Diabetes mellitus（DM） is a globally prevalent chronic metabolic disease， and its hyperglycemia can lead to a series of serious complications. Although current DM treatments are effective， they still have side effects and limitations. Therefore， discovering new drugs has become a key approach to improving DM management. As a traditional Chinese medicine， Dendrobii Caulis has garnered significant attention due to its rich phytochemical properties， which may offer a natural approach to mitigate the harmful effects of DM. Studies have demonstrated that Dendrobii Caulis can significantly reduce blood glucose levels in diabetic animal models and improve insulin resistance. Modern pharmacological studies have shown that the hypoglycemic effect of Dendrobii Caulis is primarily based on multiple mechanisms， including improving insulin sensitivity， inhibiting liver glycogen breakdown， promoting liver glycogen synthesis， and reducing oxidative stress. In addition， polysaccharides in Dendrobii Caulis have been found to increase the serum level of glucagon-like peptide-1 （GLP-1）， which promotes insulin secretion and inhibits glucagon release， thereby improving the symptoms of DM and its complications. Given its potential hypoglycemic effect， Dendrobii Caulis is expected to be developed as a new hypoglycemic agent or health food with promising prospects for treating DM and its complications. With further basic and clinical research， Dendrobii Caulis is expected to become an important adjunct in DM treatment.

Corneal endothelial cells(CECs), which form the innermost cellular layer of the cornea, play a pivotal role in sustaining corneal transparency and preserving visual acuity. However, CECs are vulnerable to damage induced by a spectrum of pathological conditions or traumatic injuries. Once the density of CECs declines below a critical threshold, corneal endothelial dysfunction is precipitated, ultimately leading to corneal edema and progressive visual impairment. Penetrating keratoplasty and corneal endothelial transplantation remain the first-line therapeutic strategies for managing advanced corneal endothelial dysfunction. Nevertheless, the global shortage of donor corneas severely limits the accessibility and scalability of these surgical interventions. Consequently, regenerative medicine approaches targeting corneal endothelial repair and regeneration have emerged as a major focus of international research in ophthalmology. A key challenge in the in vitro expansion of CECs is their propensity to undergo endothelial-to-mesenchymal transition(EndMT). EndMT is a process of cellular phenotypic transformation, through which endothelial cells lose their intrinsic functions and acquire the characteristic features of mesenchymal cells. The EndMT significantly impedes the clinical translation of in vitro-cultured CECs for regenerative applications. In this review, the risk factors and related signaling pathways involved in EndMT were summarized, aiming to provide references for the basic research and clinical treatment of relevant diseases.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

OBJECTIVE To investigate the application status of prescription pre-review systems in healthcare institutions of Yunnan province， evaluate their system functions and management capabilities， and provide a practical basis for promoting rational drug use. METHODS A questionnaire survey was conducted among public healthcare institutions at or above the secondary level in Yunnan province to investigate the deployment status of the systems. A capability maturity assessment framework was constructed， encompassing 6 dimensions and 39 indicators， including real-time prescription review， prescription correlation review， rule setting， evidence-based information support， prescription authority management， and system operation management. This framework was then used to evaluate the institutions that had implemented the pre-review systems. RESULTS A total of 100 valid questionnaires were collected， with 37 institutions having adopted prescription pre-review systems， mainly tertiary hospitals. The system predominantly adopted a modular architecture and was embedded into the hospital information system through application programming interfaces and middleware， providing certain capabilities for real-time prescription risk identification. Evaluation results indicated that basic functions such as reviewing indications， contraindications， and drug compatibility performed well， while deficiencies remained in functions related to parenteral nutrition prescription， review of drug dosage for specific diseases， individual patient characteristic recognition， and rule setting. Moreover， the construction of review centers and establishment of management systems were also not well-developed. CONCLUSIONS The overall application rate of prescription pre-review systems in Yunnan province remains low. System functions and management mechanisms require further improvement. It is recommended to enhance information infrastructure in lower-level institutions and explore regionally unified review models to promote standardized and intelligent development of prescription review practices.

