AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

The analysis presented here is based on the blood components of Guanxin Qiwei tablets, the key anti-atherosclerosis pathway of Guanxin Qiwei tablets was screened by network pharmacology, and the anti-atherosclerosis mechanism of Guanxin Qiwei tablets was clarified and verified by cell experiments. HPLC-Q-Exactive-MS/MS technique was used to analyze the components of Guanxin Qiwei tablets into blood, to determine the precise mass charge ratio of the compounds, and to conduct a comprehensive analysis of the components by using secondary mass spectrometry fragments and literature comparison. Finally, a total of 42 components of Guanxin Qiwei tablets into blood were identified. To better understand the interactions, we employed the Swiss Target Prediction database to predict the associated targets. Atherosclerosis (AS) disease targets were searched in disease databases Genecard, OMIM and Disgent, and 181 intersection targets of disease targets and component targets were obtained by Venny 2.1.0 software. Protein interactions were analyzed by String database. The 32 core targets were selected by Cytscape software. Gene Ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were performed in DAVID database. It was found that the anti-atherosclerosis pathways of Guanxin Qiwei tablets mainly include lipid metabolism and atherosclerosis and AGE-RAGE signaling pathway in diabetic complications and other signal pathways. The core targets and the core compounds were interlinked, and it was found that cryptotanshinone and tanshinone ⅡA in Guanxin Qiwei tablets were well bound to TNF, PPARγ, AKT1, PTG2 and other targets. The lipid metabolism and atherosclerotic pathway was verified using human hl-7702 hepatocytes. This study preliminarily identified the potential pharmacodynamic components of Guanxin Qiwei tablets in the treatment of AS diseases and predicted their pathways of action, and verified the relationship between regulating lipid metabolism and atherosclerosis of Guanxin Qiwei tablets in vitro, providing a reference for the further study of the pharmacodynamic material basis and mechanism of action of this prescription. This experiment was approved by the Medical Ethics Committee of Inner Mongolia Medical University (No. YKD202401262).

This study aimed to compare the ameliorative effects of Lycii Fructus and Chrysanthemi Flos at different ratios on retinal damage in mice and to elucidate the underlying mechanisms. A retinal injury model was established by intraperitoneal injection of sodium iodate(NaIO_3) solution. The mice were divided into the following groups: blank group, model group, positive drug(AREDS 2) group, low-and high-dose groups of Lycii Fructus and Chrysanthemi Flos at 1∶1, low-and high-dose groups at 3∶1, and low-and high-dose groups at 1∶3. Administration was carried out 15 days after modeling. The visual acuity of the mice was assessed using the black-and-white box test. The fundus was observed using an optical coherence tomography device, and retinal thickness was measured. HE staining was used to observe the morphology and pathological changes of the retina. The levels of oxidative factors in serum and ocular tissues were measured using assay kits. The levels of inflammatory factors in serum and ocular tissues were detected by enzyme-linked immunosorbent assay(ELISA), and the expression of Nrf2, HO-1, and NF-κB proteins in ocular tissues was analyzed by Western blot. The results showed that after administration of Lycii Fructus and Chrysanthemi Flos at different ratios, the model group showed improved retinal thinning and disordered arrangement of retinal layers, elevated content of SOD and GSH in the serum and ocular tissues, and reduced levels of MDA, TNF-α, IL-1β, and IL-6. Lycii Fructus and Chrysanthemi Flos at 1∶1 and 1∶3 showed better improvement effects. The combination significantly upregulated the expression levels of Nrf2 and HO-1 and downregulated the expression of NF-κB p65. These results indicate that Lycii Fructus and Chrysanthemi Flos at different ratios can improve retinal damage, reduce oxidative stress, and alleviate inflammation in both the body and ocular tissues of mice. The mechanism may be related to the regulation of the Nrf2/HO-1 and NF-κB signaling pathways in ocular tissues. These findings provide a theoretical basis for the clinical application of Lycii Fructus and Chrysanthemi Flos in the treatment of dry age-related macular degeneration.
Animals ; Mice ; Retina/injuries* ; Male ; Lycium/chemistry* ; Drugs, Chinese Herbal/administration & dosage* ; Chrysanthemum/chemistry* ; NF-kappa B/genetics* ; Humans ; Retinal Diseases/metabolism* ; NF-E2-Related Factor 2/metabolism* ; Oxidative Stress/drug effects* ; Flowers/chemistry* ; Heme Oxygenase-1/genetics*

