the icariin group with high dose exhibited increased exhaustive swimming time (P<0.01), reduced LA, LDH, BUN, and MDA levels (P<0.01), elevated superoxide dismutase (SOD) (P<0.01), upregulated testicular RGN, PKG, GKAP1, testosterone, Ca2+/Mg2+-ATPase, and cGMP levels (P<0.01), improved sperm motility, sperm count, and TMS scores, and enhanced STRA8, SCP3, and TNP1 expression. Compared with the L-NAME group, the icariin group with medium dose showed increased expression of STRA8, SCP3, and TNP1 in the testicular tissue (P<0.01) and elevated cGMP and GKAP1 levels (P<0.01). ConclusionExercise-induced fatigue reduces the expression of RGN and cGMP/PKG/GKAP1 in mice, thereby causing abnormal spermatogenesis and impairing reproductive function in mice. Icariin ameliorates spermatogenic dysfunction in exercise-induced fatigue mice by promoting the expression of RGN and cGMP/PKG/GKAP1, thereby mitigating the damage of exercise-induced fatigue to the reproductive system.
3.Applications of Lactoferrin and Its Nanoparticles in Cancer Therapy
Wen-Tian YUE ; Shu-Rong HE ; Qin AN ; Yun-Xia ZOU ; Wen-Wen DONG ; Qing-Yong MENG ; Ya-Li ZHANG
Progress in Biochemistry and Biophysics 2026;53(2):342-355
Cancer remains a leading cause of global mortality, necessitating the development of advanced therapeutic strategies with enhanced efficacy and reduced systemic toxicity. Among promising bioactive agents, lactoferrin (LF)—a multifunctional iron-binding glycoprotein abundantly found in mammalian milk and exocrine secretions—has garnered significant interest for its potent and multifaceted anti-cancer properties. This review provides a comprehensive analysis of the current understanding of LF’s role in oncology, encompassing its structural biology, diverse mechanisms of action, and groundbreaking advancements in its application through nano-engineering. LF exerts anti-tumor effects through multiple pathways, including extracellular action, intracellular action, and immune regulation. It demonstrates a remarkable affinity for cancer cell membranes, binding to overexpressed anionic components such as glycosaminoglycans and sialic acids, as well as to specific receptors including the low-density lipoprotein receptor-related protein-1 (LRP-1). This selective binding facilitates targeted uptake. Upon internalization, LF orchestrates a direct assault by inducing cell-cycle arrest in phases such as G0/G1 or S phase through the modulation of key regulators including cyclins, CDKs, and p53. Furthermore, it promotes programmed cell death via apoptotic pathways, involving caspase activation and downregulation of anti-apoptotic proteins such as survivin. A more recently elucidated mechanism is the induction of ferroptosis, an iron-dependent form of cell death characterized by overwhelming lipid peroxidation. Beyond direct cytotoxicity, LF acts as a potent immunomodulator. It enhances natural killer (NK) cell activity, modulates T-lymphocyte populations, and crucially reprograms tumor-associated macrophages (TAMs) from a pro-tumor M2 state to an anti-tumor M1 state, thereby reversing the immunosuppressive tumor microenvironment (TME). The translation of LF’s potential has been significantly accelerated by nanotechnology. The inherent biocompatibility and natural tumor-targeting capabilities of LF make it an ideal platform for sophisticated drug-delivery systems. This review details various fabrication strategies for LF-based nanoparticles (NPs), including self-assembly, sol-in-oil emulsion, and electrostatic nanocomplexes, among others. Research demonstrates that nano-formulations not only protect LF from degradation but also enhance its bioactivity and anti-cancer potency. More importantly, LF NPs serve as versatile carriers for a wide array of therapeutic agents, including conventional chemotherapeutics, natural compounds, and imaging agents. These engineered systems enable synergistic therapy and facilitate site-specific delivery. Notably, the ability of LF to bind to receptors on the blood-brain barrier (BBB) has been leveraged to develop nano-systems for glioblastoma treatment. Other innovative designs utilize LF to modulate the TME—for instance, by alleviating tumor hypoxia to sensitize cells to radiotherapy and chemotherapy. Despite compelling pre-clinical evidence, the clinical translation of LF and its nano-formulations remains nascent. While early-phase trials have established a favorable safety profile for recombinant human LF, larger Phase III studies have yielded mixed results, underscoring the complexity of its action in humans. Key challenges include enhancing drug targeting, optimizing loading efficiency, ensuring batch-to-batch reproducibility, and achieving deep tumor penetration. Future research must focus on the rational design of next-generation LF-NPs. This entails developing standardized manufacturing protocols, engineering “smart” stimuli-responsive systems for targeted drug release in the TME, and constructing multi-targeting platforms. A concerted interdisciplinary effort is paramount to bridge the gap between bench and bedside. In conclusion, LF, particularly in its nano-engineered forms, represents a highly promising and versatile agent in the oncological arsenal, holding immense potential for precise and effective cancer therapy.