ObjectiveThis paper aims to explore the in vitro anti-psoriasis activity and potential mechanism of Kangfuxin liquid （KFX liquid）， providing experimental evidence for the anti-psoriasis effect of KFX liquid. MethodsFirstly， the uninduced human immortalized keratinocyte cells （HaCaT cells） were divided into seven groups， namely the control group and KFX liquid groups with different doses （5， 10， 20， 40， 80， 160 g·L^-1）. After being treated with different concentrations of KFX liquid， the effect of KFX liquid on the normal cell proliferation was detected by using the cell counting kit-8 （CCK-8） method. Secondly， the uninduced HaCaT cells were divided into six groups， namely the control group and recombinant human interleukin-7A （rh-IL-7A） groups with different doses （5， 10， 50， 100， 120 g·L^-1）. After being treated with different concentrations of recombinant human interleukin-17A （rh IL-17A） liquid， the effect of rh IL-17A on cell proliferation was detected. The optimal induction concentration was screened. Then， normal HaCaT cells were divided into a control group and KFX liquid groups with different doses （5， 10， 20， 40， 80， 160 g·L^-1）. Except for the control group， the other groups established psoriasis cell models with the optimal induction concentration of rh IL-17A. After being treated with different concentrations of KFX liquid， the effects of KFX liquid on the psoriasis-like HaCaT cell proliferation were investigated. Finally， the uninduced HaCaT cells were divided into six groups， namely the control group， rh IL-17A group， methotrexate （MTX） group， and KFX liquid groups with different doses （20， 40， 80 g·L^-1）. Except for the control group， the other groups used the optimal induction concentration of rh IL-17A to establish psoriasis cell models. After being treated with different drugs， the cell migration levels were detected through scratch assays， and real-time quantitative polymerase chain reaction （Real-time PCR） was used to detect the relative mRNA expression levels of Ki-67 antigen （Ki67）， S100 calcium-binding protein A7 （S100A7）， S100 calcium-binding protein A8 （S100A8）， and S100 calcium-binding protein A9 （S100A9）， thereby comprehensively evaluating the in vitro anti-psoriasis activity of KFX liquid. By detecting the relative mRNA expression levels of interleukin-1β （IL-1β）， interleukin-6 （IL-6）， and chemokine-20 （CXCL-20） inflammatory-related factors in psoriasis-like HaCaT cells and the protein expression levels of Janus kinase 3 （JAK3）， phosphorylated Janus kinase 3 （p-JAK3）， signal transducer and activator of transcription 3 （STAT3）， and phosphorylated signal transducer and activator of transcription 3 （p-STAT3）， the mechanism was explored. ResultsCompared with that of control group， when treated with 80 g·L^-1 KFX liquid for 72 h （P<0.05） and at different times with 160 g·L^-1 KFX liquid， the HaCaT cell proliferation activity was significantly affected （P<0.01）， while the other concentrations of KFX liquid had no significant differences in cell morphology and cell proliferation activity at different times， indicating that the KFX liquid is relatively safe for HaCaT cells and has no obvious toxic side effects. Compared with that of control group， when treated with different concentrations of rh IL-17A for 24 h， the HaCaT cell proliferation activity was significantly enhanced， and the cell activity was the strongest when the concentration was 100 μg·L^-1 （P<0.05）， with a density close to 100% and intact cell morphology， indicating that 100 μg·L^-1 is the optimal concentration for inducing HaCaT cell proliferation. The results of the KFX liquid treatment on rh IL-17A-induced psoriasis-like cells show that the KFX liquid not only effectively inhibits the rh IL-17A-induced psoriasis-like HaCaT cell proliferation activity （P<0.01）， but also significantly reduces the migration ability of rh IL-17A-induced psoriasis-like HaCaT cells （P<0.01）， and the relative mRNA expression levels of Ki67， S100A7， S100A8， and S100A9 （P<0.01）. Moreover， the KFX liquid can significantly reduce the relative mRNA expression levels of IL-1β， IL-6， and CXCL-20 in rh IL-17A-induced psoriasis-like cells （P<0.01）， and significantly inhibit the phosphorylation levels of JAK3 and STAT3 proteins （P<0.05， P<0.01）. ConclusionThe KFX liquid has no obvious toxicity to uninduced HaCaT cells. It can inhibit rh IL-17A-induced psoriasis-like HaCaT cell proliferation， reduce the cell migration ability， and has good in vitro anti-psoriasis activity. Its action mechanism may be related to downregulating the expression levels of inflammation-related cytokines in the JAK3/STAT3 signaling pathway and inhibiting the phosphorylation levels of JAK3 and STAT3 proteins.

