Diabetes mellitus（DM） is a globally prevalent chronic metabolic disease， and its hyperglycemia can lead to a series of serious complications. Although current DM treatments are effective， they still have side effects and limitations. Therefore， discovering new drugs has become a key approach to improving DM management. As a traditional Chinese medicine， Dendrobii Caulis has garnered significant attention due to its rich phytochemical properties， which may offer a natural approach to mitigate the harmful effects of DM. Studies have demonstrated that Dendrobii Caulis can significantly reduce blood glucose levels in diabetic animal models and improve insulin resistance. Modern pharmacological studies have shown that the hypoglycemic effect of Dendrobii Caulis is primarily based on multiple mechanisms， including improving insulin sensitivity， inhibiting liver glycogen breakdown， promoting liver glycogen synthesis， and reducing oxidative stress. In addition， polysaccharides in Dendrobii Caulis have been found to increase the serum level of glucagon-like peptide-1 （GLP-1）， which promotes insulin secretion and inhibits glucagon release， thereby improving the symptoms of DM and its complications. Given its potential hypoglycemic effect， Dendrobii Caulis is expected to be developed as a new hypoglycemic agent or health food with promising prospects for treating DM and its complications. With further basic and clinical research， Dendrobii Caulis is expected to become an important adjunct in DM treatment.

Corneal endothelial cells(CECs), which form the innermost cellular layer of the cornea, play a pivotal role in sustaining corneal transparency and preserving visual acuity. However, CECs are vulnerable to damage induced by a spectrum of pathological conditions or traumatic injuries. Once the density of CECs declines below a critical threshold, corneal endothelial dysfunction is precipitated, ultimately leading to corneal edema and progressive visual impairment. Penetrating keratoplasty and corneal endothelial transplantation remain the first-line therapeutic strategies for managing advanced corneal endothelial dysfunction. Nevertheless, the global shortage of donor corneas severely limits the accessibility and scalability of these surgical interventions. Consequently, regenerative medicine approaches targeting corneal endothelial repair and regeneration have emerged as a major focus of international research in ophthalmology. A key challenge in the in vitro expansion of CECs is their propensity to undergo endothelial-to-mesenchymal transition(EndMT). EndMT is a process of cellular phenotypic transformation, through which endothelial cells lose their intrinsic functions and acquire the characteristic features of mesenchymal cells. The EndMT significantly impedes the clinical translation of in vitro-cultured CECs for regenerative applications. In this review, the risk factors and related signaling pathways involved in EndMT were summarized, aiming to provide references for the basic research and clinical treatment of relevant diseases.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

OBJECTIVE To investigate the application status of prescription pre-review systems in healthcare institutions of Yunnan province， evaluate their system functions and management capabilities， and provide a practical basis for promoting rational drug use. METHODS A questionnaire survey was conducted among public healthcare institutions at or above the secondary level in Yunnan province to investigate the deployment status of the systems. A capability maturity assessment framework was constructed， encompassing 6 dimensions and 39 indicators， including real-time prescription review， prescription correlation review， rule setting， evidence-based information support， prescription authority management， and system operation management. This framework was then used to evaluate the institutions that had implemented the pre-review systems. RESULTS A total of 100 valid questionnaires were collected， with 37 institutions having adopted prescription pre-review systems， mainly tertiary hospitals. The system predominantly adopted a modular architecture and was embedded into the hospital information system through application programming interfaces and middleware， providing certain capabilities for real-time prescription risk identification. Evaluation results indicated that basic functions such as reviewing indications， contraindications， and drug compatibility performed well， while deficiencies remained in functions related to parenteral nutrition prescription， review of drug dosage for specific diseases， individual patient characteristic recognition， and rule setting. Moreover， the construction of review centers and establishment of management systems were also not well-developed. CONCLUSIONS The overall application rate of prescription pre-review systems in Yunnan province remains low. System functions and management mechanisms require further improvement. It is recommended to enhance information infrastructure in lower-level institutions and explore regionally unified review models to promote standardized and intelligent development of prescription review practices.

