1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Structural and Spatial Analysis of The Recognition Relationship Between Influenza A Virus Neuraminidase Antigenic Epitopes and Antibodies
Zheng ZHU ; Zheng-Shan CHEN ; Guan-Ying ZHANG ; Ting FANG ; Pu FAN ; Lei BI ; Yue CUI ; Ze-Ya LI ; Chun-Yi SU ; Xiang-Yang CHI ; Chang-Ming YU
Progress in Biochemistry and Biophysics 2025;52(4):957-969
ObjectiveThis study leverages structural data from antigen-antibody complexes of the influenza A virus neuraminidase (NA) protein to investigate the spatial recognition relationship between the antigenic epitopes and antibody paratopes. MethodsStructural data on NA protein antigen-antibody complexes were comprehensively collected from the SAbDab database, and processed to obtain the amino acid sequences and spatial distribution information on antigenic epitopes and corresponding antibody paratopes. Statistical analysis was conducted on the antibody sequences, frequency of use of genes, amino acid preferences, and the lengths of complementarity determining regions (CDR). Epitope hotspots for antibody binding were analyzed, and the spatial structural similarity of antibody paratopes was calculated and subjected to clustering, which allowed for a comprehensively exploration of the spatial recognition relationship between antigenic epitopes and antibodies. The specificity of antibodies targeting different antigenic epitope clusters was further validated through bio-layer interferometry (BLI) experiments. ResultsThe collected data revealed that the antigen-antibody complex structure data of influenza A virus NA protein in SAbDab database were mainly from H3N2, H7N9 and H1N1 subtypes. The hotspot regions of antigen epitopes were primarily located around the catalytic active site. The antibodies used for structural analysis were primarily derived from human and murine sources. Among murine antibodies, the most frequently used V-J gene combination was IGHV1-12*01/IGHJ2*01, while for human antibodies, the most common combination was IGHV1-69*01/IGHJ6*01. There were significant differences in the lengths and usage preferences of heavy chain CDR amino acids between antibodies that bind within the catalytic active site and those that bind to regions outside the catalytic active site. The results revealed that structurally similar antibodies could recognize the same epitopes, indicating a specific spatial recognition between antibody and antigen epitopes. Structural overlap in the binding regions was observed for antibodies with similar paratope structures, and the competitive binding of these antibodies to the epitope was confirmed through BLI experiments. ConclusionThe antigen epitopes of NA protein mainly ditributed around the catalytic active site and its surrounding loops. Spatial complementarity and electrostatic interactions play crucial roles in the recognition and binding of antibodies to antigenic epitopes in the catalytic region. There existed a spatial recognition relationship between antigens and antibodies that was independent of the uniqueness of antibody sequences, which means that antibodies with different sequences could potentially form similar local spatial structures and recognize the same epitopes.
3.Patient-reported health status vs . N-terminal pro-B-type natriuretic peptide levels in patients with acute heart failure.
Jingkuo LI ; Lubi LEI ; Wei WANG ; Yan LI ; Yanwu YU ; Boxuan PU ; Yue PENG ; Xiqian HUO ; Lihua ZHANG
Chinese Medical Journal 2025;138(22):2955-2962
BACKGROUND:
Changes in N-terminal pro-B-type natriuretic peptide (NT-proBNP) levels may not fully translate into patient-reported health status in patients with heart failure (HF). We aimed to evaluate the correlation between NT-proBNP levels and patient-reported health status changes at one month after discharge of patients, and their associations with risk of death and rehospitalization in patients with acute HF.
METHODS:
We used data from the China Patient-centered Evaluative Assessment of Cardiac Events Prospective Heart Failure Study (PEACE 5p-HF Study). Patient-reported health status was measured by the 12-item Kansas City Cardiomyopathy Questionnaire (KCCQ-12). Patients who were hospitalized for HF and completed the KCCQ-12 and NT-proBNP tests before and one month after discharge were eligible in our study. We stratified patients into different groups based on NT-proBNP levels (i.e., improved, stable, and deteriorated) and KCCQ-12 scores (i.e., not deteriorated and deteriorated). We also examined the associations of the joint NT-proBNP and KCCQ-12 change with the risk of one-year and four-year clinical outcomes.