ObjectiveThis paper aims to explore the in vitro anti-psoriasis activity and potential mechanism of Kangfuxin liquid （KFX liquid）， providing experimental evidence for the anti-psoriasis effect of KFX liquid. MethodsFirstly， the uninduced human immortalized keratinocyte cells （HaCaT cells） were divided into seven groups， namely the control group and KFX liquid groups with different doses （5， 10， 20， 40， 80， 160 g·L^-1）. After being treated with different concentrations of KFX liquid， the effect of KFX liquid on the normal cell proliferation was detected by using the cell counting kit-8 （CCK-8） method. Secondly， the uninduced HaCaT cells were divided into six groups， namely the control group and recombinant human interleukin-7A （rh-IL-7A） groups with different doses （5， 10， 50， 100， 120 g·L^-1）. After being treated with different concentrations of recombinant human interleukin-17A （rh IL-17A） liquid， the effect of rh IL-17A on cell proliferation was detected. The optimal induction concentration was screened. Then， normal HaCaT cells were divided into a control group and KFX liquid groups with different doses （5， 10， 20， 40， 80， 160 g·L^-1）. Except for the control group， the other groups established psoriasis cell models with the optimal induction concentration of rh IL-17A. After being treated with different concentrations of KFX liquid， the effects of KFX liquid on the psoriasis-like HaCaT cell proliferation were investigated. Finally， the uninduced HaCaT cells were divided into six groups， namely the control group， rh IL-17A group， methotrexate （MTX） group， and KFX liquid groups with different doses （20， 40， 80 g·L^-1）. Except for the control group， the other groups used the optimal induction concentration of rh IL-17A to establish psoriasis cell models. After being treated with different drugs， the cell migration levels were detected through scratch assays， and real-time quantitative polymerase chain reaction （Real-time PCR） was used to detect the relative mRNA expression levels of Ki-67 antigen （Ki67）， S100 calcium-binding protein A7 （S100A7）， S100 calcium-binding protein A8 （S100A8）， and S100 calcium-binding protein A9 （S100A9）， thereby comprehensively evaluating the in vitro anti-psoriasis activity of KFX liquid. By detecting the relative mRNA expression levels of interleukin-1β （IL-1β）， interleukin-6 （IL-6）， and chemokine-20 （CXCL-20） inflammatory-related factors in psoriasis-like HaCaT cells and the protein expression levels of Janus kinase 3 （JAK3）， phosphorylated Janus kinase 3 （p-JAK3）， signal transducer and activator of transcription 3 （STAT3）， and phosphorylated signal transducer and activator of transcription 3 （p-STAT3）， the mechanism was explored. ResultsCompared with that of control group， when treated with 80 g·L^-1 KFX liquid for 72 h （P<0.05） and at different times with 160 g·L^-1 KFX liquid， the HaCaT cell proliferation activity was significantly affected （P<0.01）， while the other concentrations of KFX liquid had no significant differences in cell morphology and cell proliferation activity at different times， indicating that the KFX liquid is relatively safe for HaCaT cells and has no obvious toxic side effects. Compared with that of control group， when treated with different concentrations of rh IL-17A for 24 h， the HaCaT cell proliferation activity was significantly enhanced， and the cell activity was the strongest when the concentration was 100 μg·L^-1 （P<0.05）， with a density close to 100% and intact cell morphology， indicating that 100 μg·L^-1 is the optimal concentration for inducing HaCaT cell proliferation. The results of the KFX liquid treatment on rh IL-17A-induced psoriasis-like cells show that the KFX liquid not only effectively inhibits the rh IL-17A-induced psoriasis-like HaCaT cell proliferation activity （P<0.01）， but also significantly reduces the migration ability of rh IL-17A-induced psoriasis-like HaCaT cells （P<0.01）， and the relative mRNA expression levels of Ki67， S100A7， S100A8， and S100A9 （P<0.01）. Moreover， the KFX liquid can significantly reduce the relative mRNA expression levels of IL-1β， IL-6， and CXCL-20 in rh IL-17A-induced psoriasis-like cells （P<0.01）， and significantly inhibit the phosphorylation levels of JAK3 and STAT3 proteins （P<0.05， P<0.01）. ConclusionThe KFX liquid has no obvious toxicity to uninduced HaCaT cells. It can inhibit rh IL-17A-induced psoriasis-like HaCaT cell proliferation， reduce the cell migration ability， and has good in vitro anti-psoriasis activity. Its action mechanism may be related to downregulating the expression levels of inflammation-related cytokines in the JAK3/STAT3 signaling pathway and inhibiting the phosphorylation levels of JAK3 and STAT3 proteins.

