AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveDonkey hide is the sole legally designated raw material for the preparation of the traditional Chinese medicine Ejiao. The quality stability of donkey hide during preservation directly determines the efficacy and safety of Ejiao. This study focuses on the dynamic succession of microbial communities during the preservation of donkey hides from different origins, aiming to clarify the correlation between microbial biodiversity difference and the degradation profiles of hide collagen and critical biochemical components, thereby providing a theoretical foundation for developing targeted preservation strategies based on microbial regulation. MethodsDonkey hides originating from four different regions were subjected to an accelerated microbial aging assay to simulate the spoilage process. The microbial community succession was analyzed using high-throughput sequencing. Microstructure changes and pore structure characteristics were assessed by scanning electron microscopy and mercury intrusion porosimetry, respectively. Additionally, the content of major components, including lipids, proteins, and sugars were determined by biochemical methods. ResultsAfter 96 h of aging, the collagen fiber structure in Africa donkey hides (ADH) exhibited significant degradation and collapse, followed by Xinjiang donkey hides (XDH). Instead, the microstructure of Dong’e black donkey hides (DDH) and Peru donkey hides (PDH) remained relatively intact. The porosities of DDH, XDH, PDH, and ADH increased from 27.9%, 15.7%, 30.3%, and 46.2% to 36.5%, 52.6%, 42.8%, and 57.7%, respectively, during the aging process, which suggested that the originally compact fiber structure was disrupted by microbial aging. Fourier transform infrared spectrometer analysis revealed the amide bands in XDH exhibited relatively weak intensity, and no collagen amide I band was observed in ADH. Meanwhile, the lipid and protein contents decreased in all four types of donkey hides, indicating that these components served as the primary nutrient sources for the growth of microorganism. Notably, the most severe collagen degradation was observed in XDH and ADH. A substantial increase was detected in the total soluble sugar in PDH aging solution and hydroxyproline in the ADH aging solution, respectively. These results indicated that donkey hides exhibit distinct patterns of structural degradation and nutrient utilization. Furthermore, the viable cells number of donkey hides increased sharply after 48 h of aging. Metagenomic analysis revealed that the relative abundance of Euryarchaeota in ADH, PDH and XDH declining from initial 93.19%, 97.73% and 30.08% to 0.79%, 1.43% and 0.02% after 96 h, respectively. Conversely, a significantly increase was observed in the abundance of Bacillota, with a marked increase in ADH, peaking at 92.75%. Additionally, the abundance of Pseudomonadota in PDH increased from 0.10% to 87.84%, suggesting that Bacillota and Pseudomonadota may be key factors exacerbating donkey hide spoilage. Unlike the other three types of donkey hides, the dominant bacterial phylum in DDH shifted from Pseudomonadota to Bacteroidota, characterized by a substantial abundance increase of Bacteroidota from 0.13% to 44.22%. ConclusionRegional variation in origin significantly influence the microbial aging of donkey hides, leading to distinct patterns of structural deterioration and differential nutrient utilization. Therefore, implementing origin-specific preservation strategies, through the precisely controlling environmental factors to suppress harmful phyla such as Bacillota and Pseudomonadota, is crucial for enhancing the storage quality of donkey hides.