4.Applications of Lactoferrin and Its Nanoparticles in Cancer Therapy
Wen-Tian YUE ; Shu-Rong HE ; Qin AN ; Yun-Xia ZOU ; Wen-Wen DONG ; Qing-Yong MENG ; Ya-Li ZHANG
Progress in Biochemistry and Biophysics 2026;53(2):342-355
Cancer remains a leading cause of global mortality, necessitating the development of advanced therapeutic strategies with enhanced efficacy and reduced systemic toxicity. Among promising bioactive agents, lactoferrin (LF)—a multifunctional iron-binding glycoprotein abundantly found in mammalian milk and exocrine secretions—has garnered significant interest for its potent and multifaceted anti-cancer properties. This review provides a comprehensive analysis of the current understanding of LF’s role in oncology, encompassing its structural biology, diverse mechanisms of action, and groundbreaking advancements in its application through nano-engineering. LF exerts anti-tumor effects through multiple pathways, including extracellular action, intracellular action, and immune regulation. It demonstrates a remarkable affinity for cancer cell membranes, binding to overexpressed anionic components such as glycosaminoglycans and sialic acids, as well as to specific receptors including the low-density lipoprotein receptor-related protein-1 (LRP-1). This selective binding facilitates targeted uptake. Upon internalization, LF orchestrates a direct assault by inducing cell-cycle arrest in phases such as G0/G1 or S phase through the modulation of key regulators including cyclins, CDKs, and p53. Furthermore, it promotes programmed cell death via apoptotic pathways, involving caspase activation and downregulation of anti-apoptotic proteins such as survivin. A more recently elucidated mechanism is the induction of ferroptosis, an iron-dependent form of cell death characterized by overwhelming lipid peroxidation. Beyond direct cytotoxicity, LF acts as a potent immunomodulator. It enhances natural killer (NK) cell activity, modulates T-lymphocyte populations, and crucially reprograms tumor-associated macrophages (TAMs) from a pro-tumor M2 state to an anti-tumor M1 state, thereby reversing the immunosuppressive tumor microenvironment (TME). The translation of LF’s potential has been significantly accelerated by nanotechnology. The inherent biocompatibility and natural tumor-targeting capabilities of LF make it an ideal platform for sophisticated drug-delivery systems. This review details various fabrication strategies for LF-based nanoparticles (NPs), including self-assembly, sol-in-oil emulsion, and electrostatic nanocomplexes, among others. Research demonstrates that nano-formulations not only protect LF from degradation but also enhance its bioactivity and anti-cancer potency. More importantly, LF NPs serve as versatile carriers for a wide array of therapeutic agents, including conventional chemotherapeutics, natural compounds, and imaging agents. These engineered systems enable synergistic therapy and facilitate site-specific delivery. Notably, the ability of LF to bind to receptors on the blood-brain barrier (BBB) has been leveraged to develop nano-systems for glioblastoma treatment. Other innovative designs utilize LF to modulate the TME—for instance, by alleviating tumor hypoxia to sensitize cells to radiotherapy and chemotherapy. Despite compelling pre-clinical evidence, the clinical translation of LF and its nano-formulations remains nascent. While early-phase trials have established a favorable safety profile for recombinant human LF, larger Phase III studies have yielded mixed results, underscoring the complexity of its action in humans. Key challenges include enhancing drug targeting, optimizing loading efficiency, ensuring batch-to-batch reproducibility, and achieving deep tumor penetration. Future research must focus on the rational design of next-generation LF-NPs. This entails developing standardized manufacturing protocols, engineering “smart” stimuli-responsive systems for targeted drug release in the TME, and constructing multi-targeting platforms. A concerted interdisciplinary effort is paramount to bridge the gap between bench and bedside. In conclusion, LF, particularly in its nano-engineered forms, represents a highly promising and versatile agent in the oncological arsenal, holding immense potential for precise and effective cancer therapy.