Diabetic nephropathy（DN） is a common and severe microvascular complication of diabetes. In recent years， the classical herbal formula Shenqi dihuang decoction has demonstrated unique advantages in the clinical treatment of DN. This article conducts a systematic review of the mechanisms of action and clinical applications of Shenqi dihuang decoction in the treatment of DN. It reveals that the mechanism by which this formula improves DN involves multi-target synergistic regulation. For instance, Shenqi dihuang decoction exerts multiple pharmacological effects by regulating signaling pathways including phosphatidy linostiol 3-kinase/protein kinase B， AMP-activated protein kinase/silent information regulator 1/forkhead box O1， and nuclear factor erythroid 2-related factor 2/heme oxygenase-1 pathways.These effects include regulating glucose and lipid metabolism， inhibiting oxidative stress， reducing inflammation， improving insulin resistance， modulating cell death （apoptosis/autophagy/ferroptosis/pyroptosis）， and preventing renal fibrosis. Existing clinical studies indicate that Shenqi dihuang decoction and its modified formulas， alone or in combination with other therapeutic methods， can significantly improve glucose and lipid metabolism， reduce proteinuria， and delay renal function decline in patients with DN. These effects are superior to those of Western medicines such as irbesartan， valsartan， and empagliflozin， and the treatment demonstrates good safety. Future research should leverage systems biology and artificial intelligence technologies to further elucidate the integrated mechanisms in the treatment of DN by Shenqi dihuang decoction， thereby advancing the precision and standardization of its clinical application.

ObjectiveThis study aims to systematically review the marketed traditional Chinese patent medicines for treating chronic gastritis （CG） in China. By analyzing their variety characteristics and prescription patterns， it seeks to provide references for clinical syndrome differentiation-based drug selection， treatment method optimization， and the design of high-quality clinical research. MethodsInformation on marketed traditional Chinese patent medicines for treating CG was collected. Microsoft Excel software was used to collate and statistically analyze representative drugs for each pathological stage， market status， syndrome types， and other contents. The Ancient and Modern Medical Case Cloud Platform （V2.3.9） was employed to analyze the formula composition patterns of standardized prescriptions. ResultsA total of 141 marketed traditional Chinese patent medicines for treating CG in China were included. Based on the disease's pathological progression， they can be classified into drugs for non-atrophic gastritis， atrophic gastritis， and precancerous lesions. Post-marketing research reveals that relevant evaluation is only conducted on 17 drugs， of which 2 involve pharmacoeconomic studies and 14 possess standardized evidence-based evidence. The primary dosage forms were capsules， granules， and tablets. From the 100 prescriptions screened according to inclusion/exclusion criteria， the varieties indicated for the stomach collateral stasis syndrome in atrophic gastritis accounted for the highest proportion. The main efficacy distributions were clearing heat， detoxifying， and relieving pain by promoting Qi circulation. Core drugs included Glycyrrhizae Radix et Rhizome， Paeoniae Radix Alba， and Aucklandiae Radix. Medicinal properties were predominantly warm and neutral. Flavors were mainly bitter， pungent， and sweet. The drugs primarily entered the spleen and stomach meridians. Analysis of the package inserts reveals that 67 products list "contraindications"， 110 include "precautions"， and 23 explicitly state "adverse reactions". ConclusionTraditional Chinese patent medicines for treating CG hold unique value in clinical practice. However， currently there are challenges such as insufficient clarity in syndrome type descriptions within package inserts and a relative lack of high-level evidence-based medical evidence， as well as pharmacoeconomic evaluations. Future efforts should focus on addressing these shortcomings by advancing research on syndrome characteristics and medication patterns based on syndrome differentiation， systematically conducting pharmacoeconomic evaluations， strengthening the accumulation of high-level evidence-based evidence， and， on this basis， improving patient medication adherence. This will comprehensively enhance the clinical application value and scientific connotation of this category of drugs.

