1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Expert Consensus on Clinical Application of Pingxuan Capsules
Yuer HU ; Yanming XIE ; Yaming LIN ; Yuanqi ZHAO ; Yihuai ZOU ; Mingquan LI ; Xiaoming SHEN ; Wei PENG ; Changkuan FU ; Yuanyuan LI
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(1):201-210
As a patented characteristic medicine of Yi ethnic minority, Pingxuan capsules have the effects of nourishing the liver and kidney, pacifying the liver, and subduing Yang. With the main indications of dizziness, headache, palpitations, tinnitus, insomnia, dreaminess, waist and knee soreness caused by liver-kidney deficiency and liver Yang upward disturbance, Pingxuan capsules are widely used in the treatment of posterior circulation ischemic vertigo, vestibular migraine, benign paroxysmal positional vertigo. However, the current knowledge is limited regarding the efficacy, syndrome differentiation, and safety of this medicine. On the basis of summarizing the experience of clinicians and the existing evidence, this study invites clinical experts of traditional Chinese and Western medicine, pharmaceutical experts, and methodological experts from relevant fields across China to conduct evidence-based evaluation of Pingxuan capsules. The evaluation follows the Specifications for the Development of Clinical Expert Consensus on Chinese Patent Medicines issued by the Standardization Office of the China Association of Chinese Medicine, and reaches 5 recommendations and 16 consensus suggestions. The consensus clarifies the clinical applications, efficacy, dose, course of treatment, combination of medicines, precautions, and contraindications of Pingxuan capsules in the treatment of vertigo and explains the safety of clinical application. This consensus is applicable to clinicians (traditional Chinese medicine, Western medicine, and integrated traditional Chinese and Western medicine) and pharmacists in tertiary hospitals, secondary hospitals, and community-level medical and health institutions across China, providing a reference for the rational use of Pingxuan capsules in the treatment of vertigo. It is hoped that the promotion of this consensus can facilitate the rational use of drugs in clinical practice, reduce the risk of drug use, and give full play to the advantages of Pingxuan capsules in the treatment of vertigo diseases. This consensus has been reviewed and published by the China Association of Chinese Medicine, with the number GS/CACM330-2023.
3.Color-component correlation and mechanism of component transformation of processed Citri Reticulatae Semen.
Kui-Lin ZHU ; Jin-Lian ZOU ; Xu-Li DENG ; Mao-Xin DENG ; Hai-Ming WANG ; Rui YIN ; Zhang-Xian CHEN ; Yun-Tao ZHANG ; Hong-Ping HE ; Fa-Wu DONG
China Journal of Chinese Materia Medica 2025;50(9):2382-2390
High-performance liquid chromatography(HPLC) was used to determine the content of three major components in Citri Reticulatae Semen(CRS), including limonin, nomilin, and obacunone. The chromaticity of the CRS sample during salt processing and stir-frying was measured using a color difference meter. Next, the relationship between the color and content of the salt-processed CRS sample was investigated through correlation analysis. By integrating the oil bath technique for processing simulation with HPLC, the changes in the relative content of nomilin and its transformation products were analyzed, with its structural transformation pattern during processing identified. Additionally, RAW264.7 cells were induced with lipopolysaccharides(LPSs) to establish an inflammatory model, and the anti-inflammatory activity of nomilin and its transformation product, namely obacunone was evaluated. The results indicated that as processing progressed, E~*ab and L~* values showed a downward trend; a~* values exhibited a slow increase over a certain period, followed by no significant changes, and b~* values remained stable with no significant changes over a certain period and then started to decrease. The limonin content remained barely unchanged; the nomilin content decreased, and the obacunone increased significantly. The changing trends in content and color parameters during salt-processing and stir-frying were basically consistent. The content of nomilin and obacunone was significantly correlated with the colorimetric values(L~*, a~*, b~*, and E~*ab), while limonin content showed no significant correlation with these values. By analyzing HPLC patterns of nomylin at different heating temperatures and time, it was found that under conditions of 200-250 ℃ for heating of 5-60 min, the content of nomilin significantly decreased, while the obacunone content increased pronouncedly. The in vitro anti-inflammatory activity results indicated that compared to the model group, the group with a high concentration of nomilin and the groups with varying concentrations of obacunone showed significantly reduced release of nitric oxide(NO)(P<0.01). When both were at the same concentration, obacunone showed better performance in inhibiting NO release. In this study, the obvious correlation between the color and content of major components during the processing of CRS samples was identified, and the dynamic patterns of quality change in CRS samples during processing were revealed. Additionally, the study revealed and confirmed the transformation of nomilin into obacunone during processing, with the in vitro anti-inflammatory activity of obacunone significantly greater than that of nomilin. These findings provided a scientific basis for CRS processing optimization, tablet quality control, and its clinical application.