BACKGROUND: The effect of air pollution on annual change rates in grip strength and body composition in the elderly is unknown. OBJECTIVES: This study evaluated the effects of long-term exposure to ambient air pollution on change rates of grip strength and body composition in the elderly. METHODS: In the period 2016-2020, grip strength and body composition were assessed and measured 1-2 times per year in 395 elderly participants living in the Taipei basin. Exposure to ambient fine particulate matters (PM_2.5), nitric dioxide (NO₂), and ozone (O₃) from 2015 to 2019 was estimated using a hybrid Kriging/Land-use regression model. In addition, long-term exposure to carbon monoxide (CO) was estimated using an ordinary Kriging approach. Associations between air pollution exposures and annual changes in health outcomes were analyzed using linear mixed-effects models. RESULTS: An inter-quartile range (4.1 µg/m³) increase in long-term exposure to PM_2.5 was associated with a faster decline rate in grip strength (-0.16 kg per year) and skeletal muscle mass (-0.14 kg per year), but an increase in body fat mass (0.21 kg per year). The effect of PM_2.5 remained robust after adjustment for NO₂, O₃ and CO exposure. In subgroup analysis, the PM_2.5-related decline rate in grip strength was greater in participants with older age (>70 years) or higher protein intake, whereas in skeletal muscle mass, the decline rate was more pronounced in participants having a lower frequency of moderate or strenuous exercise. The PM_2.5-related increase rate in body fat mass was higher in participants having a lower frequency of strenuous exercise or soybean intake. CONCLUSIONS Among the elderly, long-term exposure to ambient PM_2.5 is associated with a faster decline in grip strength and skeletal muscle mass, and an increase in body fat mass. Susceptibility to PM_2.5 may be influenced by age, physical activity, and dietary protein intake; however, these modifying effects vary across different health outcomes, and further research is needed to clarify their mechanisms and consistency.
Humans ; Hand Strength ; Aged ; Male ; Female ; Environmental Exposure/adverse effects* ; Follow-Up Studies ; Taiwan ; Air Pollution/adverse effects* ; Particulate Matter/adverse effects* ; Muscle, Skeletal/drug effects* ; Air Pollutants/adverse effects* ; Ozone/adverse effects* ; Aged, 80 and over ; Adipose Tissue/drug effects* ; Body Composition/drug effects* ; Nitrogen Dioxide/adverse effects*

Metformin has been demonstrated to attenuate hyperglycaemia by modulating the gut microbiota. However, the mechanisms through which the microbiome mediates metformin monotherapy failure (MMF) are unclear. Herein, in a prospective clinical cohort study of newly diagnosed type 2 diabetes mellitus (T2DM) patients treated with metformin monotherapy, metagenomic sequencing of faecal samples revealed that Phocaeicola vulgatus abundance was approximately 12 times higher in nonresponders than in responders. P. vulgatus rapidly hydrolysed taurine-conjugated bile acids, leading to ceramide accumulation and reversing the improvements in glucose intolerance conferred by metformin in high-fat diet-fed mice. Interestingly, C22:0 ceramide bound to mitochondrial fission factor to induce mitochondrial fragmentation and impair hepatic oxidative phosphorylation in P. vulgatus-colonized hyperglycaemic mice, which could be exacerbated by metformin. This work suggests that metformin may be unsuitable for P. vulgatus-rich T2DM patients and that clinicians should be aware of metformin toxicity to mitochondria. Suppressing P. vulgatus growth with cefaclor or improving mitochondrial function using adenosylcobalamin may represent simple, safe, effective therapeutic strategies for addressing MMF.

