ObjectiveThis paper aims to observe the protective effect of Huamoyan granules on knee osteoarthritis （KOA） and explore whether its protective effect is oriented toward an anti-inflammatory direction by regulation of macrophage polarization， which can effectively inhibit the progression of pathological inflammatory response， reduce the release of inflammatory pain mediators， and downregulate the protein expression level of transient receptor potential vanilloid 1 （TRPV1）， so as to provide experimental evidence for its clinical application and investigate its action mechanism. MethodsAfter adaptive feeding， Sprague-Dawley （SD） rats were randomly divided into six groups： sham group， model group， celecoxib group， and high， medium， and low-dose synovitis granule groups （9.6， 4.8， 2.4 g·kg^-1）. The administration dose of celecoxib capsules was 20 mg·kg^-1. There were 10 rats in the sham group and 12 rats in the model group and each administration group. A KOA animal model was established by means of intra-articular injection of sodium iodoacetate into the knee joint. From the 10^th day of the experiment， each administration group was given intragastric administration at a dose of 10 mL·kg^-1 for 4 weeks. General conditions of rats in each group were assessed daily. The pressure pain threshold （PPT） to mechanical stimulation and joint diameter were recorded. X-ray examination was performed on the right knee joints of rats for imaging analysis. Enzyme linked immunosorbent assay （ELISA） was performed to detect the tumor necrosis factor-α （TNF-α）， serum interleukin-1β （IL-1β）， and other pro-inflammatory cytokines in rat serum samples， as well as the expression levels of neurogenic inflammatory mediators such as nerve growth factor （NGF） and calcitonin gene-related peptide （CGRP）. Histopathological changes in the knee joint synovial tissues were examined by hematoxylineosin （HE） staining. Safranin O-fast green staining was performed to observe and evaluate the degree of knee cartilage lesions. Western blot was employed to quantitatively analyze TRPV1， p38 mitogen-activated protein kinase （p38 MAPK）， and phosphorylated （p）-p38 MAPK in rat knee synovial tissues. Immunofluorescence （IF） was used to measure and assess M1/M2 macrophage polarization. ResultsCompared with those in the sham group， the circumference and joint diameter of the right knee were markedly enlarged in the model group （P<0.01）， while PPTs of rats showed a significant reduction （P<0.01）. The contents of IL-1β， TNF-α， CGRP， and NGF in rats' serum were significantly elevated （P<0.01）， and the synovial Krenn score was increased （P<0.01）. The Mankin score of cartilage tissue was increased （P<0.01）， and the protein expressions of TRPV1 and p-p38 MAPK/p38 MAPK were significantly upregulated （P<0.01）. The experimental intervention significantly reduced the proportion of pro-inflammatory M1 macrophages in the total macrophage population （P<0.01）， and the percentage of M2 macrophages was decreased （P<0.01）. The M1/M2 macrophage ratio was significantly elevated （P<0.01）. Knee joint diameters of all dose groups of Huamoyan granules and the celecoxib group were reduced （P<0.01） compared with those of the model group， and the PPT recovery speeds in the high and medium-dose groups of Huamoyan granules were more obvious （P<0.05）. The contents of IL-1β， CGRP， and NGF in the rats' serum in all administration groups were significantly reduced （P<0.05， P<0.01）， and the content of TNF-α in rats' serum was significantly reduced （P<0.01）. All dose groups of Huamoyan granules demonstrated significant reductions in both synovial Krenn score （P<0.05， P<0.01） and protein expression of TRPV1 and p-p38 MAPK/p38 MAPK in rats' synovial tissues （P<0.01）. The percentage of M1 macrophages in the synovial tissues of the celecoxib group and all dose groups of Huamoyan granules was decreased （P<0.01）. The percentage of M2 macrophages was increased （P<0.05）， and the M1/M2 ratio was decreased （P<0.01）. ConclusionHuamoyan granules can alleviate the inflammatory response of KOA， reduce the release of inflammatory pain mediators， and downregulate TRPV1 protein expression by regulating macrophage polarization. Its mechanism may be related to the TRPV1/p38 MAPK signaling pathway， thereby achieving the effect of improving peripheral pain hypersensitivity in KOA.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

