1.Action Mechanism of Huamoyan Granules in Treatment of Knee Osteoarthritis Based on TRPV1/p38 MAPK Pathway
Jin ZHANG ; Lili YANG ; Canwen ZHENG ; Jing KANG ; Yanlei MA ; Yue SHI ; Lei LI ; Hongxu MENG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(4):79-89
ObjectiveThis paper aims to observe the protective effect of Huamoyan granules on knee osteoarthritis (KOA) and explore whether its protective effect is oriented toward an anti-inflammatory direction by regulation of macrophage polarization, which can effectively inhibit the progression of pathological inflammatory response, reduce the release of inflammatory pain mediators, and downregulate the protein expression level of transient receptor potential vanilloid 1 (TRPV1), so as to provide experimental evidence for its clinical application and investigate its action mechanism. MethodsAfter adaptive feeding, Sprague-Dawley (SD) rats were randomly divided into six groups: sham group, model group, celecoxib group, and high, medium, and low-dose synovitis granule groups (9.6, 4.8, 2.4 g·kg-1). The administration dose of celecoxib capsules was 20 mg·kg-1. There were 10 rats in the sham group and 12 rats in the model group and each administration group. A KOA animal model was established by means of intra-articular injection of sodium iodoacetate into the knee joint. From the 10th day of the experiment, each administration group was given intragastric administration at a dose of 10 mL·kg-1 for 4 weeks. General conditions of rats in each group were assessed daily. The pressure pain threshold (PPT) to mechanical stimulation and joint diameter were recorded. X-ray examination was performed on the right knee joints of rats for imaging analysis. Enzyme linked immunosorbent assay (ELISA) was performed to detect the tumor necrosis factor-α (TNF-α), serum interleukin-1β (IL-1β), and other pro-inflammatory cytokines in rat serum samples, as well as the expression levels of neurogenic inflammatory mediators such as nerve growth factor (NGF) and calcitonin gene-related peptide (CGRP). Histopathological changes in the knee joint synovial tissues were examined by hematoxylineosin (HE) staining. Safranin O-fast green staining was performed to observe and evaluate the degree of knee cartilage lesions. Western blot was employed to quantitatively analyze TRPV1, p38 mitogen-activated protein kinase (p38 MAPK), and phosphorylated (p)-p38 MAPK in rat knee synovial tissues. Immunofluorescence (IF) was used to measure and assess M1/M2 macrophage polarization. ResultsCompared with those in the sham group, the circumference and joint diameter of the right knee were markedly enlarged in the model group (P<0.01), while PPTs of rats showed a significant reduction (P<0.01). The contents of IL-1β, TNF-α, CGRP, and NGF in rats' serum were significantly elevated (P<0.01), and the synovial Krenn score was increased (P<0.01). The Mankin score of cartilage tissue was increased (P<0.01), and the protein expressions of TRPV1 and p-p38 MAPK/p38 MAPK were significantly upregulated (P<0.01). The experimental intervention significantly reduced the proportion of pro-inflammatory M1 macrophages in the total macrophage population (P<0.01), and the percentage of M2 macrophages was decreased (P<0.01). The M1/M2 macrophage ratio was significantly elevated (P<0.01). Knee joint diameters of all dose groups of Huamoyan granules and the celecoxib group were reduced (P<0.01) compared with those of the model group, and the PPT recovery speeds in the high and medium-dose groups of Huamoyan granules were more obvious (P<0.05). The contents of IL-1β, CGRP, and NGF in the rats' serum in all administration groups were significantly reduced (P<0.05, P<0.01), and the content of TNF-α in rats' serum was significantly reduced (P<0.01). All dose groups of Huamoyan granules demonstrated significant reductions in both synovial Krenn score (P<0.05, P<0.01) and protein expression of TRPV1 and p-p38 MAPK/p38 MAPK in rats' synovial tissues (P<0.01). The percentage of M1 macrophages in the synovial tissues of the celecoxib group and all dose groups of Huamoyan granules was decreased (P<0.01). The percentage of M2 macrophages was increased (P<0.05), and the M1/M2 ratio was decreased (P<0.01). ConclusionHuamoyan granules can alleviate the inflammatory response of KOA, reduce the release of inflammatory pain mediators, and downregulate TRPV1 protein expression by regulating macrophage polarization. Its mechanism may be related to the TRPV1/p38 MAPK signaling pathway, thereby achieving the effect of improving peripheral pain hypersensitivity in KOA.