OBJECTIVE: We aimed to investigate the patterns of fasting blood glucose (FBG) trajectories and analyze the relationship between various occupational hazard factors and FBG trajectories in male steelworkers. METHODS: The study cohort included 3,728 workers who met the selection criteria for the Tanggang Occupational Cohort (TGOC) between 2017 and 2022. A group-based trajectory model was used to identify the FBG trajectories. Environmental risk scores (ERS) were constructed using regression coefficients from the occupational hazard model as weights. Univariate and multivariate logistic regression analyses were performed to explore the effects of occupational hazard factors using the ERS on FBG trajectories. RESULTS: FBG trajectories were categorized into three groups. An association was observed between high temperature, noise exposure, and FBG trajectory ( P < 0.05). Using the first quartile group of ERS1 as a reference, the fourth quartile group of ERS1 had an increased risk of medium and high FBG by 1.90 and 2.21 times, respectively (odds ratio [ OR] = 1.90, 95% confidence interval [ CI]: 1.17-3.10; OR = 2.21, 95% CI: 1.09-4.45). CONCLUSION An association was observed between occupational hazards based on ERS and FBG trajectories. The risk of FBG trajectory levels increase with an increase in ERS.
Humans ; Male ; Adult ; Blood Glucose/analysis* ; China ; Prospective Studies ; Occupational Exposure/adverse effects* ; Risk Factors ; Middle Aged ; Steel ; Fasting/blood* ; Metal Workers ; East Asian People

OBJECTIVE: Cigarette smoking exacerbates the progression of pulmonary tuberculosis (TB). The role of tertiary lymphoid structures (TLS) in chronic lung diseases has gained attention; however, it remains unclear whether smoking-exacerbated lung damage in TB is associated with TLS. This study aimed to analyze the characteristics of pulmonary TLS in smokers with TB and to explore the possible role of TLS in smoking-related lung injury in TB. METHODS: Lung tissues from 36 male patients (18 smokers and 18 non-smokers) who underwent surgical resection for pulmonary TB were included in this study. Pathological and immunohistological analyses were conducted to evaluate the quantity of TLS, and chest computed tomography (CT) was used to assess the severity of lung lesions. The correlation between the TLS quantity and TB lesion severity scores was analyzed. The immune cells and chemokines involved in TLS formation were also evaluated and compared between smokers and non-smokers. RESULTS: Smoker patients with TB had significantly higher TLS than non-smokers ( P < 0.001). The TLS quantity in both the lung parenchyma and peribronchial regions correlated with TB lesion severity on chest CT (parenchyma: r = 0.5767; peribronchial: r = 0.7373; both P < 0.001). Immunohistochemical analysis showed increased B cells, T cells, and C-X-C motif chemokine ligand 13 (CXCL13) expression in smoker patients with TB ( P < 0.001). CONCLUSION Smoker TB patients exhibited increased pulmonary TLS, which was associated with exacerbated lung lesions on chest CT, suggesting that cigarette smoking may exacerbate lung damage by promoting TLS formation.
Humans ; Male ; Tuberculosis, Pulmonary/immunology* ; Middle Aged ; Tertiary Lymphoid Structures/pathology* ; Adult ; Lung/pathology* ; Smoking/adverse effects* ; Smokers ; Aged ; Tomography, X-Ray Computed

Objective:To explore the pathogenesis and potential biomarkers of atrial fibrillation based on bioinformatics.Methods:Differentially expressed genes and module genes related to atrial fibrillation were obtained from GSE41177 and GSE79768 datasets(Chinese-origin tissue samples)through differential expression analysis and weighted gene co-expression network analysis.Candidate hub genes were obtained by taking intersections,and hub genes were obtained after gender stratification.Subsequently,functional enrichment analysis and immune infiltration analysis were performed.Four machine learning models were constructed based on the hub genes,and the optimal model was selected to construct a prediction nomogram.The prediction ability of the nomogram was verified using calibration curves and decision curves.Finally,potential therapeutic drugs for atrial fibrillation were screened from the DGIdb database.Results:A total of 67 differentially expressed genes and 65 module genes related to atrial fibrillation were identified.Functional enrichment analysis indicated that the pathogenesis of atrial fibrillation was closely related to inflammatory response,immune response,and immune and infectious diseases.Four common hub genes(TYROBP,FCER1G,EVI2B and SOD2),and two genes specifically expressed in male(PILRA and SLC35G3)and female(HLA-DRA and GATP)patients with atrial fibrillation were obtained after gender-segregated screening.The extreme gradient boosting model had satisfactory diagnostic efficiency,and the nomogram constructed based on the hub genes,male significant variables(PILRA,SLC35G3 and SOD2),and female significant variables(FCER1G,SOD2 and TYRO BP)had satisfactory predictive ability.Immune infiltration analysis demonstrated a disturbed immune infiltration microenvironment in atrial fibrillation with a higher abundance of plasma cells,neutrophils,and γδT cells,with a higher abundance of neutrophils in males and resting mast cells in females.Two potential drugs for the treatment of atrial fibrillation,valproic acid and methotrexate,were obtained by database and literature screening.Conclusions:The pathogenesis of atrial fibrillation is closely related to inflammation and immune response,and the microenvironment of immune cell infiltration of cardiomyocytes in the atrial tissue of patients with atrial fibrillation is disordered.TYROBP,FCER1G,EVI2B and SOD2 serve as potential diagnostic biomarkers of atrial fibrillation;PILRA and SLC35G3 serve as potential specific diagnostic biomarkers of atrial fibrillation in the male population,which can effectively predict the risk of atrial fibrillation development and are also potential targets for the treatment of atrial fibrillation.