OBJECTIVE To form an expert consensus on the clinical application of parenteral direct thrombin inhibitors （DTIs） in patients during the perioperative period. METHODS Led by Sichuan Academy of Medical Sciences & Sichuan Provincial People’s Hospital （the Affiliated Hospital of UESTC）， a multidisciplinary working group was established. Through literature review and the Delphi method， clinical questions related to the rational perioperative use of parenteral DTIs were identified. A structured design was adopted using the “Population-Intervention-Comparison-Outcome” framework； systematic searches were conducted in CNKI， Medline， Embase and other databases. Relevant evidence from randomized controlled trials and cohort studies was included and synthesized. Evidence quality was assessed using the Grades of Recommendations Assessment，Development and Evaluation （GRADE） approach， and recommendations were formulated through multiple rounds of Delphi surveys and expert consensus meetings. RESULTS &CONCLUSIONS Seven recommendations （each with an expert consensus rate exceeding 90%） on the use of parenteral DTIs in perioperative patients were developed. These recommendations specify drug selection， dosing ranges， key monitoring points， and safety management strategies for parenteral DTIs in various scenarios， including the perioperative period of ventricular assist device implantation， the perioperative period of cardiac surgery， perioperative patients with lower-extremity atherosclerotic disease， the perioperative period of percutaneous coronary intervention in patients with acute coronary syndrome， the perioperative period of carotid artery stenting in patients with carotid stenosis， the perioperative period of patients with right heart thrombosis， and patients who develop related thrombosis and dysfunction after a central venous catheter insertion. In addition， warning and management pathways for perioperative bleeding and thrombotic events were proposed. This expert consensus， which is formulated based on the best available evidence， provides evidence-based guidance for standardized and individualized use of parenteral DTIs in perioperative period.

ObjectiveDonkey hide is the sole legally designated raw material for the preparation of the traditional Chinese medicine Ejiao. The quality stability of donkey hide during preservation directly determines the efficacy and safety of Ejiao. This study focuses on the dynamic succession of microbial communities during the preservation of donkey hides from different origins, aiming to clarify the correlation between microbial biodiversity difference and the degradation profiles of hide collagen and critical biochemical components, thereby providing a theoretical foundation for developing targeted preservation strategies based on microbial regulation. MethodsDonkey hides originating from four different regions were subjected to an accelerated microbial aging assay to simulate the spoilage process. The microbial community succession was analyzed using high-throughput sequencing. Microstructure changes and pore structure characteristics were assessed by scanning electron microscopy and mercury intrusion porosimetry, respectively. Additionally, the content of major components, including lipids, proteins, and sugars were determined by biochemical methods. ResultsAfter 96 h of aging, the collagen fiber structure in Africa donkey hides (ADH) exhibited significant degradation and collapse, followed by Xinjiang donkey hides (XDH). Instead, the microstructure of Dong’e black donkey hides (DDH) and Peru donkey hides (PDH) remained relatively intact. The porosities of DDH, XDH, PDH, and ADH increased from 27.9%, 15.7%, 30.3%, and 46.2% to 36.5%, 52.6%, 42.8%, and 57.7%, respectively, during the aging process, which suggested that the originally compact fiber structure was disrupted by microbial aging. Fourier transform infrared spectrometer analysis revealed the amide bands in XDH exhibited relatively weak intensity, and no collagen amide I band was observed in ADH. Meanwhile, the lipid and protein contents decreased in all four types of donkey hides, indicating that these components served as the primary nutrient sources for the growth of microorganism. Notably, the most severe collagen degradation was observed in XDH and ADH. A substantial increase was detected in the total soluble sugar in PDH aging solution and hydroxyproline in the ADH aging solution, respectively. These results indicated that donkey hides exhibit distinct patterns of structural degradation and nutrient utilization. Furthermore, the viable cells number of donkey hides increased sharply after 48 h of aging. Metagenomic analysis revealed that the relative abundance of Euryarchaeota in ADH, PDH and XDH declining from initial 93.19%, 97.73% and 30.08% to 0.79%, 1.43% and 0.02% after 96 h, respectively. Conversely, a significantly increase was observed in the abundance of Bacillota, with a marked increase in ADH, peaking at 92.75%. Additionally, the abundance of Pseudomonadota in PDH increased from 0.10% to 87.84%, suggesting that Bacillota and Pseudomonadota may be key factors exacerbating donkey hide spoilage. Unlike the other three types of donkey hides, the dominant bacterial phylum in DDH shifted from Pseudomonadota to Bacteroidota, characterized by a substantial abundance increase of Bacteroidota from 0.13% to 44.22%. ConclusionRegional variation in origin significantly influence the microbial aging of donkey hides, leading to distinct patterns of structural deterioration and differential nutrient utilization. Therefore, implementing origin-specific preservation strategies, through the precisely controlling environmental factors to suppress harmful phyla such as Bacillota and Pseudomonadota, is crucial for enhancing the storage quality of donkey hides.