Objective To analyze survival outcomes and influencing factors among patients with colorectal cancer in Yunnan Province. Methods Clinical data were retrospectively collected from 4 892 patients with colorectal cancer. Survival data were obtained through follow-up. Overall survival (OS) was calculated by using the Kaplan-Meier method. Univariate analysis was performed by applying the log-rank test. Meanwhile, multivariate analysis employed the Cox proportional hazards regression model. Results The 1-, 3-, 5-, and 10-year OS rates for the entire cohort were 91.90%, 74.40%, 64.40%, and 28.70%, respectively. Univariate analysis revealed that age, ethnicity, region, differentiation grade, TNM stage, clinical stage, metastatic status, histological type, and treatment modality (chemotherapy, radiotherapy, and surgery) were associated with patient prognosis (all P<0.05). Multivariate analysis identified age (HR=1.250), region (HR=1.262), differentiation grade (HR=0.761), clinical stage (HR=3.128), and treatment modality (chemotherapy, HR=0.644; radiotherapy, HR=1.605; surgery, HR=0.384) as independent factors affecting survival prognosis in patients with colorectal cancer (all P<0.001). Conclusion Age, region, clinical stage, and treatment modality are independent factors influencing survival among patients with colorectal cancer in Yunnan Province. In clinical practice, these factors should be integrated to develop individualized prevention and treatment strategies, thereby improving patient outcomes.

Objective Objective To analyze the potential spatial factors affecting the genetic differentiation of Oncomelania hupensis robertsoni in Yunnan Province. Methods A total of 13 administrative villages were selected from schistosomiasis-endemic areas of Yunnan Province as O. hupensis snail sampling sites. At least 200 snails were collected in each site, and the spatial variable data of each site were recorded, including longitude, latitude and altitude. Thirty active and Schistosoma japonicum uninfected O. hupensis snails were selected from each sampling site by means of the crawling method and the cercarial shedding method. Genomic DNA was extracted from O. hupensis snails. Following PCR amplification, purification of PCR amplification products and sequencing, the gene sequences of O. hupensis snail samples were spliced and edited using the DNAstar software and the NCBI database to yield the complete mitochondrial sequences of O. hupensis snails at each sampling site, and the mitochondrial genetic distance matrix of O. hupensis robertsoni was calculated at each sampling site. The geographical coordinates of each sampling site were marked using the software ArcGIS 10.2, and the straight-line geographical distance between each sampling site was calculated. The altitude difference, longitude difference and latitude difference between each sampling site were calculated using the Excel software, and the correlation between the mitochondrial genetic distance matrix of O. hupensis robertsoni and each spatial variable matrix was examined by using the Mantel test at 13 sampling sites in Yunnan Province. Results Among the 13 O. hupensis snail sampling sites in Yunnan Province, the largest mitochondrial genetic distance of O. hupensis robertsoni snail populations was seen between Anding Village, Nanjian Yi Autonomous County and Caizhuang Village, Midu County (26.244 2), and the largest geographical distance was seen between Dongyuan Village, Gucheng District and Cangling Village, Chuxiong County (272.64 km). The highest altitude difference was seen between Anding Village, Nanjian Yi Autonomous County and Dongyuan Village, Gucheng District (1 086.10 m), and the largest longitude difference was found between Qiandian Village, Eryuan County and Cangling Village, Chuxiong County (1.86°), while the largest latitude difference was measured between Leqiu Village, Nanjian Yi Autonomous County and Dongyuan Village, Gucheng District (1.81°). In addition, the mitochondrial genetic distance of O. hupensis robertsoni snail populations was positively correlated with altitude at 13 snail sampling sites in Yunnan Province (r = 0.542 8, P < 0.001), and showed no significant correlations with geographical distance (r = 0.093 4, P > 0.05), longitude (r = −0.199 5, P > 0.05) or latitude (r = 0.205 7, P > 0.05). Conclusion Altitude may be a potential spatial factor affecting the genetic differentiation of O. hupensis robertsoni in Yunnan Province.