Mice
;
Animals
;
Drugs, Chinese Herbal/pharmacology*
;
RAW 264.7 Cells
;
Limonins/chemistry*
;
Chromatography, High Pressure Liquid
;
Citrus/chemistry*
;
Color
;
Benzoxepins/chemistry*
;
Anti-Inflammatory Agents/chemistry*
4.Research and Therapeutic Advances of 26S Proteasome Subunit in Non-small Cell Lung Cancer.
Chenrui MOU ; Shaotong ZOU ; Chao REN ; Zihan YI ; Jianlin SHI
Chinese Journal of Lung Cancer 2025;28(5):363-370
Lung cancer is one of the most common cancers worldwide and is the leading cause of cancer deaths. Lung adenocarcinoma is the most common type of lung cancer. Due to the lack of effective biomarkers and therapeutic targets in the proliferation and metastasis of lung adenocarcinoma, the overall treatment of lung adenocarcinoma is not optimistic. Therefore, there is a need to find new ideas and methods for lung adenocarcinoma treatment. The 26S proteasome is a multiprotein complex responsible for degrading misfolded proteins and maintaining intracellular protein homeostasis. During the development of non-small cell lung cancer (NSCLC), the regulatory granule subunit of the 26S proteasome promotes the malignant progression of tumours by regulating tumour-associated proteins, immune cells, and related signalling pathways. The proteasome core particle is a key subunit for degrading proteins, and its inhibitors have shown promising anti-tumour effects when combined with conventional chemotherapeutic agents. However, limited by toxic side effects and tumour heterogeneity, targeted inhibitors against the 26S proteasome are still not widely used in NSCLC treatment. This article reviews the mechanism of action and related therapeutic research of 26S proteasome regulatory particle subunits and core particle subunits in NSCLC, and explores the potential of these inhibitors in clinical application.
.
Humans
;
Proteasome Endopeptidase Complex/chemistry*
;
Carcinoma, Non-Small-Cell Lung/genetics*
;
Lung Neoplasms/genetics*
;
Animals
;
Proteasome Inhibitors/therapeutic use*
;
Antineoplastic Agents/therapeutic use*
5.Expert consensus on the treatment of oral diseases in pregnant women and infants.
Jun ZHANG ; Chenchen ZHOU ; Liwei ZHENG ; Jun WANG ; Bin XIA ; Wei ZHAO ; Xi WEI ; Zhengwei HUANG ; Xu CHEN ; Shaohua GE ; Fuhua YAN ; Jian ZHOU ; Kun XUAN ; Li-An WU ; Zhengguo CAO ; Guohua YUAN ; Jin ZHAO ; Zhu CHEN ; Lei ZHANG ; Yong YOU ; Jing ZOU ; Weihua GUO
International Journal of Oral Science 2025;17(1):62-62
With the growing emphasis on maternal and child oral health, the significance of managing oral health across preconception, pregnancy, and infancy stages has become increasingly apparent. Oral health challenges extend beyond affecting maternal well-being, exerting profound influences on fetal and neonatal oral development as well as immune system maturation. This expert consensus paper, developed using a modified Delphi method, reviews current research and provides recommendations on maternal and child oral health management. It underscores the critical role of comprehensive oral assessments prior to conception, diligent oral health management throughout pregnancy, and meticulous oral hygiene practices during infancy. Effective strategies should be seamlessly integrated across the life course, encompassing preconception oral assessments, systematic dental care during pregnancy, and routine infant oral hygiene. Collaborative efforts among pediatric dentists, maternal and child health workers, and obstetricians are crucial to improving outcomes and fostering clinical research, contributing to evidence-based health management strategies.
