Diabetes mellitus（DM） is a globally prevalent chronic metabolic disease， and its hyperglycemia can lead to a series of serious complications. Although current DM treatments are effective， they still have side effects and limitations. Therefore， discovering new drugs has become a key approach to improving DM management. As a traditional Chinese medicine， Dendrobii Caulis has garnered significant attention due to its rich phytochemical properties， which may offer a natural approach to mitigate the harmful effects of DM. Studies have demonstrated that Dendrobii Caulis can significantly reduce blood glucose levels in diabetic animal models and improve insulin resistance. Modern pharmacological studies have shown that the hypoglycemic effect of Dendrobii Caulis is primarily based on multiple mechanisms， including improving insulin sensitivity， inhibiting liver glycogen breakdown， promoting liver glycogen synthesis， and reducing oxidative stress. In addition， polysaccharides in Dendrobii Caulis have been found to increase the serum level of glucagon-like peptide-1 （GLP-1）， which promotes insulin secretion and inhibits glucagon release， thereby improving the symptoms of DM and its complications. Given its potential hypoglycemic effect， Dendrobii Caulis is expected to be developed as a new hypoglycemic agent or health food with promising prospects for treating DM and its complications. With further basic and clinical research， Dendrobii Caulis is expected to become an important adjunct in DM treatment.

Corneal endothelial cells(CECs), which form the innermost cellular layer of the cornea, play a pivotal role in sustaining corneal transparency and preserving visual acuity. However, CECs are vulnerable to damage induced by a spectrum of pathological conditions or traumatic injuries. Once the density of CECs declines below a critical threshold, corneal endothelial dysfunction is precipitated, ultimately leading to corneal edema and progressive visual impairment. Penetrating keratoplasty and corneal endothelial transplantation remain the first-line therapeutic strategies for managing advanced corneal endothelial dysfunction. Nevertheless, the global shortage of donor corneas severely limits the accessibility and scalability of these surgical interventions. Consequently, regenerative medicine approaches targeting corneal endothelial repair and regeneration have emerged as a major focus of international research in ophthalmology. A key challenge in the in vitro expansion of CECs is their propensity to undergo endothelial-to-mesenchymal transition(EndMT). EndMT is a process of cellular phenotypic transformation, through which endothelial cells lose their intrinsic functions and acquire the characteristic features of mesenchymal cells. The EndMT significantly impedes the clinical translation of in vitro-cultured CECs for regenerative applications. In this review, the risk factors and related signaling pathways involved in EndMT were summarized, aiming to provide references for the basic research and clinical treatment of relevant diseases.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

OBJECTIVE To investigate the application status of prescription pre-review systems in healthcare institutions of Yunnan province， evaluate their system functions and management capabilities， and provide a practical basis for promoting rational drug use. METHODS A questionnaire survey was conducted among public healthcare institutions at or above the secondary level in Yunnan province to investigate the deployment status of the systems. A capability maturity assessment framework was constructed， encompassing 6 dimensions and 39 indicators， including real-time prescription review， prescription correlation review， rule setting， evidence-based information support， prescription authority management， and system operation management. This framework was then used to evaluate the institutions that had implemented the pre-review systems. RESULTS A total of 100 valid questionnaires were collected， with 37 institutions having adopted prescription pre-review systems， mainly tertiary hospitals. The system predominantly adopted a modular architecture and was embedded into the hospital information system through application programming interfaces and middleware， providing certain capabilities for real-time prescription risk identification. Evaluation results indicated that basic functions such as reviewing indications， contraindications， and drug compatibility performed well， while deficiencies remained in functions related to parenteral nutrition prescription， review of drug dosage for specific diseases， individual patient characteristic recognition， and rule setting. Moreover， the construction of review centers and establishment of management systems were also not well-developed. CONCLUSIONS The overall application rate of prescription pre-review systems in Yunnan province remains low. System functions and management mechanisms require further improvement. It is recommended to enhance information infrastructure in lower-level institutions and explore regionally unified review models to promote standardized and intelligent development of prescription review practices.