ObjectiveThis paper aims to observe the protective effect of Huamoyan granules on knee osteoarthritis （KOA） and explore whether its protective effect is oriented toward an anti-inflammatory direction by regulation of macrophage polarization， which can effectively inhibit the progression of pathological inflammatory response， reduce the release of inflammatory pain mediators， and downregulate the protein expression level of transient receptor potential vanilloid 1 （TRPV1）， so as to provide experimental evidence for its clinical application and investigate its action mechanism. MethodsAfter adaptive feeding， Sprague-Dawley （SD） rats were randomly divided into six groups： sham group， model group， celecoxib group， and high， medium， and low-dose synovitis granule groups （9.6， 4.8， 2.4 g·kg^-1）. The administration dose of celecoxib capsules was 20 mg·kg^-1. There were 10 rats in the sham group and 12 rats in the model group and each administration group. A KOA animal model was established by means of intra-articular injection of sodium iodoacetate into the knee joint. From the 10^th day of the experiment， each administration group was given intragastric administration at a dose of 10 mL·kg^-1 for 4 weeks. General conditions of rats in each group were assessed daily. The pressure pain threshold （PPT） to mechanical stimulation and joint diameter were recorded. X-ray examination was performed on the right knee joints of rats for imaging analysis. Enzyme linked immunosorbent assay （ELISA） was performed to detect the tumor necrosis factor-α （TNF-α）， serum interleukin-1β （IL-1β）， and other pro-inflammatory cytokines in rat serum samples， as well as the expression levels of neurogenic inflammatory mediators such as nerve growth factor （NGF） and calcitonin gene-related peptide （CGRP）. Histopathological changes in the knee joint synovial tissues were examined by hematoxylineosin （HE） staining. Safranin O-fast green staining was performed to observe and evaluate the degree of knee cartilage lesions. Western blot was employed to quantitatively analyze TRPV1， p38 mitogen-activated protein kinase （p38 MAPK）， and phosphorylated （p）-p38 MAPK in rat knee synovial tissues. Immunofluorescence （IF） was used to measure and assess M1/M2 macrophage polarization. ResultsCompared with those in the sham group， the circumference and joint diameter of the right knee were markedly enlarged in the model group （P<0.01）， while PPTs of rats showed a significant reduction （P<0.01）. The contents of IL-1β， TNF-α， CGRP， and NGF in rats' serum were significantly elevated （P<0.01）， and the synovial Krenn score was increased （P<0.01）. The Mankin score of cartilage tissue was increased （P<0.01）， and the protein expressions of TRPV1 and p-p38 MAPK/p38 MAPK were significantly upregulated （P<0.01）. The experimental intervention significantly reduced the proportion of pro-inflammatory M1 macrophages in the total macrophage population （P<0.01）， and the percentage of M2 macrophages was decreased （P<0.01）. The M1/M2 macrophage ratio was significantly elevated （P<0.01）. Knee joint diameters of all dose groups of Huamoyan granules and the celecoxib group were reduced （P<0.01） compared with those of the model group， and the PPT recovery speeds in the high and medium-dose groups of Huamoyan granules were more obvious （P<0.05）. The contents of IL-1β， CGRP， and NGF in the rats' serum in all administration groups were significantly reduced （P<0.05， P<0.01）， and the content of TNF-α in rats' serum was significantly reduced （P<0.01）. All dose groups of Huamoyan granules demonstrated significant reductions in both synovial Krenn score （P<0.05， P<0.01） and protein expression of TRPV1 and p-p38 MAPK/p38 MAPK in rats' synovial tissues （P<0.01）. The percentage of M1 macrophages in the synovial tissues of the celecoxib group and all dose groups of Huamoyan granules was decreased （P<0.01）. The percentage of M2 macrophages was increased （P<0.05）， and the M1/M2 ratio was decreased （P<0.01）. ConclusionHuamoyan granules can alleviate the inflammatory response of KOA， reduce the release of inflammatory pain mediators， and downregulate TRPV1 protein expression by regulating macrophage polarization. Its mechanism may be related to the TRPV1/p38 MAPK signaling pathway， thereby achieving the effect of improving peripheral pain hypersensitivity in KOA.

OBJECTIVE To form an expert consensus on the clinical application of parenteral direct thrombin inhibitors （DTIs） in patients during the perioperative period. METHODS Led by Sichuan Academy of Medical Sciences & Sichuan Provincial People’s Hospital （the Affiliated Hospital of UESTC）， a multidisciplinary working group was established. Through literature review and the Delphi method， clinical questions related to the rational perioperative use of parenteral DTIs were identified. A structured design was adopted using the “Population-Intervention-Comparison-Outcome” framework； systematic searches were conducted in CNKI， Medline， Embase and other databases. Relevant evidence from randomized controlled trials and cohort studies was included and synthesized. Evidence quality was assessed using the Grades of Recommendations Assessment，Development and Evaluation （GRADE） approach， and recommendations were formulated through multiple rounds of Delphi surveys and expert consensus meetings. RESULTS &CONCLUSIONS Seven recommendations （each with an expert consensus rate exceeding 90%） on the use of parenteral DTIs in perioperative patients were developed. These recommendations specify drug selection， dosing ranges， key monitoring points， and safety management strategies for parenteral DTIs in various scenarios， including the perioperative period of ventricular assist device implantation， the perioperative period of cardiac surgery， perioperative patients with lower-extremity atherosclerotic disease， the perioperative period of percutaneous coronary intervention in patients with acute coronary syndrome， the perioperative period of carotid artery stenting in patients with carotid stenosis， the perioperative period of patients with right heart thrombosis， and patients who develop related thrombosis and dysfunction after a central venous catheter insertion. In addition， warning and management pathways for perioperative bleeding and thrombotic events were proposed. This expert consensus， which is formulated based on the best available evidence， provides evidence-based guidance for standardized and individualized use of parenteral DTIs in perioperative period.