5.Research progress on the mechanisms of traditional Chinese medicine in treating functional constipation based on the gut microbiota-bile acid axis
Xiangrui KONG ; Qimeng ZHANG ; Yue ZOU ; Yong LIANG ; Yu SHI ; Yang ZHANG ; Hongxi ZHANG
China Pharmacy 2026;37(2):244-249
Functional constipation (FC) is a common functional disorder of the intestines, mainly characterized by reduced bowel movement frequency, difficulty in defecation, a sensation of incomplete evacuation, and hard stools, which severely affect patients’ quality of life. Research indicates that the pathogenesis of FC is closely related to gut microbiota dysbiosis and abnormal bile acid secretion. Bile acids, as endogenous natural laxatives, promote bowel movements by enhancing colonic secretion and regulating intestinal motility; meanwhile, gut microbiota influence colonic transit function by regulating the enteric nervous system, immune system, and their metabolic products. Based on an overview of the relationship between gut microbiota and bile acid metabolism, this article systematically reviews the current research status on the mechanisms of traditional Chinese medicine (TCM) in treating FC by regulating the balance of the gut microbiota-bile acid axis. It is found that single Chinese medicinal herbs (such as Atractylodes macrocephala), isolated compounds (such as Platycodon grandiflorum polysaccharides), herbal formulas (such as Shanger huang pill), acupuncture, and moxibustion can up-regulate the abundance of beneficial bacteria, reshape the microbial structure, correct bile acid metabolism, and activate the Takeda G-protein receptor 5/farnesoid X receptor pathway to treat FC.
6.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
7.Research progress on traditional Chinese medicine regulation of MAPK signaling pathway in intervening slow transit constipation
Xiangrui KONG ; Qimeng ZHANG ; Yue ZOU ; Yong LIANG ; Yu SHI ; Yang ZHANG ; Ke MENG ; Hongxi ZHANG
China Pharmacy 2026;37(11):1508-1514
low transit constipation (STC) is a common functional intestinal disorder caused by impaired colonic transit function, characterized by reduced bowel movement frequency, hard stools, and difficulty in defecation. The mitogen-activated protein kinase (MAPK) signaling pathway, which mainly includes extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and p38 subtypes, plays a critical regulatory role in the occurrence and development of STC. This paper systematically reviews the multiple pathogenic mechanisms of the MAPK signaling pathway in STC and the research progress of traditional Chinese medicine (TCM) intervention.At the mechanistic level, the MAPK signaling pathway promotes the progression of STC through the following links:(1) Activation of p38 upregulates the expression of aquaporin 3 (AQP3)/AQP4 in the colon, leading to excessive reabsorption of water in the intestinal lumen; (2) It forms a positive feedback loop with nuclear factor-κB (NF-κB) to maintain low-grade intestinal inflammation, releases inflammatory factors such as tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β), and inhibits smooth muscle contraction; (3) Overactivation of p38 downregulates the expression of occludin and mucin 2 while upregulates the expression of claudin-2, thereby disrupting the mucosal barrier; (4) The JNK/p38 signaling pathway activates the caspase cascade to induce apoptosis of intestinal epithelial cells, neurons, and interstitial cells of Cajal; (5) Abnormal ERK signaling and excessive activation of p38/JNK inhibit intestinal smooth muscle contraction and reduce 5-hydroxytryptamine secretion, ultimately resulting in impaired colonic transit function.At the intervention level, TCM compound formulas and single herbs have been proven to improve STC by regulating the MAPK signaling pathway. Their effects are syndrome type-dependent:yin-nourishing formulas (Zengye Chengqi Tang, Tongbian Tang) mainly regulate the ERK/AQP axis; yang-warming formulas (Jichuan Jian) target both ERK/JNK and anti-apoptosis; heat-clearing formulas (Sanren Tang) focus on p38/NF-κB anti-inflammation. A single drug can simultaneously cover multiple aspects including water metabolism, inflammation, barrier function, apoptosis, and intestinal motility.Current relevant studies still have limitations such as mechanisms mostly remaining at the correlational level and a lack of disease-syndrome integrated research models. Future studies should combine specific inhibitors or gene knockout to identify core targets, establish disease-syndrome integrated STC models, and use network pharmacology and molecular docking techniques to deeply analyze the fine mechanism of “component-target-phenotype”, so as to provide high-quality evidence for the precise regulation of the MAPK signaling pathway by TCM in the intervention of STC.