RESULTS:
A total of 2461 patients were included in the analysis. The mean age was 64.06 ± 13.51 years, and 36.37% (895/2461) of the study population were female. Among patients with improved NT-proBNP levels, 115 (10.95%) patients had deteriorated KCCQ-12 scores. The correlation between the change in the KCCQ-12 score and NT-proBNP level was weak ( r2 = 0.002, P = 0.013). Stratification by changes in the KCCQ-12 score revealed subgroups with distinctive risks, such that patients with deteriorated KCCQ-12 scores in any of the NT-proBNP change groups exhibited an increased risk of one-year all-cause death than participants with not deteriorated KCCQ-12 scores in any of the NT-proBNP change groups. Patients with improved NT-proBNP levels and deteriorated KCCQ-12 scores presented greater risks of one-year all-cause death (hazard ratio [HR]: 2.45, 95% confidence interval [CI]: 1.34-4.48) than patients with stable NT-proBNP levels and not deteriorated KCCQ-12 scores (HR [95% CI], 1.77 [1.25-2.53]).
CONCLUSIONS:
A discrepancy between changes in NT-proBNP levels and KCCQ-12 scores was common. The change in NT-proBNP levels was not sufficient to characterize critical aspects related to HF during one month after discharge of patients. Changes in the KCCQ-12 score exhibit complementary information to NT-proBNP levels for the prediction of clinical outcomes in patients with acute HF.
REGISTRATION
www.clinicaltrials.gov (No. NCT02878811).
Aged
;
Female
;
Humans
;
Male
;
Middle Aged
;
Health Status
;
Heart Failure/metabolism*
;
Natriuretic Peptide, Brain/metabolism*
;
Peptide Fragments/metabolism*
;
Prospective Studies
4.Rapid discovery of drug-introduced multiple organ dysfunction via NIR-II fluorescent imaging.
Pu JIANG ; Ruihu SONG ; Yue HU ; Xin HE ; Zewei ZHANG ; Xuemei WEI ; Zhiming WANG ; De-An GUO ; Hao CHEN
Acta Pharmaceutica Sinica B 2025;15(8):4285-4299
The precise and rapid monitoring of multiple organ dysfunction is crucial in drug discovery. Traditional methods, such as pathological analysis, are often time-consuming and inefficient. Here, we developed a multiplexed near-infrared window two (NIR-II) fluorescent bioimaging method that allows for real-time, rapid, and quantitative assessment of multiple organ dysfunctions. Given that existing probes did not fully meet requirements, we synthesized a range of NIR-II hemicyanine dyes (HDs) with varying absorption and emission wavelengths. By modifying these dyes, we achieved high spatial and temporal resolution imaging of the liver, kidneys, stomach, and intestines. This method was further applied to investigate disorders induced by cisplatin, a drug known to cause gastric emptying issues along with liver and kidney injuries. By monitoring the metabolic rate of the dyes in these organs, we accurately quantified multi-organ dysfunction, which was also confirmed by gold-standard pathological analysis. Additionally, we evaluated the effects of five aristolochic acids (AAs) on multiple organ dysfunction. For the first time, we identified that AA-I and AA-II could cause gastric emptying disorders, which was further validated through transcriptomics analysis. Our study introduces a novel approach for the simultaneous monitoring of multi-organ dysfunction, which may significantly enhance the evaluation of drug side effects.
5.Neural Basis of Categorical Representations of Animal Body Silhouettes.
