AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

[Objective] To explore the temperature parameters affecting the polybrene test and determine the optimal temperature conditions for detecting unexpected antibodies of the Rh system. [Methods] The reaction of IgG human anti-D antibody with different dilutions (undiluted, 1∶2, 1∶4, 1∶8, 1∶16, 1∶32，1∶64) with D antigen-positive red blood cells was detected by manual polybrene test (MPT). Different temperatures (25℃ and 37℃) were set, and the reaction time with low ionic medium was 4 minutes. The agglutination integral value of anti-D and red cell depolymerization time were compared to observe the effect of enhanced agglutination reaction, thereby establishing the test temperature reaction conditions for enhancing the MPT. The same reaction condition was applied to 36 blood samples containing unexpected antibodies of the Rh system, and the effect of enhanced MPT was observed in comparison with the polybrene method and the antiglobulin test (column agglutination). [Results] With all other conditions held constant, when low ionic medium was added, the incubation temperature of 25℃ and 37℃ resulted in different total agglutination integral values for anti-D (20.9±2.025 vs 25.5±2.635), and the comparison showed a significant difference (P<0.05). When the antibody dilution was 1∶16, the incubation temperature of 25℃ and 37℃ resulted in different agglutination integral values (3.9±0.738 vs 5.8±0.632), and the comparison showed a significant difference (P<0.05). Erythrocyte depolymerization time (62.8±8.149 vs 90.1±10.713) was significantly different (P<0.05). At a dilution of 1∶32, the incubation temperatures of 25℃ and 37℃ resulted in different agglutination integral values (2.5±0.527 vs 4.3±0.675), as well as different red blood cell dissociation times (35.4±7.792 vs 57.4±10.885)(P<0.05), and the comparison showed a significant difference (P<0.05), with no differences observed in the other groups. In the detection of 36 Rh system unexpected antibody samples, when the antibody titer was ≤2, the enhanced polybrene method had a higher positive rate, and when the antibody titer was ≥4, the detection rates of the three methods were consistent. [Conclusion] The reference temperature condition for the modified MPT is incubation at 37℃ for 4 min after the addition of low ionic medium. The application of this temperature condition to unexpected antibody samples of Rh system could achieve a significant enhancement effect, thereby increasing transfusion safety for the treatment of emergency patients, and is worth popularizing.

Intraoperative cell salvage (IOCS) has been widely applied as an important blood conservation measure in surgical operations. However, there is currently a lack of clinical practice guidelines for the implementation of IOCS in patients with malignant tumors. This report aims to provide clinicians with recommendations on the use of IOCS in patients with malignant tumors based on the review and assessment of the existed evidence. Data were derived from databases such as PubMed, Embase, the Cochrane Library and Wanfang. The guideline development team formulated recommendations based on the quality of evidence, balance of benefits and harms, patient preferences, and health economic assessments. This study constructed seven major clinical questions. The main conclusions of this guideline are as follows: 1) Compared with no perioperative allogeneic blood transfusion (NPABT), perioperative allogeneic blood transfusion (PABT) leads to a more unfavorable prognosis in cancer patients (Recommended); 2) Compared with the transfusion of allogeneic blood or no transfusion, IOCS does not lead to a more unfavorable prognosis in cancer patients (Recommended); 3) The implementation of IOCS in cancer patients is economically feasible (Recommended); 4) Leukocyte depletion filters (LDF) should be used when implementing IOCS in cancer patients (Strongly Recommended); 5) Irradiation treatment of autologous blood to be reinfused can be used when implementing IOCS in cancer patients (Recommended); 6) A careful assessment of the condition of cancer patients (meeting indications and excluding contraindications) should be conducted before implementing IOCS (Strongly Recommended); 7) Informed consent from cancer patients should be obtained when implementing IOCS, with a thorough pre-assessment of the patient's condition and the likelihood of blood loss, adherence to standardized internally audited management procedures, meeting corresponding conditions, and obtaining corresponding qualifications (Recommended). In brief, current evidence indicates that IOCS can be implemented for some malignant tumor patients who need allogeneic blood transfusion after physician full evaluation, and LDF or irradiation should be used during the implementation process.