Objective: To understand the prevalence of myopia among primary and secondary school students in minority areas of Yunnan Province, and to explore the influence of outdoor activities and short-distance use of eyes, so as to provide a basis for early myopia intervention. Methods: In October 2020, the survey was conducted among 1 782 primary and secondary school students in three cities of Yunnan through a multi stage random cluster sampling method. All subjects underwent a questionnaire survey and the visual acuity examination at baseline. The first follow-up was conducted in October 2021 to obtain 1 691 valid samples, and the second follow-up was conducted in May 2023 to obtain 1 367 valid samples. Factors associated with myopia among primary and secondary school students were explored by using generalized estimating equations. Results: The prevalence rates of myopia in 2020, 2021 and 2023 were 52.64%, 61.62% and 69.35%, respectively, showing an increasing trend ( χ 2 trend =91.77, P <0.05). The results of multivariate regression analysis on the generalized estimation equations showed that age at baseline ( OR =1.31), girls ( OR =1.76), Hani ethnicity ( OR =0.75), Bai ethnicity ( OR =0.69), parental myopia ( OR =1.97-2.29), parents often reducing children s exercise time for homework or tutoring ( OR =1.35), less than 1 time or 2-3 times of ball sports per week ( OR =1.27, 1.20 ), reading and writing in the classroom during the break ( OR =1.27), reading in direct sunlight occasionally ( OR =1.20), using only desk lamp for writing at home ( OR =0.71), more than 1 hours of short-distance eye use for a break once ( OR =1.23) were associated with myopia among primary and secondary school students ( P <0.05). Conclusions Outdoor activities and short-distance use of eye among primary and middle school students in minority areas in Yunnan province are suboptimal. Enhancing the related environmental and behavioral factors can effectively mitigate the occurrence and progression of myopia.

ObjectiveTo explore the possible mechanism of Yigan Fupi Prescription （抑肝扶脾方， YFP） in treating diarrhea-type irritable bowel syndrome （IBS-D） by investigating the AKT/mTOR signaling pathway. MethodsSixty SD rats were randomly divided into control group， model group， YFP low-， medium-， and high-dose group， and pinaverium bromide group， with 10 rats in each group. All groups but the control group， were subjected to 21 days of tail-clamping stimulation and 14 days of senna leaf gavage to establish a liver stagnation and spleen deficiency-type IBS-D rat model. After successful modeling， the YFP low-， medium-， and high-dose group were administered 0.96， 1.93， and 3.87 g/（kg·d） of the prescription， respectively. The pinaverium bromide group was given 13.5 mg/（kg·d）， while the control and model groups were given 10 ml/（kg·d） distilled water. All groups were administered once daily for 14 consecutive days. General conditions of the rats were recorded during the experiment， and after modeling and drug administration， body weight， Bristol stool score， abdominal withdrawal reflex （AWR） score， and histo pathology of colon tissue were observed under HE staining. ELISA was used to detect serum levels of tumor necrosis factor α （TNF-α）， interleukin-1β （IL-1β）， and interleukin-6 （IL-6）. Immunofluorescence was employed to detect the levels of AKT/mTOR pathway-related proteins including phosphorylated AKT （p-AKT）/AKT and phosphorylated mTOR （p-mTOR）/mTOR in the colon tissue. Western Blotting was used to detect the levels of autophagy-related proteins， including UNC-51-like kinase 1 （ULK1）， Beclin1 and LC3， and tight junction proteins including Occludin and ZO-1 in the colon tissue. ResultsAfter modeling， compared to the control group， the body weight of rats in the other groups decreased， and Bristol stool scores， as well as AWR scores under 20， 40， 60， and 80 mmHg increased （P＜0.05 or P＜0.01）. After drug administration， compared to the control group， the model group showed reduced body weight， decreased ULK1， Beclin1， LC3Ⅱ/LC3Ⅰ， Occludin， and ZO-1 protein levels in the colon tissue （P＜0.05 or P＜0.01）， and increased Bristol stool scores， AWR scores， serum TNF-α， IL-1β， and IL-6 levels， as well as p-AKT/AKT and p-mTOR/mTOR protein relative expression levels （P＜0.05 or P＜0.01）. Pathological results showed a significant reduction in goblet cells in the upper part of the glandular layer of the colon， with mild inflammatory cell infiltration. The submucosal collagen fibers were dissolved， with unclear boundaries， pale staining， and microvascular congestion and dilation. Compared