1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Study on anti-atherosclerosis mechanism of blood components of Guanxin Qiwei tablets based on HPLC-Q-Exactive-MS/MS and network pharmacology
Yuan-hong LIAO ; Jing-kun LU ; Yan NIU ; Jun LI ; Ren BU ; Peng-peng ZHANG ; Yue KANG ; Yue-wu WANG
Acta Pharmaceutica Sinica 2025;60(2):449-458
The analysis presented here is based on the blood components of Guanxin Qiwei tablets, the key anti-atherosclerosis pathway of Guanxin Qiwei tablets was screened by network pharmacology, and the anti-atherosclerosis mechanism of Guanxin Qiwei tablets was clarified and verified by cell experiments. HPLC-Q-Exactive-MS/MS technique was used to analyze the components of Guanxin Qiwei tablets into blood, to determine the precise mass charge ratio of the compounds, and to conduct a comprehensive analysis of the components by using secondary mass spectrometry fragments and literature comparison. Finally, a total of 42 components of Guanxin Qiwei tablets into blood were identified. To better understand the interactions, we employed the Swiss Target Prediction database to predict the associated targets. Atherosclerosis (AS) disease targets were searched in disease databases Genecard, OMIM and Disgent, and 181 intersection targets of disease targets and component targets were obtained by Venny 2.1.0 software. Protein interactions were analyzed by String database. The 32 core targets were selected by Cytscape software. Gene Ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were performed in DAVID database. It was found that the anti-atherosclerosis pathways of Guanxin Qiwei tablets mainly include lipid metabolism and atherosclerosis and AGE-RAGE signaling pathway in diabetic complications and other signal pathways. The core targets and the core compounds were interlinked, and it was found that cryptotanshinone and tanshinone ⅡA in Guanxin Qiwei tablets were well bound to TNF, PPAR
3.Ameliorative effects of Lycii Fructus-Chrysanthemi Flos at different ratios on retinal damage in mice.
Bing LI ; Sheng GUO ; Yue ZHU ; Xue-Sen WANG ; Dan-Dan WEI ; Hong-Jie KANG ; Wen-Hua ZHANG ; Jin-Ao DUAN
China Journal of Chinese Materia Medica 2025;50(3):732-740
This study aimed to compare the ameliorative effects of Lycii Fructus and Chrysanthemi Flos at different ratios on retinal damage in mice and to elucidate the underlying mechanisms. A retinal injury model was established by intraperitoneal injection of sodium iodate(NaIO_3) solution. The mice were divided into the following groups: blank group, model group, positive drug(AREDS 2) group, low-and high-dose groups of Lycii Fructus and Chrysanthemi Flos at 1∶1, low-and high-dose groups at 3∶1, and low-and high-dose groups at 1∶3. Administration was carried out 15 days after modeling. The visual acuity of the mice was assessed using the black-and-white box test. The fundus was observed using an optical coherence tomography device, and retinal thickness was measured. HE staining was used to observe the morphology and pathological changes of the retina. The levels of oxidative factors in serum and ocular tissues were measured using assay kits. The levels of inflammatory factors in serum and ocular tissues were detected by enzyme-linked immunosorbent assay(ELISA), and the expression of Nrf2, HO-1, and NF-κB proteins in ocular tissues was analyzed by Western blot. The results showed that after administration of Lycii Fructus and Chrysanthemi Flos at different ratios, the model group showed improved retinal thinning and disordered arrangement of retinal layers, elevated content of SOD and GSH in the serum and ocular tissues, and reduced levels of MDA, TNF-α, IL-1β, and IL-6. Lycii Fructus and Chrysanthemi Flos at 1∶1 and 1∶3 showed better improvement effects. The combination significantly upregulated the expression levels of Nrf2 and HO-1 and downregulated the expression of NF-κB p65. These results indicate that Lycii Fructus and Chrysanthemi Flos at different ratios can improve retinal damage, reduce oxidative stress, and alleviate inflammation in both the body and ocular tissues of mice. The mechanism may be related to the regulation of the Nrf2/HO-1 and NF-κB signaling pathways in ocular tissues. These findings provide a theoretical basis for the clinical application of Lycii Fructus and Chrysanthemi Flos in the treatment of dry age-related macular degeneration.
Animals
;
Mice
;
Retina/injuries*
;
Male
;
Lycium/chemistry*
;
Drugs, Chinese Herbal/administration & dosage*
;
Chrysanthemum/chemistry*
;
NF-kappa B/genetics*
;
Humans
;
Retinal Diseases/metabolism*
;
NF-E2-Related Factor 2/metabolism*
;
Oxidative Stress/drug effects*
;
Flowers/chemistry*
;
Heme Oxygenase-1/genetics*
4.Air pollution exposure associated with decline rates in skeletal muscle mass and grip strength and increase rate in body fat in elderly: a 5-year follow-up study.