ObjectiveTo investigate the effect and mechanism of Polygonatum neutral polysaccharides from sibiricum （PSP-NP） on colon injury in mice with chronic obstructive pulmonary disease （COPD）. MethodsMale C57BL/6J mice were randomly divided into a control group， a COPD model group， and a PSP-NP group. The COPD model was established using smoke exposure combined with intranasal LPS administration. The PSP-NP group was simultaneously treated daily with 200 mg/kg of PSP-NP via intragastric gavage， while the other groups received an equal volume of saline. HE staining was used to observe the pathological changes in the colon. ELISA was employed to detect the levels of LPS in serum and the expressions of ZO-1， Occludin， IL-6， and TNF-α in colon tissue. UPLC-MS was used to detect the types and contents of bile acids in colonic content， and to screen for differential bile acids. Differential microbial flora were identified using 16S rRNA gene sequencing， and correlation analysis was conducted with differential bile acids. PSP-NP was combined with the differential bile acids cholic acid （CA）， and deoxycholic acid （DCA） in vitro to analyze the binding capacity of PSP-NP for CA and DCA. PSP-NP was applied to NCM460 normal colonic epithelial cells cultured in CA and DCA. Cell migration ability was assessed using the scratch assay， and the mRNA expression levels of inflammatory cytokines TNF-α， IL-6， and NF-κB were measured by RT-qPCR. ResultsPSP-NP effectively improved colonic damage in COPD model mice， enhanced mechanical barrier function， alleviated inflammatory response， and regulated abnormal changes in colonic flora and bile acid metabolism. Correlation analysis further revealed that PSP-NP regulated colonic bile acid metabolism and reduced the redundancy of secondary bile acids by increasing the relative abundance of Bacteroidota， Verrucomicrobiota， Bacteroides， and Akkermansia， while decreasing the relative abundance of Lactobacillus and Bifidobacterium. Notably， in vitro binding assays demonstrated that PSP-NP bound to differential bile acids DCA and CA， with the strongest binding capacity for DCA at 58.2%. In cellular functional studies， DCA inhibited the migration ability of colonic epithelial cells NCM460 and significantly increased the relative mRNA expression levels of inflammatory factors TNF-α， IL-6， and NF-κB. Importantly， co-treatment with PSP-NP significantly ameliorated the impact of DCA on NCM460 cells. ConclusionsPSP-NP may significantly improve colonic damage in COPD model mice. The mechanism may involve the regulation of colonic bile acid metabolism and bile acid profiles through both microbial modulation and direct binding， thereby reducing the damage caused by secondary bile acids such as DCA to colonic epithelial cells.

As a physical treatment technique, modified electro-convulsive therapy (MECT) is used to treat mental and certain neurological disorders by causing seizures with short, suitable electrical currents applied to the brain while the patient is under general anesthesia and muscle relaxants. MECT is recognized for its therapeutic efficacy and clinical safety, rendering it one of the most prevalent interventions in psychiatric care. To enhance clinical outcomes and minimize adverse effects, this consensus document delineates the indications, therapeutic parameters, therapeutic procedures, potential adverse effects, and associated management strategies for MECT. These guidelines are informed by the latest clinical research and expert consensus, integrating evidence-based medicine methodologies. The objective is to furnish clinicians with precise operational guidelines and to advance the standardization of MECT practices in clinical settings.

Aim To investigate the mechanism by which sufentanil(Suf)improved hypoxia-reoxygen-ation(H/R)-induced myocardial cell injury by regula-ting hypoxia inducible factor-1α(HIF-1α)and KC-NQ1 opposite strand/antisense transcript 1(Kcnq1ot1).Methods Bioinformatics analysis was conducted to predict the interaction between HIF-1αand Kcnq1ot1.Subsequently,H9c2 cells were divided into multiple treatment groups:Ctrl group,H/R group,and Suf group.Further grouping was based on different transfection conditions,including oe-HIF-1α group,oe-HIF-1α+Suf group,sh-HIF-1α group,and sh-HIF-1α+Kcnq1ot1 group.Cell viability was detected u-sing the MTT assay,cell apoptosis was detected using the TUNEL assay,and the concentrations of CK-MB and HBDH in cell supernatants were measured using ELISA.HIF-1α protein expression in cellswas deter-mined by Western blot,and the mRNA expression level of Kcnq1ot1 was measured by reverse transcription quantitative PCR(RT-qPCR).Additionally,a rat model of myocardial is chemia reperfusion was con-structed to evaluate the therapeutic potential of Suf for myocardial ischemia reperfusion injury in vivo.Results The results of bioinformatics analysis showed a direct interaction between HIF-1α and Kcnq1ot1.Compared with the Ctrl group,the H/R group showed significantly reduced H9c2 cell viability,increased cell apoptosis,and significantly upregulated concentrations of CK-MB and HBDH,along with significantly enhanced expres-sion of HIF-1α and Kcnq1ot1(all P＜0.05).When H9c2 cells were transfected with oe-HIF-1 α,cell via-bility further decreased,apoptosis was worsened,and CK-MB and HBDH concentrations further increased(all P＜0.05);however,these adverse effects were significantly inhibited when combined with Suf inter-vention(all P＜0.05).Additionally,compared with the H/R group,the sh-HIF-1α group showed signifi-cantly improved cell viability,reduced apoptosis and decreased CK-MB and HBDH concentrations(all P＜0.05);however,these improvements were partially re-versed upon transfection with Kcnq1ot1(all P＜0.05).Animal experiments confirmed that Suf could improve myocardial ischemia-reperfusion injury in myo-cardial ischemia-reperfusion injury rats.Conclusions Suf improves myocardial H/R injury by inhibiting the HIF-1α-Kcnq1ot1.