8.Role of Innate Trained Immunity in Diseases
Chuang CHENG ; Yue-Qing WANG ; Xiao-Qin MU ; Xi ZHENG ; Jing HE ; Jun WANG ; Chao TAN ; Xiao-Wen LIU ; Li-Li ZOU
Progress in Biochemistry and Biophysics 2025;52(1):119-132
The innate immune system can be boosted in response to subsequent triggers by pre-exposure to microbes or microbial products, known as “trained immunity”. Compared to classical immune memory, innate trained immunity has several different features. Firstly, the molecules involved in trained immunity differ from those involved in classical immune memory. Innate trained immunity mainly involves innate immune cells (e.g., myeloid immune cells, natural killer cells, innate lymphoid cells) and their effector molecules (e.g., pattern recognition receptor (PRR), various cytokines), as well as some kinds of non-immune cells (e.g., microglial cells). Secondly, the increased responsiveness to secondary stimuli during innate trained immunity is not specific to a particular pathogen, but influences epigenetic reprogramming in the cell through signaling pathways, leading to the sustained changes in genes transcriptional process, which ultimately affects cellular physiology without permanent genetic changes (e.g., mutations or recombination). Finally, innate trained immunity relies on an altered functional state of innate immune cells that could persist for weeks to months after initial stimulus removal. An appropriate inducer could induce trained immunity in innate lymphocytes, such as exogenous stimulants (including vaccines) and endogenous stimulants, which was firstly discovered in bone marrow derived immune cells. However, mature bone marrow derived immune cells are short-lived cells, that may not be able to transmit memory phenotypes to their offspring and provide long-term protection. Therefore, trained immunity is more likely to be relied on long-lived cells, such as epithelial stem cells, mesenchymal stromal cells and non-immune cells such as fibroblasts. Epigenetic reprogramming is one of the key molecular mechanisms that induces trained immunity, including DNA modifications, non-coding RNAs, histone modifications and chromatin remodeling. In addition to epigenetic reprogramming, different cellular metabolic pathways are involved in the regulation of innate trained immunity, including aerobic glycolysis, glutamine catabolism, cholesterol metabolism and fatty acid synthesis, through a series of intracellular cascade responses triggered by the recognition of PRR specific ligands. In the view of evolutionary, trained immunity is beneficial in enhancing protection against secondary infections with an induction in the evolutionary protective process against infections. Therefore, innate trained immunity plays an important role in therapy against diseases such as tumors and infections, which has signature therapeutic effects in these diseases. In organ transplantation, trained immunity has been associated with acute rejection, which prolongs the survival of allografts. However, trained immunity is not always protective but pathological in some cases, and dysregulated trained immunity contributes to the development of inflammatory and autoimmune diseases. Trained immunity provides a novel form of immune memory, but when inappropriately activated, may lead to an attack on tissues, causing autoinflammation. In autoimmune diseases such as rheumatoid arthritis and atherosclerosis, trained immunity may lead to enhance inflammation and tissue lesion in diseased regions. In Alzheimer’s disease and Parkinson’s disease, trained immunity may lead to over-activation of microglial cells, triggering neuroinflammation even nerve injury. This paper summarizes the basis and mechanisms of innate trained immunity, including the different cell types involved, the impacts on diseases and the effects as a therapeutic strategy to provide novel ideas for different diseases.