Objective:To explore the clinical characteristics, diagnosis and treatment strategies, and prognosis of pulmonary embolism (PE) complicating childhood rheumatic diseases.Methods:A retrospective case series study was performed on the demographic data, laboratory indicators, imaging features, treatment regimens, and follow-up data of 8 children with rheumatic diseases complicated by PE who were admitted to the Department of Rheumatology and Immunology, Capital Center for Children′s Health, Capital Medical University from January 2014 to October 2023.Results:Among the 8 children, there were 4 boys and 4 girls, with an age of 12.0 (7.5, 13.0) years. Among the primary diseases, there were 3 cases of systemic lupus erythematosus, 2 cases of Beh?et′s disease, 2 cases of Takayasu arteritis, and 1 case of antiphospholipid syndrome. All children developed PE during the active phase of the primary disease. PE was detected at the onset of the primary disease in 3 cases, and the median time from the diagnosis of the primary disease to the development of PE was 10.0 (6.0, 25.0) months in the remaining 5 cases. Fever was present in all 8 children, 4 cases were accompanied by chest tightness, dyspnea, etc., and 2 cases only presented with fever. Laboratory examinations revealed the following results: erythrocyte sedimentation rate was 42.0 (17.0, 78.0) mm/1 h, high-sensitivity C-reactive protein was 12.7 (2.6, 78.7) mg/L, white blood cell count was 9.6 (7.2, 18.7)×10 9/L; D-dimer was 2.3 (0.9, 6.2) mg/L; and hemoglobin was (109±16) g/L.Imaging examinations revealed that 5 cases had involvement of the bilateral lower pulmonary arteries, 5 cases had peripheral embolism, and 3 cases had central PE. Complications included 3 cases of deep vein thrombosis, 2 cases of intracranial venous sinus thrombosis, and 1 case of mild pulmonary hypertension.In terms of treatment, 7 cases received anticoagulation with heparin followed by warfarin. Immunomodulation was mainly based on glucocorticoids combined with immunosuppressants, and 4 cases were combined with biological agents. The follow-up time of 4.17 (1.75, 7.17) years, the time for complete absorption of PE was 10.5 (6.0, 18.0) months; all 8 children had no target events, with no recurrence or chronic thromboembolic pulmonary hypertension, and the pulmonary artery remodeling was good. Conclusions:PE complicating childhood rheumatic diseases is closely related to the activity of the primary disease. The clinical manifestations are insidious, with fever as the main symptom. Imaging examination is the key to diagnosis.Early adoption of heparin followed by warfarin anticoagulation and glucocorticoids combined with immunosuppressants and (or) biological agents to control the primary disease can achieve a favorable prognosis.