Neuroscience Bulletin 2025;41(2):211-223
Neural activities differentiating bodies versus non-body stimuli have been identified in the occipitotemporal cortex of both humans and nonhuman primates. However, the neural mechanisms of coding the similarity of different individuals' bodies of the same species to support their categorical representations remain unclear. Using electroencephalography (EEG) and magnetoencephalography (MEG), we investigated the temporal and spatial characteristics of neural processes shared by different individual body silhouettes of the same species by quantifying the repetition suppression of neural responses to human and animal (chimpanzee, dog, and bird) body silhouettes showing different postures. Our EEG results revealed significant repetition suppression of the amplitudes of early frontal/central activity at 180-220 ms (P2) and late occipitoparietal activity at 220-320 ms (P270) in response to animal (but not human) body silhouettes of the same species. Our MEG results further localized the repetition suppression effect related to animal body silhouettes in the left supramarginal gyrus and left frontal cortex at 200-440 ms after stimulus onset. Our findings suggest two neural processes that are involved in spontaneous categorical representations of animal body silhouettes as a cognitive basis of human-animal interactions.
Humans
;
Animals
;
Male
;
Electroencephalography
;
Magnetoencephalography
;
Female
;
Young Adult
;
Adult
;
Pattern Recognition, Visual/physiology*
;
Brain Mapping
;
Photic Stimulation
;
Brain/physiology*
;
Dogs
6.Neural Tracking of Race-Related Information During Face Perception.
Chenyu PANG ; Na ZHOU ; Yiwen DENG ; Yue PU ; Shihui HAN
Neuroscience Bulletin 2025;41(11):1957-1976
Previous studies have identified two group-level processes, neural representations of interracial between-group difference and intraracial within-group similarity, that contribute to the racial categorization of faces. What remains unclear is how the brain tracks race-related information that varies across different faces as an individual-level neural process involved in race perception. In three studies, we recorded functional MRI signals when Chinese adults performed different tasks on morphed faces in which proportions of pixels contributing to perceived racial identity (Asian vs White) and expression (pain vs neutral) varied independently. We found that, during a pain expression judgment task, tracking other-race and same-race-related information in perceived faces recruited the ventral occipitotemporal cortices and medial prefrontal/anterior temporal cortices, respectively. However, neural tracking of race-related information tended to be weakened during explicit race judgments on perceived faces. During a donation task, the medial prefrontal activity also tracked race-related information that distinguished between two perceived faces for altruistic decision-making and encoded the Euclidean distance between the two faces that predicted decision-making speeds. Our findings revealed task-dependent neural mechanisms underlying the tracking of race-related information during face perception and altruistic decision-making.
Adult
;
Female
;
Humans
;
Male
;
Young Adult
;
Brain/diagnostic imaging*
;
Brain Mapping
;
Decision Making/physiology*
;
Facial Recognition/physiology*
;
Judgment/physiology*
;
Magnetic Resonance Imaging
;
Photic Stimulation
;
Racial Groups
;
Social Perception
;
East Asian People
7.Natural polyphenols as novel interventions for aging and age-related diseases: Exploring efficacy, mechanisms of action and implications for future research.
Wenze WU ; Yan MI ; Qingqi MENG ; Ning LI ; Wei LI ; Pu WANG ; Yue HOU
Chinese Herbal Medicines 2025;17(2):279-291
Natural polyphenols are a group of components widely found in traditional Chinese medicines and have been demonstrated to delay or prevent the development of aging and age-related diseases in recent years. As far as we know, the studies of natural polyphenols in aging and aging-related diseases have never been extensively reviewed. In the present paper, we reviewed recent advances of natural polyphenols in aging and common age-related diseases and the current technological methods to improve the bioavailability of natural polyphenols. The results showed that natural polyphenols have the potential to prevent or treat aging and common age-related diseases through multiple mechanisms. Nanotechnology, structural modifications, and matrix processing could provide strong technical support for the development of natural polyphenols to prevent or treat aging and age-related diseases. In conclusion, natural polyphenols have important potential in the prevention and treatment of aging and age-related diseases.