9.Changing prevalence and antibiotic resistance profiles of carbapenem-resistant Enterobacterales in hospitals across China:data from CHINET Antimicrobial Resistance Surveillance Program,2015-2021
Wenxiang JI ; Tong JIANG ; Jilu SHEN ; Yang YANG ; Fupin HU ; Demei ZHU ; Yuanhong XU ; Ying HUANG ; Fengbo ZHANG ; Ping JI ; Yi XIE ; Mei KANG ; Chuanqing WANG ; Pan FU ; Yingchun XU ; Xiaojiang ZHANG ; Ziyong SUN ; Zhongju CHEN ; Yuxing NI ; Jingyong SUN ; Yunzhuo CHU ; Sufei TIAN ; Zhidong HU ; Jin LI ; Yunsong YU ; Jie LIN ; Bin SHAN ; Yan DU ; Sufang GUO ; Lianhua WEI ; Fengmei ZOU ; Yunjian HU ; Xiaoman AI ; Chao ZHUO ; Danhong SU ; Dawen GUO ; Jinying ZHAO ; Hua YU ; Xiangning HUANG ; Wen'en LIU ; Yanming LI ; Yan JIN ; Chunhong SHAO ; Xuesong XU ; Chao YAN ; Shanmei WANG ; Yafei CHU ; Lixia ZHANG ; Juan MA ; Shuping ZHOU ; Yan ZHOU ; Lei ZHU ; Jinhua MENG ; Fang DONG ; Zhiyong LÜ ; Fangfang HU ; Han SHEN ; Wanqing ZHOU ; Wei JIA ; Gang LI ; Jinsong WU ; Yuemei LU ; Jihong LI ; Jinju DUAN ; Jianbang KANG ; Xiaobo MA ; Yanping ZHENG ; Ruyi GUO ; Yan ZHU ; Yunsheng CHEN ; Qing MENG ; Shifu WANG ; Xuefei HU ; Hong ZHANG ; Chun WANG ; Wenhui HUANG ; Ruizhong WANG ; Hua FANG ; Bixia YU ; Yong ZHAO ; Ping GONG ; Kaizhen WENG ; Yirong ZHANG ; Jiangshan LIU ; Longfeng LIAO ; Hongqin GU ; Lin JIANG ; Wen HE ; Shunhong XUE ; Jiao FENG ; Chunlei YUE
Chinese Journal of Infection and Chemotherapy 2025;25(4):445-454
Objective To summarize the changing prevalence of carbapenem resistance in Enterobacterales based on the data of CHINET Antimicrobial Resistance Surveillance Program from 2015 to 2021 for improving antimicrobial treatment in clinical practice.Methods Antimicrobial susceptibility testing was performed using a commercial automated susceptibility testing system according to the unified CHINET protocol.The results were interpreted according to the breakpoints of the Clinical & Laboratory Standards Institute(CLSI)M100 31st ed in 2021.Results Over the seven-year period(2015-2021),the overall prevalence of carbapenem-resistant Enterobacterales(CRE)was 9.43%(62 342/661 235).The prevalence of CRE strains in Klebsiella pneumoniae,Citrobacter freundii,and Enterobacter cloacae was 22.38%,9.73%,and 8.47%,respectively.The prevalence of CRE strains in Escherichia coli was 1.99%.A few CRE strains were also identified in Salmonella and Shigella.The CRE strains were mainly isolated from respiratory specimens(44.23±2.80)%,followed by blood(20.88±3.40)%and urine(18.40±3.45)%.Intensive care units(ICUs)were the major source of the CRE strains(27.43±5.20)%.CRE strains were resistant to all the β-lactam antibiotics tested and most non-β-lactam antimicrobial agents.The CRE strains were relatively susceptible to tigecycline and polymyxins with low resistance rates.Conclusions The prevalence of CRE strains was increasing from 2015 to 2021.CRE strains were highly resistant to most of the antibacterial drugs used in clinical practice.Clinicians should prescribe antimicrobial agents rationally.Hospitals should strengthen antibiotic stewardship in key clinical settings such as ICUs,and take effective infection control measures to curb CRE outbreak and epidemic in hospitals.