2.Expert Consensus on Clinical Application of Qidong Yixin Oral Liquid
Changkuan FU ; Xiaochang MA ; Mingjun ZHU ; Yue DENG ; Hongxu LIU ; Mingxue ZHANG ; Ying CHEN ; Yan ZHOU ; Ling ZHANG ; Jianhua FU ; Wei YANG ; Yu'er HU ; Ming CHEN ; Yanming XIE ; Yuanyuan LI
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(4):147-158
The prescription of Qidong Yixin oral liquid is derived from the experience of national medical master Ren Jixue in treating viral myocarditis (VMC). It has the functions of tonifying Qi, nourishing the heart,calming the mind, and relieving palpitations. It is used to treat VMC and angina pectoris of coronary heart disease caused by deficiency of both Qi and Yin. However,the understanding of its efficacy evidence, advantageous aspects, dosage and administration, and medication safety remains insufficient in clinical practice. Therefore,the development of the Expert Consensus on the Clinical Application of Qidong Yixin Oral Liquid (hereinafter referred to as consensus) was initiated. Consensus strictly followed the process and methods of the expert consensus on the clinical application of Chinese patent medicines of the China Association of Chinese Medicine,successively completing multiple tasks such as the consensus project initiation,determination of clinical problems,evidence search and evaluation,formation of recommendation opinions and consensus suggestions,solicitation of opinions,peer review, submission for review and release, and so on. Consensus formed a total of 10 recommendation opinions and 12 consensus suggestions,clarifying the clinical positioning,efficacy advantages,syndrome differentiation,dosage and administration,combination therapy,timing of medication,adverse reactions,contraindications, and precautions of Qidong Yixin oral liquid,indicating that it has good clinical advantages and safety in the treatment of VMC and angina pectoris of coronary heart disease,providing norms and references for physicians to safely and rationally apply Qidong Yixin oral liquid. Consensus was reviewed and approved for release by the Standardization Office of the China Association of Chinese Medicine on December 23, 2024. Standard number:GSCACM-376-2024.
3.Clinical comprehensive evaluation of 16 commonly used kinds of enteral nutrition preparations in Hebei province
Zhihan ZHANG ; Yue CHENG ; Lamei XU ; Qingsong LI ; Yuan GAO ; Congxin LI ; Shuqing GAO
China Pharmacy 2026;37(3):281-287
OBJECTIVE To comprehensively evaluate the 16 commonly used kinds of enteral nutrition preparations in Hebei province, aiming to provide a reference for the selection of drugs in medical institutions and clinical drug decision-making. METHODS Based on the Quick Guide for Drug Evaluation and Selection in Chinese Medical Institutions (the Second Edition), evaluation evidence was collected, and the included drugs were scored and evaluated from four dimensions of pharmaceutical characteristics, clinical characteristics, economy and other attributes. RESULTS & CONCLUSIONS The scores for Enteral nutritional emulsion (TPF-T), Enteral nutritional emulsion (TPF-D), Enteral nutritional emulsion (TPF), Enteral nutritional emulsion (TPF-HE), Enteral nutritional emulsion (TP), Enteral nutritional emulsion (SP), Enteral nutritional suspension (TPF) (1.5 kcal/mL, 1 kcal=4.184 kJ), Enteral nutritional suspension (TPF) (1.0 kcal/mL), Intact protein enteral nutrition (powder), Enteral nutritional suspension (TPF-DM), Enteral nutritional suspension (TPF-MCT), Enteral nutritional suspension (SP), Short- peptide enteral nutrition, Enteral nutritional powder (TP), Enteral nutritional suspension (TPF-D) and Enteral nutritional suspension (TPF-FOS) were 82.9, 84.1, 84.1, 86.1, 78.4, 79.1, 82.6, 82.3, 82.4, 80.2, 83.0, 82.4, 82.1, 85.7, 76.0, 82.4 points, respectively. All medications scored above 70 points. In practice, appropriate drugs can be selected according to clinical requirements and patient needs.