8.Advances in prevention,treatment and nursing of anastomotic leakage following laparoscopic colorectal cancer surgery
Xi PU ; Yue WEN ; Chunyan LU
Journal of Clinical Medicine in Practice 2025;29(2):143-148
Colorectal cancer is one of the common malignancies of the digestive system.Laparo-scopic surgery,as a minimally invasive procedure,has advantages such as minimal trauma,rapid re-covery,and shortened hospital stay,gradually becoming a main choice for treatment of digestive system diseases.However,anastomotic leakage remains one of the serious complications following this surger-y,impacting patients'recovery and prognosis.This review aimed to summarize and analyze recent re-search on anastomotic leakage after laparoscopic colorectal cancer surgery,exploring its pathogenesis,risk factors,preventive strategies,treatment and nursing measures,in order to provide a scientific ba-sis and guidance for clinical practice.
9.Investigation on efficacy against hepatocellular carcinoma of novel antisense oligonucleotide targeting IGF1R mRNA encapsulated with neutral cytidinyl/cationic lipid in vitro
Yang PU ; Jing GUAN ; Qian-yi HE ; Yue-jie ZHU ; De-lin PAN ; Zhu GUAN ; Zhen-jun YANG
Acta Pharmaceutica Sinica 2024;59(5):1441-1448
Antisense oligonucleotides are a type of gene therapy that targets mRNA and inhibits gene expression. They have been applied in the treatment of various diseases, but there are still problems with poor enzyme stability and high dosage
10.GRK2-YAP signaling is implicated in pulmonary arterial hypertension development
Peng YE ; Yunfei DENG ; Yue GU ; Pengfei LIU ; Jie LUO ; Jiangqin PU ; Jingyu CHEN ; Yu HUANG ; Nanping WANG ; Yong JI ; Shaoliang CHEN
Chinese Medical Journal 2024;137(7):846-858
Background::Pulmonary arterial hypertension (PAH) is characterized by excessive proliferation of small pulmonary arterial vascular smooth muscle cells (PASMCs), endothelial dysfunction, and extracellular matrix remodeling. G protein-coupled receptor kinase 2 (GRK2) plays an important role in the maintenance of vascular tone and blood flow. However, the role of GRK2 in the pathogenesis of PAH is unknown.Methods::GRK2 levels were detected in lung tissues from healthy people and PAH patients. C57BL/6 mice, vascular smooth muscle cell-specific Grk2-knockout mice ( Grk2?SM22), and littermate controls ( Grk2flox/flox) were grouped into control and hypoxia mice ( n = 8). Pulmonary hypertension (PH) was induced by exposure to chronic hypoxia (10%) combined with injection of the SU5416 (cHx/SU). The expression levels of GRK2 and Yes-associated protein (YAP) in pulmonary arteries and PASMCs were detected by Western blotting and immunofluorescence staining. The mRNA expression levels of Grk2 and Yes-associated protein ( YAP) in PASMCs were quantified with real-time polymerase chain reaction (RT-PCR). Wound-healing assay, 3-(4,5)-dimethylthiahiazo (-z-y1)-3,5-di-phenytetrazoliumromide (MTT) assay, and 5-Ethynyl-2′-deoxyuridine (EdU) staining were performed to evaluate the proliferation and migration of PASMCs. Meanwhile, the interaction among proteins was detected by immunoprecipitation assays. Results::The expression levels of GRK2 were upregulated in the pulmonary arteries of patients with PAH and the lungs of PH mice. Moreover, cHx/SU-induced PH was attenuated in Grk2?SM22 mice compared with littermate controls. The amelioration of PH in Grk2?SM22 mice was accompanied by reduced pulmonary vascular remodeling. In vitro study further confirmed that GRK2 knock-down significantly altered hypoxia-induced PASMCs proliferation and migration, whereas this effect was severely intensified by overexpression of GRK2. We also identified that GRK2 promoted YAP expression and nuclear translocation in PASMCs, resulting in excessive PASMCs proliferation and migration. Furthermore, GRK2 is stabilized by inhibiting phosphorylating GRK2 on Tyr86 and subsequently activating ubiquitylation under hypoxic conditions. Conclusion::Our findings suggest that GRK2 plays a critical role in the pathogenesis of PAH, via regulating YAP expression and nuclear translocation. Therefore, GRK2 serves as a novel therapeutic target for PAH treatment.

Result Analysis
Print
Save
E-mail