AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Age-related macular degeneration (AMD) involves dysregulation of the innate immune response of complement and mononuclear phagocytes and abnormalities of local microglia. When microglia transition from a resting state to an active state, their metabolic pathway also changes, known as "metabolic reprogramming", and their glucose metabolic reprogramming is a key factor in the pathogenesis of AMD, involving multiple signaling pathways. Including phosphatidylinositol 3-kinase-serine threonine kinase-rapamycin target, adenylate activated protein kinase and hypoxia-inducing factor 1 pathway. These metabolic changes regulate the inflammatory response, energy supply, and neuroprotective functions of microglia. Therapeutic strategies to regulate the reprogramming of glucose metabolism in microglia have achieved initial results. Future studies should further explore the mechanisms of microglia metabolic regulation to develop new targeted drugs and intervene in the treatment of AMD through anti-cellular aging pathways.

ObjectiveTo evaluate the effect of labor analgesia and the outcome of maternals and neonatals by applying the vitamin B6- folic acid mixture to combined with spinal-epidural analgesia(CSEA) in nulliparous women at latency.MethodsAll the 112 full-term nulliparous parturients were selected and divided into the treated group and controlled group.Nulliparous women in two groups received CSEA,with which the additional vitamin - folic acid mixture was used only in treatment group.The contrast between the analgesic effect in groups,and alalgesic effect-acting period,fentanyl Apgar score and newborn usage were compared between groups also.ResultsThe analgesic effect-acting period and fentanyl dosage in the treated group were significantly decreased.There was significant difference between the 2 ( P ＜ 0.05 ).ConclusionsIt could be effective applying vitamin B6- folic acid mixture at latency in nulliparous women based on CSEA,which could shorten the lumbar hemp effect-acting period and reduce fentanyl narcotic drugs dosage.