Humans
;
Pregnancy
;
Female
;
Infant
;
Consensus
;
Mouth Diseases/therapy*
;
Pregnancy Complications/therapy*
;
Oral Health
;
Infant, Newborn
;
Delphi Technique
;
Oral Hygiene
6.Analysis of detection of acute respiratory infection in children under 12 years old in Pudong New Area, Shanghai from 2019 to 2023
Yang YUAN ; Lu ZHANG ; Zhuyun LI ; Yue ZHANG ; Yujia HUO ; Jialiang CHEN ; Qing LIU ; Wenwei ZOU ; Bing ZHAO ; Lipeng HAO ; Lifeng PAN
Shanghai Journal of Preventive Medicine 2024;36(4):342-347
ObjectiveTo investigate the impact of acute respiratory infections in children under 12 years old in Pudong New Area, Shanghai from 2019 to 2023. MethodsAcute respiratory infection samples of children under 12 years old from three sentinel hospitals in Pudong New Area, Shanghai from 2019 to 2023 were collected, and 42 respiratory infection pathogens, including influenza virus, adenovirus, parainfluenza virus, respiratory syncytial virus, human enterovirus/rhinovirus, human pulmonary virus, human bokavirus, coronavirus (229E, HKU1, NL63 and OC43), and novel coronavirus, were detected with microfluidic chips. The situation of acute respiratory infections among outpatient and inpatient children in this area was analyzed for the before the implementation of non pharmacological intervention measures (2019.12‒2020.1), during the period of non pharmacological intervention measures (2020.2‒2022.12), and after non pharmacological intervention measures (2023.1‒2023.6). ResultsFrom 2019 to 2023, a total of 1 770 samples were collected, and 445 pathogens were detected, with a detection rate of 25.14% (445/1 770). The main pathogens detected during the study period were influenza virus: 8.70% (154/1 770), respiratory syncytial virus: 4.41% (78/1 770), human enterovirus/rhinovirus: 2.66% (47/1 770), human adenovirus: 2.49% (44/1 770), and parainfluenza virus: 2.20% (39/1 770). Before the implementation of non pharmacological intervention measures, outpatients were primarily infected with influenza, parainfluenza virus, and respiratory syncytial virus, with detection rates of 8.09%, 4.49%, and 4.04%, respectively; inpatients were mainly infected with influenza, respiratory syncytial virus, and parainfluenza virus, with detection rates of 4.49%, 3.82%, and 3.15%, respectively. During the period of non pharmacological intervention measures, influenza, rhinovirus and respiratory syncytial virus were the main viruses detected in the samples of outpatient children, with detection rates of 4.04%, 3.60%, and 2.47%, respectively; inpatient samples mainly detected respiratory syncytial virus, rhinovirus, and influenza virus, with detection rates of 3.60%, 2.02%, and 1.80%, respectively. After non pharmacological intervention measures, influenza, rhinovirus and respiratory syncytial virus were the main pathogens detected in the outpatients, with detection rates of 9.89%, 2.92% and 2.02%, respectively; influenza, respiratory syncytial virus, and rhinovirus were the main pathogens detected in inpatient children, with detection rates of 6.29%, 1.57%, and 1.35%, respectively. ConclusionThe prevalence of pathogens related to acute respiratory infections in children is influenced by non pharmacological preventive measures.
