To investigate the effect of mesenchymal stromal cells (MSCs) on the fibrosis progression and endometrial regeneration in mouse models of endometrial injury, a mouse endometrial injury model was established by physical scraping combined with lipopolysaccharide (LPS) chemical induction, and the endometrium morphology and collagen deposition were evaluated by HE and Masson staining after unilateral administration of MSCs. RT-qPCR and immunofluorescence were used to detect the expression of epithelial markers Epcam and collagen I (Col1). Primary endometrial epithelial cells were isolated to assess p21 expression. Fibrosis-related genes and signaling pathways were validated using transcriptome sequencing and RT-qPCR. The experimental results showed that MSCs increased endometrial thickness and number of glands (P<0.05), up-regulated the expression of Epcam (P<0.01), while significantly reducing uterine collagen fiber deposition (P<0.05) and the expression of p21 in primary epithelial cells (P<0.0001). Transcriptomic analysis revealed that MSCs attenuated collagen deposition by modulating genes involved in the TGF-β signaling pathway. This study elucidates that MSCs facilitate uterine repair by reversing endometrial fibrosis and promoting epithelial regeneration, and their role is related to the regulation of the TGF-β/SMAD pathway and suppression of aberrant collagen accumulation.

Since its emergence in the 1980s, the human immunodeficiency virus (HIV) has caused a global pandemic, posing a severe threat to human life and health as well as social development. Although pre-exposure prophylaxis (PrEP) effectively curbs HIV transmission and antiretroviral therapy (ART) significantly extends the lifespan of patients, vaccines remain a pivotal tool for blocking transmission and ending the pandemic. The high genetic variability of HIV-1, the glycan shield of its envelope glycoproteins, and the long-term persistence of latent reservoirs have repeatedly led to bottlenecks in traditional vaccine strategies. In recent years, mRNA technology has offered a novel approach to addressing these challenges, leveraging advantages such as sequence programmability, short production cycles, native conformational expression of antigens, and self-adjuvant effects. In recent years, mRNA vaccine technology has emerged as a transformative solution to longstanding vaccinology challenges, characterized by its sequence programmability, rapid production cycles, native conformational antigen expression, and intrinsic self-adjuvanting properties. Unlike traditional platforms reliant on pathogen culture or recombinant proteins, mRNA vaccines can be expeditiously designed and updated based solely on viral genomic sequences. Lipid nanoparticle (LNP)-encapsulated mRNA facilitates endogenous antigen expression and presentation, simultaneously eliciting potent humoral and cellular immune responses. Within this landscape, self-amplifying mRNA (saRNA) further extends in vivo antigen expression to enhance the persistence of immune responses. Moreover, the LNP delivery system not only protects mRNA from degradation and mediates endosomal escape but also synergizes with mRNA to optimize immune activation via self-adjuvant effects. Importantly, mRNA platforms circumvent the pre-existing immunity associated with viral vectors and the genomic integration risks of DNA vaccines, positioning them as a cornerstone for global pandemic preparedness. This review systematically delineates recent advances in mRNA technology for HIV-1 vaccine development, focusing on four pivotal research frontiers. First, mRNA innovations building upon the RV144 trial optimize antigens through codon modification and multivalent designs to induce more durable and broad-spectrum immunity. Second, particulate mRNA vaccine strategies, utilizing virus-like particles (VLPs) and ferritin nanoparticles, achieve in situ antigen self-assembly, significantly enhancing B cell activation and reducing infection risks in non-human primate models. Third, germline-targeting mRNA vaccines address the low-affinity barrier of broadly neutralizing antibody (bNAp) precursors, efficiently activating rare precursor B cells and promoting affinity maturation. Fourth, therapeutic mRNA vaccines offer unique advantages for an HIV functional cure; combining immunogens with mRNA-encoded adjuvants potentiates cellular immunity, while LNP-mediated “shock-and-kill” strategies specifically activate latent reservoirs to guide immune clearance. Comparative analyses with traditional platforms reveal that mRNA technology redefines antigen production and presentation, simulating chronic infection through sustained expression and enabling dual-pathway presentation via endogenous synthesis. Furthermore, we explore the mechanistic innovations of mRNA vaccines in inducing bNAps: sustained in vivo production prolongs the activation window for precursor B cells and maintains germinal center (GC) reactions; endogenously expressed antigens adopt native conformations to expose conserved epitopes; and self-adjuvanting effects modulate the functions of antigen-presenting cells (APCs) and follicular helper T cells (Tfh), driving somatic hypermutation and affinity maturation. We also address critical clinical translation challenges, including immune durability, adaptability to special populations, and large-scale LNP manufacturing, while proposing targeted optimization strategies. In conclusion, this review establishes a theoretical framework for utilizing mRNA technology to overcome HIV-1 immune escape, transitioning from a descriptive paradigm to a problem-solving-based synthesis of evidence. By integrating preclinical and early clinical data, we bridge the gap between basic design and translational verification. mRNA technology is poised to become a central pillar inHIV-1 prevention and therapy, providing a robust toolset to achieve the global goal of ending the AIDS pandemic and offering a blueprint for vaccine development against other recalcitrant infectious diseases.