with the model group， the YFP low-， medium-， and high-dose group and the pinaverium bromide group showed increased body weight， Beclin1， Occludin， and LC3Ⅱ/LC3Ⅰ protein levels （P＜0.05 or P＜0.01）， and decreased Bristol stool scores， AWR scores under 40， 60， and 80 mmHg， serum IL-1β， IL-6， TNF-α levels， and p-AKT/AKT， p-mTOR/mTOR protein relative expression levels （P＜0.05 or P＜0.01）. The pathological morphology of the rats in the YFP groups and pinaverium bromide group showed varying degrees of improvement. Compared with the pinaverium bromide group， the YFP low- and medium-dose group showed increased AWR scores under 20， 40， and 60 mmHg （P＜0.05）. The YFP low-dose group had reduced TNF-α， IL-1β， and IL-6 levels， and increased p-mTOR/mTOR protein relative expression levels occured in all YFP groups （P＜0.05）. Compared with the YFP low-dose group， the YFP high-dose group and pinaverium bromide group showed decreased AWR scores under different pressure levels and reduced p-AKT/AKT protein relative expression levels， while the YFP medium- and high-dose group had elevated serum TNF-α， IL-1β levels and reduced p-mTOR/mTOR protein relative expression levels （P＜0.05）. ConclusionYFP can effectively improve the pathological injury of colon tissue in IBS-D model rats with liver stagnation and spleen deficiency， reduce Bristol stool and AWR scores， and its mechanism may be related to reducing level of inflammatory factors and inhibiting AKT/mTOR pathway-related proteins in colon tissue， thereby enhancing the expression of autophagy-related proteins in the colon tissue.

ObjectiveTo investigate the influencing factors for hepatic hydrothorax （HH） before intervention for primary hepatic carcinoma （PHC）， and to construct and assess the nomogram risk prediction model. MethodsA retrospective analysis was performed for the clinical data of 353 hospitalized patients who attended the Third People’s Hospital of Kunming for the first time from October 2012 to October 2021 and there diagnosed with PHC， and according to the presence or absence of HH， they were divided into HH group with 153 patients and non-HH group with 200 patients. General data and the data of initial clinical testing after admission were collected from all PHC patients. The independent-samples t test was used for comparison of normally distributed continuous data between two groups， and the Mann-Whitney U test was used for comparison of non-normally distributed continuous data between two groups； the chi-square test or the Fisher’s exact test was used for comparison of categorical data between groups. After the multicollinearity test was performed for the variables with statistical significance determined by the univariate analysis， the multivariate Logistic regression analysis was used to identify independent influencing factors. The “rms” software package was used to construct a nomogram risk prediction model， and the Hosmer-Lemeshow test and the receiver operating characteristic （ROC） curve were used to assess the risk prediction model； the “Calibration Curves” software package was used to plot the calibration curve， and the “rmda” software package was used to plot the clinical decision curve and the clinical impact curve. ResultsAmong the 353 patients with PHC， there were 153 patients with HH， with a prevalence rate of 43.34%. Child-Pugh class B （odds ratio ［OR］=2.652， 95% confidence interval ［CI］： 1.050 — 6.698， P=0.039）， Child-Pugh class C （OR=7.963， 95%CI： 1.046‍ ‍—‍ ‍60.632， P=0.045）， total protein （OR=0.947， 95%CI： 0.914‍ ‍—‍ ‍0.981， P=0.003）， high-sensitivity C-reactive protein （OR=1.007， 95%CI： 1.001‍ ‍—‍ ‍1.014， P=0.025）， and interleukin-2 （OR=0.801， 95%CI： 0.653‍ ‍—‍ ‍0.981， P=0.032） were independent influencing factors for HH before PHC intervention， and a nomogram risk prediction model was established based on these factors. The Hosmer-Lemeshow test showed that the model had a good degree of fitting （χ²=5.006， P=0.757）， with an area under the ROC curve of 0.752 （95%CI： 0.701‍ ‍—‍ ‍0.803）， a sensitivity of 78.40%， and a specificity of 63.50%. The calibration curve showed that the model had good consistency in predicting HH before PHC intervention， and the clinical decision curve and the clinical impact curve showed that the model had good clinical practicability within a certain threshold range. ConclusionChild-Pugh class， total protein， interleukin-2， and high-sensitivity C-reactive protein are independent influencing factors for developing HH before PHC intervention， and the nomogram model established based on these factors can effectively predict the risk of developing HH.