Objective:To explore the clinical characteristics, diagnosis and treatment strategies, and prognosis of pulmonary embolism (PE) complicating childhood rheumatic diseases.Methods:A retrospective case series study was performed on the demographic data, laboratory indicators, imaging features, treatment regimens, and follow-up data of 8 children with rheumatic diseases complicated by PE who were admitted to the Department of Rheumatology and Immunology, Capital Center for Children′s Health, Capital Medical University from January 2014 to October 2023.Results:Among the 8 children, there were 4 boys and 4 girls, with an age of 12.0 (7.5, 13.0) years. Among the primary diseases, there were 3 cases of systemic lupus erythematosus, 2 cases of Beh?et′s disease, 2 cases of Takayasu arteritis, and 1 case of antiphospholipid syndrome. All children developed PE during the active phase of the primary disease. PE was detected at the onset of the primary disease in 3 cases, and the median time from the diagnosis of the primary disease to the development of PE was 10.0 (6.0, 25.0) months in the remaining 5 cases. Fever was present in all 8 children, 4 cases were accompanied by chest tightness, dyspnea, etc., and 2 cases only presented with fever. Laboratory examinations revealed the following results: erythrocyte sedimentation rate was 42.0 (17.0, 78.0) mm/1 h, high-sensitivity C-reactive protein was 12.7 (2.6, 78.7) mg/L, white blood cell count was 9.6 (7.2, 18.7)×10 9/L; D-dimer was 2.3 (0.9, 6.2) mg/L; and hemoglobin was (109±16) g/L.Imaging examinations revealed that 5 cases had involvement of the bilateral lower pulmonary arteries, 5 cases had peripheral embolism, and 3 cases had central PE. Complications included 3 cases of deep vein thrombosis, 2 cases of intracranial venous sinus thrombosis, and 1 case of mild pulmonary hypertension.In terms of treatment, 7 cases received anticoagulation with heparin followed by warfarin. Immunomodulation was mainly based on glucocorticoids combined with immunosuppressants, and 4 cases were combined with biological agents. The follow-up time of 4.17 (1.75, 7.17) years, the time for complete absorption of PE was 10.5 (6.0, 18.0) months; all 8 children had no target events, with no recurrence or chronic thromboembolic pulmonary hypertension, and the pulmonary artery remodeling was good. Conclusions:PE complicating childhood rheumatic diseases is closely related to the activity of the primary disease. The clinical manifestations are insidious, with fever as the main symptom. Imaging examination is the key to diagnosis.Early adoption of heparin followed by warfarin anticoagulation and glucocorticoids combined with immunosuppressants and (or) biological agents to control the primary disease can achieve a favorable prognosis.

Objective To investigate the distribution and antimicrobial resistance profiles of clinically isolated Haemophilus influenzae and Moraxella catarrhalis in hospitals across China from 2015 to 2021,and provide evidence for rational use of antimicrobial agents.Methods Data of H.influenzae and M.catarrhalis strains isolated from 2015 to 2021 in CHINET program were collected for analysis,and antimicrobial susceptibility testing was performed by disc diffusion method or automated systems according to the uniform protocol of CHINET.The results were interpreted according to the CLSI breakpoints in 2022.Beta-lactamases was detected by using nitrocefin disk.Results From 2015 to 2021,a total of 43 642 strains of Haemophilus species were isolated,accounting for 2.91％of the total clinical isolates and 4.07％of Gram-negative bacteria in CHINET program.Among the 40 437 strains of H.influenzae,66.89％were isolated from children and 33.11％were isolated from adults.More than 90％of the H.influenzae strains were isolated from respiratory tract specimens.The prevalence of β-lactamase was 53.79％in H.influenzae strains.The H.influenzae strains isolated from children showed higher resistance rate than the strains isolated from adults.Overall,779 strains of H.influenzae did not produce β-lactamase but were resistant to ampicillin(BLNAR).Beta-lactamase-producing strains showed significantly higher resistance rates to these antimicrobial agents than the β-lactamase-nonproducing strains.Of the 16 191 M.catarrhalis strains,80.06％were isolated from children and 19.94％isolated from adults.M.catarrhalis strains were mostly susceptible to both amoxicillin-clavulanic acid and cefuroxime,evidenced by resistance rate lower than 2.0％.Conclusions The emergence of antibiotic-resistant H.influenzae due to β-lactamase production poses a challenge for clinical anti-infective treatment.Therefore,it is very important to implement antibiotic resistance surveillance for H.influenzae and guide rational antibiotic use.All local clinical microbiology laboratories should actively improve antibiotic susceptibility testing and strengthen antibiotic resistance surveillance for H.influenzae.