Objective:To explore the clinical characteristics, diagnosis and treatment strategies, and prognosis of pulmonary embolism (PE) complicating childhood rheumatic diseases.Methods:A retrospective case series study was performed on the demographic data, laboratory indicators, imaging features, treatment regimens, and follow-up data of 8 children with rheumatic diseases complicated by PE who were admitted to the Department of Rheumatology and Immunology, Capital Center for Children′s Health, Capital Medical University from January 2014 to October 2023.Results:Among the 8 children, there were 4 boys and 4 girls, with an age of 12.0 (7.5, 13.0) years. Among the primary diseases, there were 3 cases of systemic lupus erythematosus, 2 cases of Beh?et′s disease, 2 cases of Takayasu arteritis, and 1 case of antiphospholipid syndrome. All children developed PE during the active phase of the primary disease. PE was detected at the onset of the primary disease in 3 cases, and the median time from the diagnosis of the primary disease to the development of PE was 10.0 (6.0, 25.0) months in the remaining 5 cases. Fever was present in all 8 children, 4 cases were accompanied by chest tightness, dyspnea, etc., and 2 cases only presented with fever. Laboratory examinations revealed the following results: erythrocyte sedimentation rate was 42.0 (17.0, 78.0) mm/1 h, high-sensitivity C-reactive protein was 12.7 (2.6, 78.7) mg/L, white blood cell count was 9.6 (7.2, 18.7)×10 9/L; D-dimer was 2.3 (0.9, 6.2) mg/L; and hemoglobin was (109±16) g/L.Imaging examinations revealed that 5 cases had involvement of the bilateral lower pulmonary arteries, 5 cases had peripheral embolism, and 3 cases had central PE. Complications included 3 cases of deep vein thrombosis, 2 cases of intracranial venous sinus thrombosis, and 1 case of mild pulmonary hypertension.In terms of treatment, 7 cases received anticoagulation with heparin followed by warfarin. Immunomodulation was mainly based on glucocorticoids combined with immunosuppressants, and 4 cases were combined with biological agents. The follow-up time of 4.17 (1.75, 7.17) years, the time for complete absorption of PE was 10.5 (6.0, 18.0) months; all 8 children had no target events, with no recurrence or chronic thromboembolic pulmonary hypertension, and the pulmonary artery remodeling was good. Conclusions:PE complicating childhood rheumatic diseases is closely related to the activity of the primary disease. The clinical manifestations are insidious, with fever as the main symptom. Imaging examination is the key to diagnosis.Early adoption of heparin followed by warfarin anticoagulation and glucocorticoids combined with immunosuppressants and (or) biological agents to control the primary disease can achieve a favorable prognosis.

Objective:To explore the clinical characteristics, diagnosis and treatment strategies, and prognosis of pulmonary embolism (PE) complicating childhood rheumatic diseases.Methods:A retrospective case series study was performed on the demographic data, laboratory indicators, imaging features, treatment regimens, and follow-up data of 8 children with rheumatic diseases complicated by PE who were admitted to the Department of Rheumatology and Immunology, Capital Center for Children′s Health, Capital Medical University from January 2014 to October 2023.Results:Among the 8 children, there were 4 boys and 4 girls, with an age of 12.0 (7.5, 13.0) years. Among the primary diseases, there were 3 cases of systemic lupus erythematosus, 2 cases of Beh?et′s disease, 2 cases of Takayasu arteritis, and 1 case of antiphospholipid syndrome. All children developed PE during the active phase of the primary disease. PE was detected at the onset of the primary disease in 3 cases, and the median time from the diagnosis of the primary disease to the development of PE was 10.0 (6.0, 25.0) months in the remaining 5 cases. Fever was present in all 8 children, 4 cases were accompanied by chest tightness, dyspnea, etc., and 2 cases only presented with fever. Laboratory examinations revealed the following results: erythrocyte sedimentation rate was 42.0 (17.0, 78.0) mm/1 h, high-sensitivity C-reactive protein was 12.7 (2.6, 78.7) mg/L, white blood cell count was 9.6 (7.2, 18.7)×10 9/L; D-dimer was 2.3 (0.9, 6.2) mg/L; and hemoglobin was (109±16) g/L.Imaging examinations revealed that 5 cases had involvement of the bilateral lower pulmonary arteries, 5 cases had peripheral embolism, and 3 cases had central PE. Complications included 3 cases of deep vein thrombosis, 2 cases of intracranial venous sinus thrombosis, and 1 case of mild pulmonary hypertension.In terms of treatment, 7 cases received anticoagulation with heparin followed by warfarin. Immunomodulation was mainly based on glucocorticoids combined with immunosuppressants, and 4 cases were combined with biological agents. The follow-up time of 4.17 (1.75, 7.17) years, the time for complete absorption of PE was 10.5 (6.0, 18.0) months; all 8 children had no target events, with no recurrence or chronic thromboembolic pulmonary hypertension, and the pulmonary artery remodeling was good. Conclusions:PE complicating childhood rheumatic diseases is closely related to the activity of the primary disease. The clinical manifestations are insidious, with fever as the main symptom. Imaging examination is the key to diagnosis.Early adoption of heparin followed by warfarin anticoagulation and glucocorticoids combined with immunosuppressants and (or) biological agents to control the primary disease can achieve a favorable prognosis.