7.Synthesis and Cytotoxicity Evaluation of Panaxadiol Derivatives
Hong PU ; Chengmei DONG ; Cheng ZOU ; Qing ZHAO ; Wenyue DUAN ; Yanmei CHEN ; Lianqing ZHANG ; Jianlin HU
Chinese Journal of Modern Applied Pharmacy 2024;41(13):1765-1774
OBJECTIVE
To obtain stronger cytotoxic activity of panaxadiol derivatives.
METHODS
The 3-amino panaxadiol was prepared by the bioelectronic isosteric principle, and then 18 derivatives of cinnamic acid, NO donor and other types of panaxadiol derivatives were synthesized, among them, 12 compounds had not been reported in the literature, and their structures had been confirmed by 1H-NMR, 13C-NMR and mass spectrometry. These compounds were evaluated for their cytotoxic activity by MTS assay against human leukemia cell line HL-60, liver cancer cell line SMMC-7721, lung cancer cell line A-549, breast cancer cell line MCF-7, and colon cancer cell line SW480.
RESULTS
These results showed that compounds 6c, 7 as well as 7j exhibited potent inhibitory activities against all five tumor cells, especially the IC50 values of compound 7 against HL-60 and SMMC-7721cells were 3.41 and 4.51 μmol·L−1, respectively. It was significantly superior to panaxadiol in cytotoxicity.
CONCLUSION
These results show that 7 and 7j can be used as promising lead compounds for further research.
8. MW-9, a chalcones derivative bearing heterocyclic moieties, ameliorates ulcerative colitis via regulating MAPK signaling pathway
Zhao WU ; Nan-Ting ZOU ; Chun-Fei ZHANG ; Hao-Hong ZHANG ; Qing-Yan MO ; Ze-Wei MAO ; Chun-Ping WAN ; Ming-Qian JU ; Chun-Ping WAN ; Xing-Cai XU
Chinese Pharmacological Bulletin 2024;40(3):514-520
Aim To investigate the therapeutic effect of the MW-9 on ulcerative colitis(UC)and reveal the underlying mechanism, so as to provide a scientific guidance for the MW-9 treatment of UC. Methods The model of lipopolysaccharide(LPS)-stimulated RAW264.7 macrophage cells was established. The effect of MW-9 on RAW264.7 cells viability was detected by MTT assay. The levels of nitric oxide(NO)in RAW264.7 macrophages were measured by Griess assay. Cell supernatants and serum levels of inflammatory cytokines containing IL-6, TNF-α and IL-1β were determined by ELISA kits. Dextran sulfate sodium(DSS)-induced UC model in mice was established and body weight of mice in each group was measured. The histopathological damage degree of colonic tissue was assessed by HE staining. The protein expression of p-p38, p-ERK1/2 and p-JNK was detected by Western blot. Results MW-9 intervention significantly inhibited NO release in RAW264.7 macrophages with IC50 of 20.47 mg·L-1 and decreased the overproduction of inflammatory factors IL-6, IL-1β and TNF-α(P<0.05). MW-9 had no cytotoxicity at the concentrations below 6 mg·L-1. After MW-9 treatment, mouse body weight was gradually reduced, and the serum IL-6, IL-1β and TNF-α levels were significantly down-regulated. Compared with the model group, MW-9 significantly decreased the expression of p-p38 and p-ERK1/2 protein. Conclusions MW-9 has significant anti-inflammatory activities both in vitro and in vivo, and its underlying mechanism for the treatment of UC may be associated with the inhibition of MAPK signaling pathway.