Objective To investigate the effect of loganin(Log)on glutamine metabolism in cervical cancer through the regula-tion of nuclear factor red blood cell 2 related factor 2(NFE2L2)-ferritin heavy chain 1(FTH1)-glutathione peroxidase 4(GPX4).Methods Bioinformatics analysis was conducted to identify common targets of Log,glutamine metabolism,and cervical cancer.Hela cells were divided into Blank,control(Ctrl),Log,cisplatin(DDP),NFE2L2 activator(TBHQ),NFE2L2 inhibitor(ML385),and TBHQ+Log groups to detect cell proliferation,invasion,apoptosis,glutamine metabolism,and the protein expression of NFE2L2,FTH1,and GPX4.A cervical cancer xenograft mouse model was established to investigate the in vivo effects of Log on the progression of cervical cancer.Results Bioinformatics analysis confirmed that NFE2L2 might be a target of Log in the treatment of cervical cancer.Both Log and DDP reduced the proliferation and invasion abilities of Hela cells,increased apoptosis,and decreased the levels of glutamine and glutamic acid,as well as the protein expression of glutaminase(GLS1)and glutamic dehydrogenase(GLUD1,P<0.05).The NFE2L2 activator TBHQ had opposite effects,whereas ML385 had a similar impact on the Log.Additionally,Log treatment inhibited the protein expression of NFE2L2,FTH1,and GPX4(P<0.05).Animal experiments showed that Log significantly inhibited cervical cancer progression(P<0.05).Conclusion Log affects cervical cancer progression via glutamine metabolism by inhibiting the NFE2L2-FTH1-GPX4 signaling pathway.

Objective:To explore the safety, effectiveness, and short-term outcomes of transoral robotic surgery (TORS) for supraglottic laryngeal cancer.Methods:A retrospective analysis was conducted on patients with supraglottic laryngeal cancer who underwent TORS at Sun Yat-sen Memorial Hospital of Sun Yat-sen University, Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology, Eye Ear Nose and Throat Hospital of Fudan University, and the First Affiliated Hospital of China Medical University between January 2018 and April 2024. Data on operative time, intraoperative blood loss, postoperative hospital stay, perioperative tracheostomy, nasogastric feeding, complications, and short-term follow-up were analyzed. Statistical analysis was performed using Python.Results:A total of 27 patients with supraglottic laryngeal cancer were included from the four centers, including 24 males and 3 females, with a median age of 66 (65, 68) years [ M( Q1, Q3), same below]. There were 26 cases of squamous cell carcinoma and 1 case of adenoid cystic carcinoma.The TNM staging included T1 in 10 cases (37.04%), T2 in 13 cases (48.15%), and T3 in 4 cases (14.81%); N0 in 14 cases (51.85%), N1 in 7 cases (25.93%), and N2 in 6 cases (22.22%). The Da Vinci Si system was used in 23 cases, and the Da Vinci Xi in 4 cases. The robotic surgical time was 53 (30, 58) min. Concurrent neck dissection was performed in 25 cases, neoadjuvant therapy was given preoperatively in 8 cases (29.63%), and postoperative radiotherapy was administered in 13 cases (48.15%). Tracheostomy was performed in 11 cases (40.74%). Nasogastric tube placement was required in 23 cases (85.19%), with a median duration of 16 (12, 21) days. The postoperative hospital stay was 9.19±4.07 days. The median follow-up time was 12 (3, 30) months. Local recurrence occurred in 2 cases. The 3-year overall survival rate was 100%, and the 3-year disease-free survival rate was 94.1%. Conclusion:With appropriate patient selection, TORS for supraglottic laryngeal cancer demonstrates satisfactory short-term outcomes, thereby offering advantages in safety, efficacy, and minimal invasiveness, which can be considered a new treatment option for this condition.