Chi-Hsien CHEN ; Li-Ying HUANG ; Kang-Yun LEE ; Chih-Da WU ; Shih-Chun PAN ; Yue Leon GUO
Environmental Health and Preventive Medicine 2025;30():56-56
BACKGROUND:
The effect of air pollution on annual change rates in grip strength and body composition in the elderly is unknown.
OBJECTIVES:
This study evaluated the effects of long-term exposure to ambient air pollution on change rates of grip strength and body composition in the elderly.
METHODS:
In the period 2016-2020, grip strength and body composition were assessed and measured 1-2 times per year in 395 elderly participants living in the Taipei basin. Exposure to ambient fine particulate matters (PM2.5), nitric dioxide (NO2), and ozone (O3) from 2015 to 2019 was estimated using a hybrid Kriging/Land-use regression model. In addition, long-term exposure to carbon monoxide (CO) was estimated using an ordinary Kriging approach. Associations between air pollution exposures and annual changes in health outcomes were analyzed using linear mixed-effects models.
RESULTS:
An inter-quartile range (4.1 µg/m3) increase in long-term exposure to PM2.5 was associated with a faster decline rate in grip strength (-0.16 kg per year) and skeletal muscle mass (-0.14 kg per year), but an increase in body fat mass (0.21 kg per year). The effect of PM2.5 remained robust after adjustment for NO2, O3 and CO exposure. In subgroup analysis, the PM2.5-related decline rate in grip strength was greater in participants with older age (>70 years) or higher protein intake, whereas in skeletal muscle mass, the decline rate was more pronounced in participants having a lower frequency of moderate or strenuous exercise. The PM2.5-related increase rate in body fat mass was higher in participants having a lower frequency of strenuous exercise or soybean intake.
CONCLUSIONS
Among the elderly, long-term exposure to ambient PM2.5 is associated with a faster decline in grip strength and skeletal muscle mass, and an increase in body fat mass. Susceptibility to PM2.5 may be influenced by age, physical activity, and dietary protein intake; however, these modifying effects vary across different health outcomes, and further research is needed to clarify their mechanisms and consistency.
Humans
;
Hand Strength
;
Aged
;
Male
;
Female
;
Environmental Exposure/adverse effects*
;
Follow-Up Studies
;
Taiwan
;
Air Pollution/adverse effects*
;
Particulate Matter/adverse effects*
;
Muscle, Skeletal/drug effects*
;
Air Pollutants/adverse effects*
;
Ozone/adverse effects*
;
Aged, 80 and over
;
Adipose Tissue/drug effects*
;
Body Composition/drug effects*
;
Nitrogen Dioxide/adverse effects*
5.Advantages of Chinese Medicines for Diabetic Retinopathy and Mechanisms: Focused on Inflammation and Oxidative Stress.
Li-Shuo DONG ; Chong-Xiang XUE ; Jia-Qi GAO ; Yue HU ; Ze-Zheng KANG ; A-Ru SUN ; Jia-Rui LI ; Xiao-Lin TONG ; Xiu-Ge WANG ; Xiu-Yang LI
Chinese journal of integrative medicine 2025;31(11):1046-1055
6.A critical role for Phocaeicola vulgatus in negatively impacting metformin response in diabetes.
Manyun CHEN ; Yilei PENG ; Yuhui HU ; Zhiqiang KANG ; Ting CHEN ; Yulong ZHANG ; Xiaoping CHEN ; Qing LI ; Zuyi YUAN ; Yue WU ; Heng XU ; Gan ZHOU ; Tao LIU ; Honghao ZHOU ; Chunsu YUAN ; Weihua HUANG ; Wei ZHANG
Acta Pharmaceutica Sinica B 2025;15(5):2511-2528
Metformin has been demonstrated to attenuate hyperglycaemia by modulating the gut microbiota. However, the mechanisms through which the microbiome mediates metformin monotherapy failure (MMF) are unclear. Herein, in a prospective clinical cohort study of newly diagnosed type 2 diabetes mellitus (T2DM) patients treated with metformin monotherapy, metagenomic sequencing of faecal samples revealed that Phocaeicola vulgatus abundance was approximately 12 times higher in nonresponders than in responders. P. vulgatus rapidly hydrolysed taurine-conjugated bile acids, leading to ceramide accumulation and reversing the improvements in glucose intolerance conferred by metformin in high-fat diet-fed mice. Interestingly, C22:0 ceramide bound to mitochondrial fission factor to induce mitochondrial fragmentation and impair hepatic oxidative phosphorylation in P. vulgatus-colonized hyperglycaemic mice, which could be exacerbated by metformin. This work suggests that metformin may be unsuitable for P. vulgatus-rich T2DM patients and that clinicians should be aware of metformin toxicity to mitochondria. Suppressing P. vulgatus growth with cefaclor or improving mitochondrial function using adenosylcobalamin may represent simple, safe, effective therapeutic strategies for addressing MMF.