Objective To establish a normal three-dimensional model of the hip bone in adolescents aged 10-19 years old,analyze the morphology and positional parameters of the posterior superior iliac spine of the hip bone among different genders,sides,and ages,which can supplement the study of the anatomical morphology of the hip bone and to provide a reference for the diagnosis of the clinically relevant diseases and for the therapeutic manipulation and localization of the hip bone.Methods Forty adolescent patients aged 10-19 years without previous spinal pelvic diseases were selected,and the pelvic CT image data were collected and imported into Mimics 21.0 software to establish the model.The relative position parameters of the posterior superior iliac spine and the surrounding anatomical landmarks included the length from the posterior superior iliac spine to the anterior superior iliac spine(ab),the length from the tip of the posterior superior iliac spine to the sciatica(ac),the length from the tip of the posterior superior iliac spine to the pubic tubercle(ae),the length from the tip of the posterior superior iliac spine to the midpoint of the posterior margin of the auricular joint surfaces(af),the length from the tip of the posterior superior iliac spine to the iliac spine turn(ag),and the length from the sciatica tubercle to the highest point of the iliac spine(cd).The local parameters of the posterior superior iliac spine included the width(W0)and the thickness(H0)at point A.The maximum width of the posterior iliac spine(WMAX),its distance from point a(D0),and the width of the iliac spine were measured at 0.5,1,and 1.5 cm from point a,and were recorded sequentially as W1,W2,and W3.The width of the iliac spine at the turn of the iliac spine(point g)was measured(W4).The relative positions and parameters of the posterior superior iliac spine to the surrounding anatomical landmarks and the localized parameters of the posterior superior iliac spine were compared sequentially for different genders,sides,and age groups.Results In the measurement result of the parameters of the posterior superior iliac spine and the surrounding anatomical landmarks,the differences in the comparisons between different genders of the ac,ae,and af indexes were statistically significant(P＜0.05),and the differences in the comparisons between different genders of the ab,ag,and cd indexes were not statistically significant(P＞0.05).The differences in the comparisons between the right and left sides of the ab,ac,ae,af,ag,and cd indexes were not statistically significant(P＞0.05).The difference in comparison between different age groups of ab,ac,ae,af,ag,and cd indicators was statistically significant(P＜0.05).In the measurement result of the local parameters of the posterior superior iliac spine,the difference in the comparison between the sexes of the W0,W1,W2,WMAX,and H0 indexes was statistically significant(P＜0.05),and the difference in the comparison between the sexes of the W3,W4,and D0 indexes was not statistically significant(P＞0.05);And the difference in the comparison between the left and right sides of the W0,W1,W2,and the right and left sides of the W3,W4,WMAX,D0,and H0 indexes was not statistically significant(P＞0.05);The difference between W0,W1,W2,W3,W4,WMAX,D0,H0 indicators compared between different age groups was not statistically significant(P＞0.05).Conclusion Adolescent females have overall greater pelvic parameters than males,with wider and thicker tips of the posterior superior iliac spine in females and narrower and thinner tips of the posterior superior iliac spine in males;Pelvic parameters show a tendency to increase with age,while the width and thickness of the posterior superior iliac spine,as well as the width of the cephalic end to the iliac spine remain essentially unchanged.