This study aimed to compare the ameliorative effects of Lycii Fructus and Chrysanthemi Flos at different ratios on retinal damage in mice and to elucidate the underlying mechanisms. A retinal injury model was established by intraperitoneal injection of sodium iodate(NaIO_3) solution. The mice were divided into the following groups: blank group, model group, positive drug(AREDS 2) group, low-and high-dose groups of Lycii Fructus and Chrysanthemi Flos at 1∶1, low-and high-dose groups at 3∶1, and low-and high-dose groups at 1∶3. Administration was carried out 15 days after modeling. The visual acuity of the mice was assessed using the black-and-white box test. The fundus was observed using an optical coherence tomography device, and retinal thickness was measured. HE staining was used to observe the morphology and pathological changes of the retina. The levels of oxidative factors in serum and ocular tissues were measured using assay kits. The levels of inflammatory factors in serum and ocular tissues were detected by enzyme-linked immunosorbent assay(ELISA), and the expression of Nrf2, HO-1, and NF-κB proteins in ocular tissues was analyzed by Western blot. The results showed that after administration of Lycii Fructus and Chrysanthemi Flos at different ratios, the model group showed improved retinal thinning and disordered arrangement of retinal layers, elevated content of SOD and GSH in the serum and ocular tissues, and reduced levels of MDA, TNF-α, IL-1β, and IL-6. Lycii Fructus and Chrysanthemi Flos at 1∶1 and 1∶3 showed better improvement effects. The combination significantly upregulated the expression levels of Nrf2 and HO-1 and downregulated the expression of NF-κB p65. These results indicate that Lycii Fructus and Chrysanthemi Flos at different ratios can improve retinal damage, reduce oxidative stress, and alleviate inflammation in both the body and ocular tissues of mice. The mechanism may be related to the regulation of the Nrf2/HO-1 and NF-κB signaling pathways in ocular tissues. These findings provide a theoretical basis for the clinical application of Lycii Fructus and Chrysanthemi Flos in the treatment of dry age-related macular degeneration.
Animals ; Mice ; Retina/injuries* ; Male ; Lycium/chemistry* ; Drugs, Chinese Herbal/administration & dosage* ; Chrysanthemum/chemistry* ; NF-kappa B/genetics* ; Humans ; Retinal Diseases/metabolism* ; NF-E2-Related Factor 2/metabolism* ; Oxidative Stress/drug effects* ; Flowers/chemistry* ; Heme Oxygenase-1/genetics*

OBJECTIVE: We aimed to investigate the patterns of fasting blood glucose (FBG) trajectories and analyze the relationship between various occupational hazard factors and FBG trajectories in male steelworkers. METHODS: The study cohort included 3,728 workers who met the selection criteria for the Tanggang Occupational Cohort (TGOC) between 2017 and 2022. A group-based trajectory model was used to identify the FBG trajectories. Environmental risk scores (ERS) were constructed using regression coefficients from the occupational hazard model as weights. Univariate and multivariate logistic regression analyses were performed to explore the effects of occupational hazard factors using the ERS on FBG trajectories. RESULTS: FBG trajectories were categorized into three groups. An association was observed between high temperature, noise exposure, and FBG trajectory ( P < 0.05). Using the first quartile group of ERS1 as a reference, the fourth quartile group of ERS1 had an increased risk of medium and high FBG by 1.90 and 2.21 times, respectively (odds ratio [ OR] = 1.90, 95% confidence interval [ CI]: 1.17-3.10; OR = 2.21, 95% CI: 1.09-4.45). CONCLUSION An association was observed between occupational hazards based on ERS and FBG trajectories. The risk of FBG trajectory levels increase with an increase in ERS.