7.Occupational Hazard Factors and the Trajectory of Fasting Blood Glucose Changes in Chinese Male Steelworkers Based on Environmental Risk Scores: A Prospective Cohort Study.
Ming Xia ZOU ; Wei DU ; Qin KANG ; Yu Hao XIA ; Nuo Yun ZHANG ; Liu FENG ; Fei Yue LI ; Tian Cheng MA ; Ya Jing BAO ; Hong Min FAN
Biomedical and Environmental Sciences 2025;38(6):666-677
OBJECTIVE:
We aimed to investigate the patterns of fasting blood glucose (FBG) trajectories and analyze the relationship between various occupational hazard factors and FBG trajectories in male steelworkers.
METHODS:
The study cohort included 3,728 workers who met the selection criteria for the Tanggang Occupational Cohort (TGOC) between 2017 and 2022. A group-based trajectory model was used to identify the FBG trajectories. Environmental risk scores (ERS) were constructed using regression coefficients from the occupational hazard model as weights. Univariate and multivariate logistic regression analyses were performed to explore the effects of occupational hazard factors using the ERS on FBG trajectories.
RESULTS:
FBG trajectories were categorized into three groups. An association was observed between high temperature, noise exposure, and FBG trajectory ( P < 0.05). Using the first quartile group of ERS1 as a reference, the fourth quartile group of ERS1 had an increased risk of medium and high FBG by 1.90 and 2.21 times, respectively (odds ratio [ OR] = 1.90, 95% confidence interval [ CI]: 1.17-3.10; OR = 2.21, 95% CI: 1.09-4.45).
CONCLUSION
An association was observed between occupational hazards based on ERS and FBG trajectories. The risk of FBG trajectory levels increase with an increase in ERS.
Humans
;
Male
;
Adult
;
Blood Glucose/analysis*
;
China
;
Prospective Studies
;
Occupational Exposure/adverse effects*
;
Risk Factors
;
Middle Aged
;
Steel
;
Fasting/blood*
;
Metal Workers
;
East Asian People
8.Increased Tertiary Lymphoid Structures are Associated with Exaggerated Lung Tissue Damage in Smokers with Pulmonary Tuberculosis.
Yue ZHANG ; Liang LI ; Zi Kang SHENG ; Ya Fei RAO ; Xiang ZHU ; Yu PANG ; Meng Qiu GAO ; Xiao Yan GAI ; Yong Chang SUN
Biomedical and Environmental Sciences 2025;38(7):810-818
OBJECTIVE:
Cigarette smoking exacerbates the progression of pulmonary tuberculosis (TB). The role of tertiary lymphoid structures (TLS) in chronic lung diseases has gained attention; however, it remains unclear whether smoking-exacerbated lung damage in TB is associated with TLS. This study aimed to analyze the characteristics of pulmonary TLS in smokers with TB and to explore the possible role of TLS in smoking-related lung injury in TB.
METHODS:
Lung tissues from 36 male patients (18 smokers and 18 non-smokers) who underwent surgical resection for pulmonary TB were included in this study. Pathological and immunohistological analyses were conducted to evaluate the quantity of TLS, and chest computed tomography (CT) was used to assess the severity of lung lesions. The correlation between the TLS quantity and TB lesion severity scores was analyzed. The immune cells and chemokines involved in TLS formation were also evaluated and compared between smokers and non-smokers.
RESULTS:
Smoker patients with TB had significantly higher TLS than non-smokers ( P < 0.001). The TLS quantity in both the lung parenchyma and peribronchial regions correlated with TB lesion severity on chest CT (parenchyma: r = 0.5767; peribronchial: r = 0.7373; both P < 0.001). Immunohistochemical analysis showed increased B cells, T cells, and C-X-C motif chemokine ligand 13 (CXCL13) expression in smoker patients with TB ( P < 0.001).
CONCLUSION
Smoker TB patients exhibited increased pulmonary TLS, which was associated with exacerbated lung lesions on chest CT, suggesting that cigarette smoking may exacerbate lung damage by promoting TLS formation.