Transmembrane proteins (TMEM) are a type of membrane protein. Most proteins in this family are located in the phospholipid bilayer of the cell membrane, while a smaller portion is found in the membranes of cellular organelles. Transmembrane protein 43 (TMEM43) is a member of the TMEM protein family and is encoded by the TMEM43 gene. This protein consists of 400 amino acids and has 4 transmembrane domains and 1 membrane-associated domain. TMEM43 is localized to various biological membranes within the cell, such as the cell membrane and nuclear membrane, where it forms transmembrane channels for various ions. Additionally, TMEM43 is expressed in many species, showing high genetic similarity, especially with the four transmembrane domains being highly conserved. Current studies on the TMEM43 gene are still in its early stages, mainly focusing on its association with arrhythmogenic right ventricular cardiomyopathy (ARVC) and cancer. However, recent studies suggest that pathogenic mutations in TMEM43 may cause auditory neuropathy spectrum disorder (ANSD). Patients with TMEM43 p.Ser372Ter exhibited late-onset progressive ANSD. Impact of TMEM43 pathogenic mutations on individual hearing was likely mediated through effects on gap junction (GJ) structures on glia-like supporting cells (GLS), cell membranes. The TMEM43 p.Arg372Ter pathogenic mutation primarily affected the structure and function of TMEM43 protein, leading to premature termination of protein translation and the production of a truncated protein. Abnormal TMEM43 protein significantly reduced K⁺ influx in GLS cells, disrupting the endolymphatic K⁺ circulation and cochlear microenvironment homeostasis. When K⁺ circulation was obstructed, the endocochlear potential (EP) became abnormal, impairing the physiological function of hair cells and potentially leading to hearing impairment. However, it is important to note that studies on the mechanism is limited, and more experimental evidence is needed to confirm this hypothesis. Currently, there is a significant gap in research on TMEM43 and hearing loss, with many issues remaining unresolved. While TMEM43 has been studied in relation to hearing loss in humans, zebrafish, mice, and rats, the research is still preliminary. Detailed investigations into the molecular pathogenic mechanisms, the impact of mutations on hearing damage, and related therapeutic strategies are needed. Additionally, as a newly identified hearing loss-related gene, the mutation frequency and incidence of hearing disorders associated with TMEM43 have not been effectively quantified. For example, the ClinVar database listed 829 mutation sites for the TMEM43 gene, with only three mutations related to auditory neuropathy: c.605A>T (p.Asn202Ile), c.889T>A (p.Phe297Ile), and c.1114C>T (p.Arg372Ter). Aside from the aforementioned TMEM43 c.1114C>T (p.Arg372Ter) mutation observed in patients, the other two mutations were experimentally induced and have not been found in patients. Consequently, these mutations have been classified as unknown significance. We reviewed the current understanding of TMEM43 and hearing loss, analyzed its role in ear development and sound conduction, and explored the impact of TMEM43 gene variations on hearing loss, aiming to provide new insights for future research and precision medicine related to TMEM43.

Objective : To investigate the antidepressant effects and the underlying mechanisms of tetrahydrocurcumin(THC) and its nanoparticle formulation(THCN). Methods : Forty-six male ICR mice were randomly divided into Con group, LPS group, THC group, THCN group and SER group. A mouse depression model was established by intraperitoneal administration of LPS. The anxiety and depression-like behaviors of mice were evaluated by open field test(OFT) and forced swimming test(FST). Myelin staining was applied to assess the extent of demyelination in the prefrontal cortex of the mice. The prefrontal cortex and hippocampus were further examined for the expression levels of glial fibrillary acidic protein(GFAP) and Toll-like receptor 4(TLR4) through quantitative immunofluorescence assays. Results : Compared with the Con group, the LPS group showed increased anxiety-like and depressive-like behaviors in both the long-term and short-term experiments(P<0.05); the degree of demyelination increased in the LPS group of the long-term experiment(P<0.01); the expression of GFAP was reduced in the LPS group of the short-term experiment(P<0.01), while the expression of TLR4 increased(P<0.05); the expression of TLR4 decreased in the THC group(P<0.01); the expression of GFAP in the prefrontal cortex of the THCN group was reduced(P<0.01), while the expression of TLR4 increased(P<0.05). Compared with the LPS group, the THC group showed reduced depressive-like behaviors in the long-term experiment(P<0.05), while the anxiety-like and depressive-like behaviors of the THCN group and the SER group were reduced(P<0.05), and the anxiety-like and depressive-like behaviors of the THC group and the THCN group were reduced in the short-term experiment(P<0.05); the degree of demyelination was reduced in the THC group, THCN group and SER group in the long-term experiment(P<0.05); the expression of GFAP increased in the THC group of the short-term experiment(P<0.05), while the expression of TLR4 was reduced(P<0.05), and the expression of GFAP increased in the THCN group(P<0.05). Compared with the THC group, the THCN group and the SER group showed reduced anxiety-like behaviors in the long-term experiment(P<0.05); the expression of GFAP in the prefrontal cortex of the THCN group was reduced in the short-term experiment(P<0.05), while the expression of TLR4 in the hippocampal DG area increased in the short-term experiment(P<0.01). Conclusion Tetrahydrocurcumin and its nanoparticle formulation both exert significant ameliorative effects on depression-like behaviors and demyelination in mice induced by lipopolysaccharide. The antidepressant mechanism of THC appears to be mediated through the down-regulation of TLR4 and the up-regulation of GFAP. The mechanism underlying the antidepressant action of THCN seems predominantly focused on the enhancement of GFAP expression.