Objective To understand the changing composition and antibiotic resistance of bacterial species in the clinical isolates from outpatient and emergency department(hereinafter referred to as outpatients)and inpatient children over time in various hospitals,and to provide laboratory evidence for rational antibiotic use.Methods The data on clinically isolated pathogenic bacteria and antimicrobial susceptibility of isolates from outpatients and inpatient children in the CHINET program from 2015 to 2021 were collected and analyzed.Results A total of 278 471 isolates were isolated from pediatric patients in the CHINET program from 2015 to 2021.About 17.1％of the strains were isolated from outpatients,primarily group A β-hemolytic Streptococcus,Escherichia coli,and Staphylococcus aureus.Most of the strains(82.9％)were isolated from inpatients,mainly SS.aureus,E.coli,and H.influenzae.The prevalence of methicillin-resistant S.aureus(MRSA)in outpatients(24.5％)was lower than that in inpatient children(31.5％).The MRSA isolates from outpatients showed lower resistance rates to the antibiotics tested than the strains isolated from inpatient children.The prevalence of vancomycin-resistant Enterococcus faecalis or E.faecium and penicillin-resistant S.pneumoniae was low in either outpatients or inpatient children.S.pneumoniae,β-hemolytic Streptococcus and S.viridans showed high resistance rates to erythromycin.The prevalence of erythromycin-resistant group A β-hemolytic Streptococcus was higher in outpatients than that in inpatient children.The prevalence of β-lactamase-producing H.influenzae showed an overall upward trend in children,but lower in outpatients(45.1％)than in inpatient children(59.4％).The prevalence of carbapenem-resistant Klebsiella pneumoniae(CRKpn),carbapenem-resistant Pseudomonas aeruginosa(CRPae)and carbapenem-resistant Acinetobacter baumannii(CRAba)was 14％,11.7％,47.8％in outpatients,but 24.2％,20.6％,and 52.8％in inpatient children,respectively.The prevalence of multidrug-resistant E.coli,K.pneumoniae,Proteus mirabilis,P.aeruginosa and A.baumannii strains was lower in outpatients than in inpatient children.The prevalence of fluoroquinolone-resistant E.coli,ESBLs-producing K.pneumoniae,ESBLs-producing P.mirabilis,carbapenem-resistant E.coli(CREco),CRKpn,and CRPae was lower in children in outpatients than in inpatient children,but the prevalence of CRAba in 2021 was higher than in inpatient children.Conclusions The distribution of clinical isolates from children is different between outpatients and inpatients.The prevalence of MRSA,ESBL,and CRO was higher in inpatient children than in outpatients.Antibiotics should be used rationally in clinical practice based on etiological diagnosis and antimicrobial susceptibility test results.Ongoing antimicrobial resistance surveillance and prevention and control of hospital infections are crucial to curbing bacterial resistance.