Humans
;
Male
;
Tuberculosis, Pulmonary/immunology*
;
Middle Aged
;
Tertiary Lymphoid Structures/pathology*
;
Adult
;
Lung/pathology*
;
Smoking/adverse effects*
;
Smokers
;
Aged
;
Tomography, X-Ray Computed
9.Enhancing antimicrobial resistance detection with MetaGeneMiner: Targeted gene extraction from metagenomes
Chang LIU ; Zizhen TANG ; Linzhu LI ; Yan KANG ; Yue TENG ; Yan YU
Chinese Medical Journal 2024;137(17):2092-2098
Background::Accurately and efficiently extracting microbial genomic sequences from complex metagenomic data is crucial for advancing our understanding in fields such as clinical diagnostics, environmental microbiology, and biodiversity. As sequencing technologies evolve, this task becomes increasingly challenging due to the intricate nature of microbial communities and the vast amount of data generated. Especially in intensive care units (ICUs), infections caused by antibiotic-resistant bacteria are increasingly prevalent among critically ill patients, significantly impacting the effectiveness of treatments and patient prognoses. Therefore, obtaining timely and accurate information about infectious pathogens is of paramount importance for the treatment of patients with severe infections, which enables precisely targeted anti-infection therapies, and a tool that can extract microbial genomic sequences from metagenomic dataset would be of help.Methods::We developed MetaGeneMiner to help with retrieving specific microbial genomic sequences from metagenomes using a k-mer-based approach. It facilitates the rapid and accurate identification and analysis of pathogens. The tool is designed to be user-friendly and efficient on standard personal computers, allowing its use across a wide variety of settings. We validated MetaGeneMiner using eight metagenomic samples from ICU patients, which demonstrated its efficiency and accuracy.Results::The software extensively retrieved coding sequences of pathogens Acinetobacter baumannii and herpes simplex virus type 1 and detected a variety of resistance genes. All documentation and source codes for MetaGeneMiner are freely available at https://gitee.com/sculab/MetaGeneMiner. Conclusions::It is foreseeable that MetaGeneMiner possesses the potential for applications across multiple domains, including clinical diagnostics, environmental microbiology, gut microbiome research, as well as biodiversity and conservation biology. Particularly in ICU settings, MetaGeneMiner introduces a novel, rapid, and precise method for diagnosing and treating infections in critically ill patients. This tool is capable of efficiently identifying infectious pathogens, guiding personalized and precise treatment strategies, and monitoring the development of antibiotic resistance, significantly impacting the diagnosis and treatment of severe infections.
10.Pathogenesis and potential diagnostic biomarkers of atrial fibrillation in Chinese population:a study based on bioinfor-matics
Xize WU ; Yue LI ; Jiaxiang PAN ; Jian KANG ; Xue PAN ; Chentian XUE ; Lihong GONG
Journal of Zhejiang University. Medical sciences 2024;53(5):593-603
Objective:To explore the pathogenesis and potential biomarkers of atrial fibrillation based on bioinformatics.Methods:Differentially expressed genes and module genes related to atrial fibrillation were obtained from GSE41177 and GSE79768 datasets(Chinese-origin tissue samples)through differential expression analysis and weighted gene co-expression network analysis.Candidate hub genes were obtained by taking intersections,and hub genes were obtained after gender stratification.Subsequently,functional enrichment analysis and immune infiltration analysis were performed.Four machine learning models were constructed based on the hub genes,and the optimal model was selected to construct a prediction nomogram.The prediction ability of the nomogram was verified using calibration curves and decision curves.Finally,potential therapeutic drugs for atrial fibrillation were screened from the DGIdb database.Results:A total of 67 differentially expressed genes and 65 module genes related to atrial fibrillation were identified.Functional enrichment analysis indicated that the pathogenesis of atrial fibrillation was closely related to inflammatory response,immune response,and immune and infectious diseases.Four common hub genes(TYROBP,FCER1G,EVI2B and SOD2),and two genes specifically expressed in male(PILRA and SLC35G3)and female(HLA-DRA and GATP)patients with atrial fibrillation were obtained after gender-segregated screening.The extreme gradient boosting model had satisfactory diagnostic efficiency,and the nomogram constructed based on the hub genes,male significant variables(PILRA,SLC35G3 and SOD2),and female significant variables(FCER1G,SOD2 and TYRO BP)had satisfactory predictive ability.Immune infiltration analysis demonstrated a disturbed immune infiltration microenvironment in atrial fibrillation with a higher abundance of plasma cells,neutrophils,and γδT cells,with a higher abundance of neutrophils in males and resting mast cells in females.Two potential drugs for the treatment of atrial fibrillation,valproic acid and methotrexate,were obtained by database and literature screening.Conclusions:The pathogenesis of atrial fibrillation is closely related to inflammation and immune response,and the microenvironment of immune cell infiltration of cardiomyocytes in the atrial tissue of patients with atrial fibrillation is disordered.TYROBP,FCER1G,EVI2B and SOD2 serve as potential diagnostic biomarkers of atrial fibrillation;PILRA and SLC35G3 serve as potential specific diagnostic biomarkers of atrial fibrillation in the male population,which can effectively predict the risk of atrial fibrillation development and are also potential targets for the treatment of atrial fibrillation.

Result Analysis
Print
Save
E-mail