ObjectiveTo investigate the influencing factors for recompensation in patients with decompensated hepatitis C cirrhosis， and to establish a predictive model. MethodsA total of 217 patients who were diagnosed with decompensated hepatitis C cirrhosis and were admitted to The Third People’s Hospital of Kunming l from January， 2019 to December， 2022 were enrolled， among whom 63 patients who were readmitted within at least 1 year and had no portal hypertension-related complications were enrolled as recompensation group， and 154 patients without recompensation were enrolled as control group. Related clinical data were collected， and univariate and multivariate analyses were performed for the factors that may affect the occurrence of recompensation. The independent-samples t test was used for comparison of normally distributed measurement data between two groups， and the Mann-Whitney U test was used for comparison of non-normally distributed measurement data between two groups； the chi-square test or the Fisher’s exact test was used for comparison of categorical data between two groups. A binary Logistic regression analysis was used to investigate the influencing factors for recompensation in patients with decompensated hepatitis C cirrhosis， and the receiver operating characteristic （ROC） curve was used to assess the predictive performance of the model. ResultsAmong the 217 patients with decompensated hepatitis C cirrhosis， 63 （29.03%） had recompensation. There were significant differences between the recompensation group and the control group in HIV history （χ²=4.566， P=0.034）， history of partial splenic embolism （χ²=6.687， P=0.014）， Child-Pugh classification （χ²=11.978， P=0.003）， grade of ascites （χ²=14.229， P<0.001）， albumin （t=4.063， P<0.001）， prealbumin （Z=-3.077， P=0.002）， high-density lipoprotein （t=2.854， P=0.011）， high-sensitivity C-reactive protein （Z=-2.447， P=0.014）， prothrombin time （Z=-2.441， P=0.015）， carcinoembryonic antigen （Z=-2.113， P=0.035）， alpha-fetoprotein （AFP） （Z=-2.063， P=0.039）， CA125 （Z=-2.270， P=0.023）， TT3 （Z=-3.304， P<0.001）， TT4 （Z=-2.221， P=0.026）， CD45⁺ （Z=-2.278， P=0.023）， interleukin-5 （Z=-2.845， P=0.004）， tumor necrosis factor-α （Z=-2.176， P=0.030）， and portal vein width （Z=-5.283， P=0.005）. The multivariate analysis showed that history of partial splenic embolism （odds ratio ［OR］=3.064， P=0.049）， HIV history （OR=0.195， P=0.027）， a small amount of ascites （OR=3.390， P=0.017）， AFP （OR=1.003， P=0.004）， and portal vein width （OR=0.600， P<0.001） were independent influencing factors for the occurrence of recompensation in patients with decompensated hepatitis C cirrhosis. The ROC curve analysis showed that HIV history， grade of ascites， history of partial splenic embolism， AFP， portal vein width， and the combined predictive model of these indices had an area under the ROC curve of 0.556， 0.641， 0.560， 0.589， 0.745， and 0.817， respectively. ConclusionFor patients with decompensated hepatitis C cirrhosis， those with a history of partial splenic embolism， a small amount of ascites， and an increase in AFP level are more likely to experience recompensation， while those with a history of HIV and an increase in portal vein width are less likely to experience recompensation.