Objective To investigate the changing antibiotic resistance profiles of E.coli isolated from patients in the 52 hospitals participating in the CHINET program from 2015 to 2021.Methods Antimicrobial susceptibility was tested for clinical isolates of E.coli according to the unified protocol of CHINET program.WHONET 5.6 and SPSS 20.0 software were used for data analysis.Results Atotal of 289 760 nonduplicate clinical strains ofE.coli were isolated from 2015 to 2021,mainly from urine samples(44.7±3.2)％.The proportion of E.coli strains isolated from urine samples was higher in females than in males(59.0％vs 29.5％).The proportion of E.coli strains isolated from respiratory tract and cerebrospinal fluid samples was significantly higher in children than in adults(16.7％vs 7.8％,0.8％vs 0.1％,both P＜0.05).The isolates from internal medicine department accounted for the largest proportion(28.9±2.8)％with an increasing trend over years.Overall,the prevalence of ESBLs-producing E.coli and carbapenem resistant E.coli(CREco)was 55.9％and 1.8％,respectively during the 7-year period.The prevalence of ESBLs-producing E.coli was the highest in tertiary hospitals each year from 2015 to 2021 compared to secondary hospitals.The prevalence of CREco was higher in children's hospitals compared to secondary and tertiary hospitals each year from 2015 to 2021.The prevalence of ESBLs-producing E.coli in tertiary hospitals and children's hospitals and the prevalence of CREco in children's hospitals showed a decreasing trend over the 7-year period.The prevalence of CREco in secondary and tertiary hospitals increased slowly.Antibiotic resistance rates changed slowly from 2015 to 2021.Carbapenem drugs(imipenem,meropenem)were the most active drugs amongβ-lactams against E.coli(resistance rate≤2.1％).The resistance rates of E.coli to β-lactam/β-lactam inhibitor combinations(piperacillin-tazobactam,cefoperazone-sulbactam),aminoglycosides(amikacin),nitrofurantoin and fosfomycin(for urinary isolates only)were all less than 10％.The resistance rate of E.coli strains to antibiotics varied with the level of hospitals and the departments where the strains were isolated,especially for cefazolin and ciprofloxacin,to which the resistance rate of E.coli strains from children in non-ICU departments was significantly lower than that of the strains isolated from other departments(P＜0.05).The E.coli isolates from ICU showed higher resistance rate to most antimicrobial agents tested(excluding tigecycline)than the strains isolated from other departments.The E.coli strains isolated from tertiary hospitals showed higher resistance rates to the antimicrobial agents tested(excluding tigecycline,polymyxin B,cefepime and carbapenems)than the strains from secondary hospitals and children's hospitals.Conclusions E.coli is an important pathogen causing clinical infection.More than half of the clinical isolates produced ESBL.The prevalence of CREco is increasing in secondary and tertiary hospitals over the 7-year period even though the overall prevalence is still low.This is an issue of concern.

BACKGROUND: The effect of air pollution on annual change rates in grip strength and body composition in the elderly is unknown. OBJECTIVES: This study evaluated the effects of long-term exposure to ambient air pollution on change rates of grip strength and body composition in the elderly. METHODS: In the period 2016-2020, grip strength and body composition were assessed and measured 1-2 times per year in 395 elderly participants living in the Taipei basin. Exposure to ambient fine particulate matters (PM_2.5), nitric dioxide (NO₂), and ozone (O₃) from 2015 to 2019 was estimated using a hybrid Kriging/Land-use regression model. In addition, long-term exposure to carbon monoxide (CO) was estimated using an ordinary Kriging approach. Associations between air pollution exposures and annual changes in health outcomes were analyzed using linear mixed-effects models. RESULTS: An inter-quartile range (4.1 µg/m³) increase in long-term exposure to PM_2.5 was associated with a faster decline rate in grip strength (-0.16 kg per year) and skeletal muscle mass (-0.14 kg per year), but an increase in body fat mass (0.21 kg per year). The effect of PM_2.5 remained robust after adjustment for NO₂, O₃ and CO exposure. In subgroup analysis, the PM_2.5-related decline rate in grip strength was greater in participants with older age (>70 years) or higher protein intake, whereas in skeletal muscle mass, the decline rate was more pronounced in participants having a lower frequency of moderate or strenuous exercise. The PM_2.5-related increase rate in body fat mass was higher in participants having a lower frequency of strenuous exercise or soybean intake. CONCLUSIONS Among the elderly, long-term exposure to ambient PM_2.5 is associated with a faster decline in grip strength and skeletal muscle mass, and an increase in body fat mass. Susceptibility to PM_2.5 may be influenced by age, physical activity, and dietary protein intake; however, these modifying effects vary across different health outcomes, and further research is needed to clarify their mechanisms and consistency.
Humans ; Hand Strength ; Aged ; Male ; Female ; Environmental Exposure/adverse effects* ; Follow-Up Studies ; Taiwan ; Air Pollution/adverse effects* ; Particulate Matter/adverse effects* ; Muscle, Skeletal/drug effects* ; Air Pollutants/adverse effects* ; Ozone/adverse effects* ; Aged, 80 and over ; Adipose Tissue/drug effects* ; Body Composition/drug effects* ; Nitrogen Dioxide/adverse effects*