10.Changing distribution and antibiotic resistance profiles of the respiratory bacterial isolates in hospitals across China:data from CHINET Antimicrobial Resistance Surveillance Program,2015-2021
Ying FU ; Yunsong YU ; Jie LIN ; Yang YANG ; Fupin HU ; Demei ZHU ; Yingchun XU ; Xiaojiang ZHANG ; Fengbo ZHANG ; Ping JI ; Yi XIE ; Mei KANG ; Chuanqing WANG ; Pan FU ; Yuanhong XU ; Ying HUANG ; Ziyong SUN ; Zhongju CHEN ; Yuxing NI ; Jingyong SUN ; Yunzhuo CHU ; Sufei TIAN ; Zhidong HU ; Jin LI ; Bin SHAN ; Yan DU ; Sufang GUO ; Lianhua WEI ; Fengmei ZOU ; Hong ZHANG ; Chun WANG ; Yunjian HU ; Xiaoman AI ; Chao ZHUO ; Danhong SU ; Dawen GUO ; Jinying ZHAO ; Hua YU ; Xiangning HUANG ; Wen'en LIU ; Yanming LI ; Yan JIN ; Chunhong SHAO ; Xuesong XU ; Chao YAN ; Shanmei WANG ; Yafei CHU ; Lixia ZHANG ; Juan MA ; Shuping ZHOU ; Yan ZHOU ; Lei ZHU ; Jinhua MENG ; Fang DONG ; Zhiyong LÜ ; Fangfang HU ; Han SHEN ; Wanqing ZHOU ; Wei JIA ; Gang LI ; Jinsong WU ; Yuemei LU ; Jihong LI ; Jinju DUAN ; Jianbang KANG ; Xiaobo MA ; Yanping ZHENG ; Ruyi GUO ; Yan ZHU ; Yunsheng CHEN ; Qing MENG ; Shifu WANG ; Xuefei HU ; Jilu SHEN ; Ruizhong WANG ; Hua FANG ; Bixia YU ; Yong ZHAO ; Ping GONG ; Kaizhen WENG ; Yirong ZHANG ; Jiangshan LIU ; Longfeng LIAO ; Hongqin GU ; Lin JIANG ; Wen HE ; Shunhong XUE ; Jiao FENG ; Chunlei YUE ; Wenhui HUANG
Chinese Journal of Infection and Chemotherapy 2025;25(4):431-444
Objective To characterize the changing species distribution and antibiotic resistance profiles of respiratory isolates in hospitals participating in the CHINET Antimicrobial Resistance Surveillance Program from 2015 to 2021.Methods Commercial automated antimicrobial susceptibility testing systems and disk diffusion method were used to test the susceptibility of respiratory bacterial isolates to antimicrobial agents following the standardized technical protocol established by the CHINET program.Results A total of 589 746 respiratory isolates were collected from 2015 to 2021.Overall,82.6%of the isolates were Gram-negative bacteria and 17.4%were Gram-positive bacteria.The bacterial isolates from outpatients and inpatients accounted for(6.0±0.9)%and(94.0±0.1)%,respectively.The top microorganisms were Klebsiella spp.,Acinetobacter spp.,Pseudomonas aeruginosa,Staphylococcus aureus,Haemophilus spp.,Stenotrophomonas maltophilia,Escherichia coli,and Streptococcus pneumoniae.Each microorganism was isolated from significantly more males than from females(P<0.05).The overall prevalence of methicillin-resistant S.aureus(MRSA)was 39.9%.The prevalence of penicillin-resistant S.pneumoniae was 1.4%.The prevalence of extended-spectrum β-lactamase(ESBL)-producing E.coli and K.pneumoniae was 67.8%and 41.3%,respectively.The overall prevalence of carbapenem-resistant E.coli,K.pneumoniae,Enterobacter cloacae,Pseudomonas aeruginosa,and Acinetobacter baumannii was 3.7%,20.8%,9.4%,29.8%,and 73.3%,respectively.The prevalence of β-lactamase was 96.1%in Moraxella catarrhalis and 60.0%in Haemophilus influenzae.The H.influenzae isolates from children(<18 years)showed significantly higher resistance rates to β-lactam antibiotics than the isolates from adults(P<0.05).Conclusions Gram-negative bacteria are still predominant in respiratory isolates associated with serious antibiotic resistance.Antimicrobial resistance surveillance should be strengthened in clinical practice to support accurate etiological diagnosis and appropriate antimicrobial therapy based on antimicrobial susceptibility testing results.

Result Analysis
Print
Save
E-mail