4.A Review of Methods for Establishing and Evaluating Animal Models of Stroke
Yunrong YANG ; Wenyu WU ; Yue TAN ; Guofeng YAN ; Yao LI ; Jin LU
Laboratory Animal and Comparative Medicine 2026;46(1):94-106
Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.
5.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
6.Protection of exosomes derived from bone marrow mesenchymal stem cells of different mouse ages on radiation-induced lung injury
Tingting ZHANG ; Yalong LI ; Haodi YUE ; Yanjun LI ; Xiwen GENG ; Yuwei ZHANG ; Xiaozhuan LIU
Chinese Journal of Tissue Engineering Research 2026;30(1):1-9
BACKGROUND:Mesenchymal stem cells show extremely therapeutic potential for radiation-induced lung injury through delivering exosomes.Age is a primary factor affecting the function and biological efficacy of mesenchymal stem cells.OBJECTIVE:To investigate the protective effects of exosomes derived from bone marrow mesenchymal stem cells of different mouse ages on radiation-induced lung injury in mice.METHODS:Bone marrow mesenchymal stem cells of young mice and old mice were obtained by whole bone marrow adherent culture.The exosomes were isolated from the supernatant of passage 3 bone marrow mesenchymal stem cells.Ten 2-month-old C57BL/6J mice were randomly selected as the control group after anesthesia and not irradiated.The remaining 30 2-month-old C57BL/6J mice were used to establish a mouse radiation-induced lung injury model and were randomly divided into three groups.Exosomes derived from bone marrow mesenchymal stem cells of young mice,exosomes derived from bone marrow mesenchymal stem cells of old mice,and PBS were injected through the tail vein,respectively.The survival rate of mice was monitored.The lung function,lung inflammation and fibrosis were assessed at 1 and 12 weeks after irradiation.RESULTS AND CONCLUSION:(1)The concentrations of particles and proteins in exosomes derived from bone marrow mesenchymal stem cells of young mice were higher than those in exosomes derived from bone marrow mesenchymal stem cells of old mice.(2)Compared with the control group,the survival rate of mice in the PBS group was low,and lung inflammation was obvious at week 1 after irradiation,and the levels and mRNA expressions of interleukin-1β,interleukin-6,and tumor necrosis factor-α were increased.Collagen deposition in lung tissues was observed at week 12 after irradiation,and the mRNA level of E-cadherin was decreased,while the mRNA levels of α-smooth muscle actin,transforming growth factor-β1,and β-catenin were increased.(3)Compared with the PBS group,the survival rate of mice in the exosome group was significantly improved,and the level of proinflammatory factors and their mRNA expression were reduced at week 1 after irradiation,the mRNA level of E-cadherin was increased,and the mRNA levels of α-smooth muscle actin,transforming growth factor β1 and β-catenin were reduced at week 12 after irradiation.(4)Among all the above indicators,the therapeutic effect of exosomes derived from bone marrow mesenchymal stem cells of young mice was better than that of exosomes derived from bone marrow mesenchymal stem cells of old mice.(5)The results showed that exosomes derived from bone marrow mesenchymal stem cells of young mice contained more particles and proteins,and the effect of alleviating early inflammation and late fibrosis of radiation-induced lung injury in mice was better than that of exosomes derived from bone marrow mesenchymal stem cells of old mice.