Objective: To explore the association between takeout fast foods and sugar sweetened beverage consumption with co-occurrence of anxiety and depressive symptoms among first year junior high school students in Yunnan Province, so as to provide theoretical basis for the prevention of anxiety and depressive symptoms co-occurrence among adolescents. Methods: A random cluster sampling involving 8 500 first year junior high school students in 11 counties in Yunnan Province was conducted by a questionnaire survey from October to December 2022. The Depression Anxiety Stress Scale-21 (DASS-21) was applied to assess anxiety and depressive symptoms in first year junior high school students. Chi-square test was used to compare the anxiety-depression co-occurrence symptoms of first year junior high school students with different demographic characteristics. The association between takeout fast foods and sugar sweetened beverage consumption with co-occurrence of anxiety and depressive symptoms of adolescents was analyzed by binary Logistic regression models. Results: The detection rate of co-occurrence of anxiety and depression symptoms among first year junior high school students in Yunnan Province was 26.92%. After controlling for demographic variables and other confounders, takeout fast foods and sugar sweetened beverage consumption( OR=1.50, 95%CI =1.27-1.77) was associated with anxiety-depression co-occurrence symptoms among first year junior high school students in Yunnan Province ( P <0.01). Stratified analysis showed that both Han ( OR=1.37, 95%CI =1.07-1.77) and ethnic minorities ( OR=1.60, 95%CI =1.29-2.00) exhibited statistically significant associations between takeout fast foods and sugar sweetened beverage consumption with co-occurrence of anxiety and depressive symptoms(both P <0.05). Conclusions Takeout fast foods and sugar sweetened beverage consumption increases the risk of co-occurrence of anxiety and depressive symptoms among first year junior high school students in Yunnan Province. It is recommended to strengthen guidance on the consumption of such products among junior high school students to prevent co-occurrence of anxiety and depressive symptoms.

ObjectiveTo investigate the influencing factors for recompensation in patients with decompensated liver cirrhosis， as well as the impact of recompensation on the prognosis of such patients， and to provide a basis for early identification of high-risk patients in clinical practice. MethodsA retrospective analysis was performed for the clinical data of patients who attended The Third People’s Hospital of Kunming from January 2016 to December 2022 and were diagnosed with decompensated liver cirrhosis due to hepatitis B， hepatitis C， alcoholic hepatitis， and autoimmune hepatitis， and they were divided into recompensation group and persistent decompensation group. To control for confounding factors， whether recompensation occurred was used as the rouping variable，and BMI， alcohol consumption history， HIV infection history， TG， CHOL， LDL， and HDL were used as covariates. The propensity score was calculated， and 1：1 nearest neighbor matching was performed with a caliper value of 0.1. After propensity score matching， the recompensation group and the persistent decompensation group with relatively balanced covariates were obtained. Univariate and multivariate Cox proportional-hazards regression model analyses were used to investigate the influencing factors for recompensation； the “rms” package was used to establish a nomogram； the receiver operating characteristic （ROC） curve was plotted to calculate the area under the ROC curve （AUC）； the Hosmer-Lemeshow test was used to assess the goodness of fit of the model； the “Calibration Curves” package was used to plot calibration curves for model assessment. The Kaplan-Meier method was used to plot survival curves， and the Log-rank test was used for comparison of survival curves. ResultsAmong the 863 patients with decompensated liver cirrhosis， 305 experienced recompensation， resulting in an incidence rate of 35.3%. After PSM， 610 cases were successfully matched， with 305 cases in each group. The univariate and multivariate Cox regression analyses showed that etiology （hepatitis C： hazard ratio［HR］=0.288， P=0.002）； male（HR=0.701， P=0.016）， age（HR=0.988， P=0.047）， hemoglobin （HGB）（HR=1.006， P=0.017）， and CD4 T cell（HR=1.001，P=0.047）， TIPS procedure （HR=1.808，P=0.042） were independent influencing factors for recompensation in patients with decompensated liver cirrhosis. During follow-up， 116 patients died of liver disease-related causes， with 27 patients （8.85%） in the recompensation group and 89 （15.95%） in the persistent decompensation group； 109 patients developed HCC， with 23 patients （7.54%） in the recompensation group and 86 （15.41%） in the persistent decompensation group. The Kaplan-Meier survival curves showed significant separation between the patients with different states of compensation in terms of liver disease-related mortality rate and the incidence rate of HCC， and the Log-rank test showed that there were significant differences between the two groups in liver disease-related mortality rate （χ²=9.023， P=0.003） and the incidence rate of HCC （χ²=10.526， P=0.001）. ConclusionEtiology，sex，age，TIPS，HGB，and CD4 T cell are independent influencing factors for recompensation in patients with decompensated liver cirrhosis. There is a significant difference in the incidence rate of recompensation between decompensated liver cirrhosis patients with different etiologies， and female patients and patients with a younger age，a history of TIPS， a higher HGB level， and a higher CD4 lymphocyte count are more likely to experience recompensation. Recompensation is the key to improving the long-term prognosis of patients and can significantly reduce long-term liver disease-related mortality rate and the incidence rate of HCC.