9.The Effects of The PD-1/PD-L1 Axis and Its Implications for Immunotherapy in Gastrointestinal Tract Cancers
Xin CAO ; Jin-Ping ZHANG ; Li-Ying TU ; Yun-Lian ZOU
Progress in Biochemistry and Biophysics 2024;51(8):1834-1847
Programmed death-1 (PD-1) is an inhibitory immune checkpoint that binds to programmed death-ligand 1 (PD-L1) to regulate the immune response and maintain immune system homeostasis of the immune system. Through overexpression of PD-L1, tumor cells bind to PD-1 on the surface of immune cells, inhibiting the activity and function of immune cells, leading to immune escape of cancer cells and tumor progression. Gastrointestinal cancer is a common malignancy with a high mortality rate worldwide, and the effectiveness of current systematic treatment options is limited. In recent years, immune checkpoint inhibitors (ICIs) such as PD-1/PD-L1 inhibitors have attracted much attention in cancer therapy. Immunotherapy has been incorporated into the treatment of some gastrointestinal malignancies. Different from traditional treatment, it uses various means to stimulate and enhance the immune function of the body to achieve the therapeutic purpose of controlling and eliminating tumor cells. However, although PD-1/PD-L1 inhibitors have shown potential in the treatment of gastrointestinal tumors, the efficacy of single inhibitor therapy is limited, which may be due to the ability of tumors to escape immune attack through other pathways after inhibitor treatment, or the presence of other immunosuppressive factors. For example, PD-1 and PD-L1 inhibitors can be combined with other immune checkpoint drugs, molecularly targeted drugs, or chemotherapy drugs to simultaneously act on different immune pathways and improve the comprehensive effect of immunotherapy. However, to achieve an effective combination therapy, we need to delve into the specific mechanisms of action of the PD-1/PD-L1 axis in the development and progression of gastrointestinal tumors, which can help to develop the best treatment strategy and provide individualized treatment options for the appropriate patient population. Therefore, future studies should focus on the regulatory mechanisms of PD-1/PD-L1 axis and evaluate the therapeutic effects of different treatment combinations on gastrointestinal tumors. In this paper, we review the research progress of PD-1/PD-L1 axis in tumorigenicity and its mechanism, and review the single and combined treatment strategies of PD-1 and PD-L1 inhibitors in gastrointestinal tumors.
10.Cytotoxic sesquiterpene aryl esters from Armillaria gallica 012m.
Yanping LI ; Shuizhu LOU ; Run YANG ; Ling ZHANG ; Qiuping ZOU ; Shanzhai SHANG ; Lu GAO ; Weiguang WANG
Chinese Herbal Medicines 2023;15(2):343-346
OBJECTIVE:
To study the chemical constituents of the EtOAc extract of Armillaria gallica 012m.
METHODS:
The chemical constituents of the EtOAc extract of A. gallica 012m were isolated and purified by various column chromatography and their structures were elucidated on the basis of the 1D and 2D NMR spectroscopic and HRESIMS data. Cytotoxicity of all isolates against A549, HCT-116, M231 and W256 human tumor cells was determined by the MTT method.
RESULTS:
A new sesquiterpene aryl ester, armimelleolide C ( 1), and eight known ones including armillarivin ( 2), melleolide F ( 3), 6'-chloromelleolide F ( 4), melleolide ( 5), melleolide K ( 6), melledonol ( 7), 13-hydroxydihydromelleolide ( 8), and armillane ( 9), were isolated from the EtOAc extract of A. gallica 012m. All isolates showed potential cytotoxic activities against at least one of the human cancer cell lines with IC50 values ranging from (3.17 ± 0.54) to (17.57 ± 0.47) μmol/L. Compound 1 showed significant inhibitory activity against M231 with an IC50 value of (7.54 ± 0.24) μmol/L compared with paclitaxel as the positive control. Compounds 2, 3, and 7, 9 showed obvious inhibitory activity against HCT-116 and were better than that of the positive control.
CONCLUSION
The chemical constituents including a new sesquiterpene aryl ester armimelleolide C ( 1) from the EtOAc extract of A. gallica 012m have a variety of structures and potential antitumor activities.


Result Analysis
Print
Save
E-mail