7.Pharmacodynamic Substances and Mechanisms of Xinglou Chengqi Tang in Treating Post-stroke Complications: A Review
Yujin ZHANG ; Xiangzhuo LIU ; Zhouyang CHEN ; Zihao SONG ; Xinyi LIU ; Yizhi YAN ; Chaoya LI ; Yingyan FANG ; Shasha YANG ; Xueqin CHENG ; Zhou XIE ; Sijie TAN ; Peng ZENG ; Yue ZHANG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(1):327-337
Stroke is the leading cause of death and disability among adults in China, and its common complications include digestive system abnormalities, cognitive impairment, depression, stroke-associated pneumonia, and hemiplegia. The combination of traditional Chinese and Western medicine has great potential in treating post-stroke complications. Xinglou Chengqitang (XLCQT) is a representative prescription of alleviating the disease in the upper part by treating the lower part. It has definite therapeutic effect and high safety. Clinically, XLCQT is often used to treat stroke and its complications. However, the quantity and quality of clinical trials of XLCQT in treating post-stroke complications need to be improved. Additionally, since the basic research is weak, the material basis and multi-target mechanism for the efficacy of this prescription are unknown. This article reviews XLCQT in terms of the pharmacodynamic basis, medicinal properties, safety evaluation, and progress in clinical research and mechanisms in treating post-stroke complications. This article summarizes 22 key active ingredients of XLCQT in treating acute stroke complicated with syndrome of phlegm heat and fu-organ excess. Among these key active ingredients, resveratrol, kaempferol, luteolin, chrysoeriol, apigenin, (+)-catechin, and adenosine have good pharmacokinetic properties and high bioavailability. The mechanisms of XLCQT in treating post-stroke complications are complex, including inflammatory response, brain-gut axis, hypothalamic-pituitary-adrenal (HPA) axis, intestinal flora, neurotrophic factors, autophagy, oxidative stress, and free radical damage. This review helps to deeply understand the pharmacodynamic basis and mechanisms of XLCQT in treating post-stroke complications and provides a theoretical basis for the clinical application of XLCQT against post-stroke complications and the development of drugs.
8.Treatment of Liver Cancer by Intervening TGF-β Signaling Pathway with Traditional Chinese Medicine: A Review
Hao CHENG ; Haohao GUO ; Jun SUN ; Juan XUE ; Chunyan JI ; Shiyi LI ; Yuxue DING ; Huaqiang YUE
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(8):318-326
Liver cancer is one of the most common malignant tumors in the digestive system and ranks sixth among newly diagnosed malignant tumors worldwide. Transforming growth factor-β (TGF-β) regulates cell differentiation, proliferation, apoptosis, and other physiological and pathological mechanisms and exerts cancer-suppressive and pro-cancerous dual effects in the process of tumor development. In recent years, with the continuous exploration of the mechanism of liver cancer, it has been found that the conversion of the cancer-suppressive effect into a pro-cancerous effect of this pathway plays a key role in the development of liver cancer. Traditional Chinese medicine (TCM) provides a unique perspective for the classification, diagnosis, and treatment of liver cancer with its comprehensive regulatory effects of multi-components, multi-targets, and multi-pathways. This paper summarized that the cancer-suppressive mechanisms of the TGF-β signaling pathway included promoting cancer cell cycle arrest, apoptosis, autophagy, et al, while the pro-cancerous mechanisms included promoting cancer cell proliferation, invasion and metastasis, immunosuppression, angiogenesis, et al. The TCM compounds intervening this pathway were sorted out, including Jianpi Huayu compound, Fuyang Baoyuan compound, Yipi Yanggan compound, Fuzheng Jiedu compound, compound Astragalus and Salvia, Biejia Jianwan, Dahuang Zhechong pill, and Qingxiang powder. The single TCMs mainly included Schizocapsa plantaginea, Dendrobii Caulis, Gleditsia sinensis, and Dracaena cochinchinensis. The active ingredients of TCM are mainly concentrated on flavonoids, alkaloids, glycosides, phenolics, terpenoids, polysaccharides, and other kinds of compounds. At the same time, it summarized that the liver cancer inhibition mechanism of TCM by regulating this pathway mainly included promoting apoptosis of liver cancer cells, blocking the cell cycle, and inhibiting liver cancer cell proliferation, migration, invasion, angiogenesis, immune escape, etc. The mechanism aims to give full play to the advantages of TCM and precisely regulate the TGF-β signal, thereby exerting positive anti-tumor effects, opening up a new direction for the precise targeted treatment of liver cancer, and providing a scientific basis and a new strategy for the application of TCM in the treatment of liver cancer.