Objective: To propose an improved method for constructing the internal quality control (IQC) framework for ELISA assays and validate its efficacy by statistically analyzing IQC data from nine blood center laboratories. Methods: 1) IQC data was collected from nine blood centers and analyzed using a domestic HBsAg ELISA detection kit as an example. 2) Differences between IQC values across batches within Blood Center 1 were assessed. 3) Statistical analyses were performed on batch usage, number of batches used, days of use, number of QC points, batch-specific means, and coefficients of variation (CV) across all nine centers. 4) Using the improved construction method for IQC framework, provisional and permanent frames were established for batches within Blood Center 1 and Blood Center 9, followed by outlier determination. Results: 1) Statistically significant differences were observed in IQC data between batches within Blood Center 1 (P<0.01). It is recommended that both the control material/reagents and the control chart framework be replaced simultaneously. 2) There were substantial differences among 9 blood centers regarding the control material/reagent lot numbers used, the number of QC runs per batch, and the QC values for identical lots. Therefore, individual laboratories should establish their own IQC chart frameworks. 3) The improved IQC framework construction method for ELISA assays is as follows: provisional frames are established via frame-shifting, using the pre-experimental mean and cumulative coefficient of variation (CV) from the preceding batch. For batches used >20 days with >20 QC points, permanent frames are constructed by aggregating in-control data accumulated over ≥20 days with ≥20 points to calculate cumulative mean and standard deviation. The provisional and permanent frames constructed by this method identified all 26 extreme outliers across Blood Centers 1 and 9 as out-of-control. Among the 218 general outliers, 10 were classified as normal by the provisional frames, while the remainder were designated as warnings or out-of-control. This method effectively monitors assay stability. Conclusion: Based on the statistical analysis of IQC practices across blood centers of varying scales, combined with the inherent characteristics of ELISA assays and the batch-to-batch instability of reagents/QC materials, it is recommended to reconstruct QC charts upon lot changes. The proposed method—utilizing frame-shifting for provisional frames and establishing permanent frames based on cumulative data—is applicable to blood center laboratories of differing sizes and effectively monitors the stability of the ELISA assay process.