Humans ; Male ; Adult ; Blood Glucose/analysis* ; China ; Prospective Studies ; Occupational Exposure/adverse effects* ; Risk Factors ; Middle Aged ; Steel ; Fasting/blood* ; Metal Workers ; East Asian People

OBJECTIVE: Cigarette smoking exacerbates the progression of pulmonary tuberculosis (TB). The role of tertiary lymphoid structures (TLS) in chronic lung diseases has gained attention; however, it remains unclear whether smoking-exacerbated lung damage in TB is associated with TLS. This study aimed to analyze the characteristics of pulmonary TLS in smokers with TB and to explore the possible role of TLS in smoking-related lung injury in TB. METHODS: Lung tissues from 36 male patients (18 smokers and 18 non-smokers) who underwent surgical resection for pulmonary TB were included in this study. Pathological and immunohistological analyses were conducted to evaluate the quantity of TLS, and chest computed tomography (CT) was used to assess the severity of lung lesions. The correlation between the TLS quantity and TB lesion severity scores was analyzed. The immune cells and chemokines involved in TLS formation were also evaluated and compared between smokers and non-smokers. RESULTS: Smoker patients with TB had significantly higher TLS than non-smokers ( P < 0.001). The TLS quantity in both the lung parenchyma and peribronchial regions correlated with TB lesion severity on chest CT (parenchyma: r = 0.5767; peribronchial: r = 0.7373; both P < 0.001). Immunohistochemical analysis showed increased B cells, T cells, and C-X-C motif chemokine ligand 13 (CXCL13) expression in smoker patients with TB ( P < 0.001). CONCLUSION Smoker TB patients exhibited increased pulmonary TLS, which was associated with exacerbated lung lesions on chest CT, suggesting that cigarette smoking may exacerbate lung damage by promoting TLS formation.
Humans ; Male ; Tuberculosis, Pulmonary/immunology* ; Middle Aged ; Tertiary Lymphoid Structures/pathology* ; Adult ; Lung/pathology* ; Smoking/adverse effects* ; Smokers ; Aged ; Tomography, X-Ray Computed

BACKGROUND: The effect of air pollution on annual change rates in grip strength and body composition in the elderly is unknown. OBJECTIVES: This study evaluated the effects of long-term exposure to ambient air pollution on change rates of grip strength and body composition in the elderly. METHODS: In the period 2016-2020, grip strength and body composition were assessed and measured 1-2 times per year in 395 elderly participants living in the Taipei basin. Exposure to ambient fine particulate matters (PM_2.5), nitric dioxide (NO₂), and ozone (O₃) from 2015 to 2019 was estimated using a hybrid Kriging/Land-use regression model. In addition, long-term exposure to carbon monoxide (CO) was estimated using an ordinary Kriging approach. Associations between air pollution exposures and annual changes in health outcomes were analyzed using linear mixed-effects models. RESULTS: An inter-quartile range (4.1 µg/m³) increase in long-term exposure to PM_2.5 was associated with a faster decline rate in grip strength (-0.16 kg per year) and skeletal muscle mass (-0.14 kg per year), but an increase in body fat mass (0.21 kg per year). The effect of PM_2.5 remained robust after adjustment for NO₂, O₃ and CO exposure. In subgroup analysis, the PM_2.5-related decline rate in grip strength was greater in participants with older age (>70 years) or higher protein intake, whereas in skeletal muscle mass, the decline rate was more pronounced in participants having a lower frequency of moderate or strenuous exercise. The PM_2.5-related increase rate in body fat mass was higher in participants having a lower frequency of strenuous exercise or soybean intake. CONCLUSIONS Among the elderly, long-term exposure to ambient PM_2.5 is associated with a faster decline in grip strength and skeletal muscle mass, and an increase in body fat mass. Susceptibility to PM_2.5 may be influenced by age, physical activity, and dietary protein intake; however, these modifying effects vary across different health outcomes, and further research is needed to clarify their mechanisms and consistency.
Humans ; Hand Strength ; Aged ; Male ; Female ; Environmental Exposure/adverse effects* ; Follow-Up Studies ; Taiwan ; Air Pollution/adverse effects* ; Particulate Matter/adverse effects* ; Muscle, Skeletal/drug effects* ; Air Pollutants/adverse effects* ; Ozone/adverse effects* ; Aged, 80 and over ; Adipose Tissue/drug effects* ; Body Composition/drug effects* ; Nitrogen Dioxide/adverse effects*