9.Treatment of Liver Cancer by Intervening TGF-β Signaling Pathway with Traditional Chinese Medicine: A Review
Hao CHENG ; Haohao GUO ; Jun SUN ; Juan XUE ; Chunyan JI ; Shiyi LI ; Yuxue DING ; Huaqiang YUE
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(8):318-326
Liver cancer is one of the most common malignant tumors in the digestive system and ranks sixth among newly diagnosed malignant tumors worldwide. Transforming growth factor-β (TGF-β) regulates cell differentiation, proliferation, apoptosis, and other physiological and pathological mechanisms and exerts cancer-suppressive and pro-cancerous dual effects in the process of tumor development. In recent years, with the continuous exploration of the mechanism of liver cancer, it has been found that the conversion of the cancer-suppressive effect into a pro-cancerous effect of this pathway plays a key role in the development of liver cancer. Traditional Chinese medicine (TCM) provides a unique perspective for the classification, diagnosis, and treatment of liver cancer with its comprehensive regulatory effects of multi-components, multi-targets, and multi-pathways. This paper summarized that the cancer-suppressive mechanisms of the TGF-β signaling pathway included promoting cancer cell cycle arrest, apoptosis, autophagy, et al, while the pro-cancerous mechanisms included promoting cancer cell proliferation, invasion and metastasis, immunosuppression, angiogenesis, et al. The TCM compounds intervening this pathway were sorted out, including Jianpi Huayu compound, Fuyang Baoyuan compound, Yipi Yanggan compound, Fuzheng Jiedu compound, compound Astragalus and Salvia, Biejia Jianwan, Dahuang Zhechong pill, and Qingxiang powder. The single TCMs mainly included Schizocapsa plantaginea, Dendrobii Caulis, Gleditsia sinensis, and Dracaena cochinchinensis. The active ingredients of TCM are mainly concentrated on flavonoids, alkaloids, glycosides, phenolics, terpenoids, polysaccharides, and other kinds of compounds. At the same time, it summarized that the liver cancer inhibition mechanism of TCM by regulating this pathway mainly included promoting apoptosis of liver cancer cells, blocking the cell cycle, and inhibiting liver cancer cell proliferation, migration, invasion, angiogenesis, immune escape, etc. The mechanism aims to give full play to the advantages of TCM and precisely regulate the TGF-β signal, thereby exerting positive anti-tumor effects, opening up a new direction for the precise targeted treatment of liver cancer, and providing a scientific basis and a new strategy for the application of TCM in the treatment of liver cancer.
10.Advances in perioperative nutritional management for patients with esophageal cancer
Zuyu ZHANG ; Bo YANG ; Rong NIU ; Jijun XUE ; Jian CHEN ; Dong LI ; Wentao ZHAO ; Wenfeng HAN ; Yue BAI
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2026;33(01):157-162
Esophageal cancer is a prevalent malignant tumor of the digestive tract in China, and radical surgery remains the cornerstone of its comprehensive treatment. However, multifactorial challenges such as postoperative gastrointestinal tract reconstruction, traumatic stress, and tumor-related metabolic disturbances render esophageal cancer patients highly susceptible to malnutrition. Perioperative nutritional support therapy plays a crucial role in enhancing surgical safety, improving clinical outcomes, and elevating patients' quality of life by regulating metabolic homeostasis, preserving organ function, and optimizing the immune microenvironment. This article reviews the mechanisms underlying malnutrition in esophageal cancer, methods for nutritional status assessment, and precision intervention pathways based on multi-omics evaluations. The aim is to strengthen clinicians' awareness of standardized perioperative nutritional management for esophageal cancer patients and promote its clinical implementation, thereby facilitating postoperative recovery and improving long-term quality of life.

Result Analysis
Print
Save
E-mail