Objective To analyze the epidemiologic burden of colorectal cancer in Xishan District, Kunming City, Yunnan Province from 2018 to 2020. Methods Indicators of epidemiologic burden were calculated, including incidence rate, mortality rate, age-specific incidence/mortality rates, potential years of life lost (PYLL), and disability-adjusted life years (DALY) based on the National Disease Control and Prevention Center’s "Cancer Information Registration and Reporting System" and "Cause of Death Registration System". Results From 2018 to 2020, the ASR (China) for the incidence of colorectal cancer in Xishan District, Kunming City increased from 25.27/10⁵ to 26.29/10⁵, while the ASR (China) for mortality decreased from 17.11/10⁵ to 16.03/10⁵. The PYLL in 2018–2020 were 1399.63, 1376.78, and 1571.56 person-years, respectively, whereas the DALY in 2018–2020 were 1927.74, 1875.05, and 1945.17 person-years, respectively. The morbidity, mortality, PYLL, and DALY were generally higher in males than in females over 45 years of age. Conclusion Given the parallel trends of persistent incidence risk and steadily declining mortality for colorectal cancer in Xishan District, Kunming City, a three-tier prevention and control system centered on "lifestyle intervention–regular screening–positive case tracking" should be established, with a focus on covering high-risk populations, particularly males over 45 years of age.

The Pharmacovigilance Guidelines for Clinical Application of Traditional Chinese Medicine Injections （hereinafter referred to as the Guidelines） were released by the China Association of Chinese Medicine， with the standard number T/CACM 1563.4—2024. It is the first specialized guideline in China on the approach to pharmacovigilance activities for the clinical application of traditional Chinese medicine injections （TCMIs）. The Guidelines were jointly developed by the Institute of Basic Research in Clinical Medicine， China Academy of Chinese Medical Sciences， along with 30 experts in TCM pharmacovigilance， clinical practice （TCM， as well as integrated traditional Chinese and Western medicine），and evidence-based medicine from across the country. This publication filled the gap in standard documents in this field， both domestically and internationally. The Guidelines were formulated according to GB/T1.1—2020 Directives for standardization—Part 1： Rules for the structure and drafting of standardizing documents， the WHO Handbook for Guideline Development，and other methodological norms. Based on international norms，national laws and regulations，and scientific research results in the field of pharmacovigilance， methods adopted included expert interviews，literature research，nominal group technique， and Delphi method. Then， key points for pharmacovigilance for TCM injections were summarized and clarified in the four critical sections of "monitoring"，"identification"，"assessment"，and "control". The development process of the Guidelines included project initiation， international registration， expert interviews， literature search， and evaluation. Based on the research results of these steps，a draft was formed and revised through multiple rounds of in-group expert discussion and peer evaluations by 56 external experts. After revisions by the working group based on the feedback， the final version was formed. The Guidelines came into effect on January 8，2024，providing suggestions and reference norms for pharmacovigilance in the clinical application of TCMIs. To further promote the application and popularization of the Guidelines and help pharmacovigilance personnel better understand the development process，this study elucidates the background，methodological framework，and key development steps of the Guidelines.

The theory of constitution in traditional Chinese medicine （TCM） has emerged as a new discipline in recent years. Constitution plays a vital role in the onset，progression，transformation，and prognosis of diseases. At present，some clinical scholars have adopted a novel diagnostic and treatment model of "constitution differentiation-disease identification-syndrome differentiation"，in which constitution is regarded as a core element throughout the diagnostic and therapeutic process. Constitution is closely associated with etiology，onset，pathogenesis，syndrome differentiation，and treatment. Against this background，the construction of animal models based on constitution holds far-reaching significance for advancing clinical research. This paper focuses on the construction and evaluation of rodent models with Qi-deficiency constitution，aiming to explore how to further induce Qi-deficiency syndromes and related disease states on the basis of Qi-deficiency constitution models，thereby developing an integrated animal model that embodies the trinity of "constitution-disease-syndrome". The establishment of this model not only provides a solid experimental foundation for the development of new therapies and drugs in TCM targeting specific constitutions，diseases，and syndromes，but also greatly promotes the modernization and scientific advancement of TCM theory. By comprehensively applying multidisciplinary technologies and methods，the study evaluates the model's validity，reliability，and practicality，with the aim of opening new avenues for future research in TCM and promoting the development of the field.