ObjectiveThe malaria parasites remodel the host erythrocyte structure by exporting parasite proteins that interact with the membrane skeleton proteins of red blood cells (RBCs), facilitating their intracellular survival and pathogenicity. Skeleton-binding protein 1 (SBP1) is a conserved exported protein across Plasmodium species. In Plasmodium falciparum, SBP1 has been reported to interact with erythrocyte membrane skeleton proteins 4.1R and spectrin, while its contribution to erythrocyte remodeling and parasite virulence in Plasmodium berghei (Pb) remains unclear. This study aims to determine whether PbSBP1 associates with the host cytoskeletal protein 4.1R and to investigate its role in the remodeling of host RBCs and the pathogenicity of Plasmodium berghei. MethodsIn Plasmodium berghei, the relationship between PbSBP1 and the erythrocyte cytoskeletal protein 4.1R was examined using co-immunoprecipitation. A Pbsbp1 gene knockout mutant of Plasmodium berghei (Pbsbp1∆) was generated based on the principle of double crossover homologous recombination. The deformability of erythrocytes infected with Pbsbp1∆ parasites was assessed using microfluidic methods. Microchannels with an array of cylindrical pillars were used to detect modifications in infected RBC deformability. The infected RBCs were squashed between the rows and recovered between the columns and the transit velocity (μm/s) of infected RBCs travelling through the microchannel was recorded. The component of the erythrocyte membrane skeleton junctional complex, tropomodulin (TMOD), was fluorescently labeled, and the cytoskeletal network of infected erythrocytes was imaged using super-resolution stochastic optical reconstruction microscopy (STORM) to analyze ultrastructural changes in the cytoskeleton of wild-type (WT) and Pbsbp1∆-infected erythrocytes. Actin-based junctional complexes were displayed as individual clusters by the labeled TMOD in the STORM images, and the cluster densities and distances between adjacent clusters of infected RBCs were calculated. Additionally, rodent malaria models (BALB/c mice) and experimental cerebral malaria models (C57BL/6 mice) were employed to monitor the growth of Pbsbp1∆ and WT parasites during the intraerythrocytic stage and their capacity to induce cerebral malaria in mice. ResultsPbSBP1 may participate in the remodeling of infected erythrocytes through direct or indirect interaction with the erythrocyte cytoskeletal protein 4.1R. Microfluidic assays revealed that the deformability of erythrocytes infected with Pbsbp1∆ parasites was significantly enhanced compared to those infected with WT parasites. STORM imaging further demonstrated that the ultrastructure of the erythrocyte cytoskeleton in Pbsbp1∆-infected cells was altered relative to that in WT-infected erythrocytes. The distances between nearest neighbors of clusters had a tendency to increase while the cluster densities were decreased in Pbsbp1∆-infected RBCs compared to WT-infected RBCs. Subsequent phenotypic analysis indicated that the growth rate of Pbsbp1∆ parasites during the intraerythrocytic stage was significantly slower than that of WT parasites, and their ability to induce cerebral malaria in mice was also attenuated. These findings suggest that PbSBP1 is involved in the remodeling of the erythrocyte membrane skeleton, likely through its direct or indirect interaction with protein 4.1R, thereby regulating the deformability of infected erythrocytes and influencing the pathogenicity of the blood-stage parasites. ConclusionThis study establishes a role for PbSBP1 in host erythrocyte remodeling and parasite virulence, providing new research strategies for the prevention and treatment of malaria.

ObjectiveThis paper aims to investigate and evaluate the staged efficacy and safety of the representative empirical prescription of the “Zhu Ke Jiao” theory， Qijia Rougan prescription， combined with entecavir in the treatment of hepatic fibrosis in chronic hepatitis B. MethodsA multicenter randomized controlled clinical study was conducted， and 101 patients diagnosed with chronic hepatitis B-related hepatic fibrosis （CHB-HF） who met the diagnosis and inclusion criteria were randomly assigned to an observation group （Qijia Rougan prescription + entecavir） and a control group （entecavir）. The treatment duration was 24 weeks. Liver stiffness measurement （LSM）， fibrosis-4 index （FIB-4）， portal vein diameter， hepatitis B serology， biochemical indicators， hepatic fibrosis markers in serum ［hyaluronic acid （HA）， laminin （LN）， procollagen Ⅲ peptide （PⅢP）， and type Ⅳ collagen （Ⅳ-C）］， and traditional Chinese medicine syndrome scores were used as efficacy evaluation indicators. Efficacy assessments and explorations of different staged subgroups of Qijia Rougan prescription were conducted according to LSM values based on the Metavir pathological staging standard. ResultsA total of 98 cases were included for statistical analysis， with 49 cases in the observation group and 49 in the control group. The general data of the patients in both groups were comparable. Compared with the same group before treatment， the observation group showed a significant reduction in LSM and FIB-4 （P<0.01）， as well as notable improvements in LN， Ⅳ-C， and various TCM syndrome scores （P<0.05， P<0.01）. When compared to the control group after treatment， the observation group demonstrated significant improvements in LSM， FIB-4， and various TCM syndrome score indicators （P<0.05， P<0.01）， indicating that the observation group performed better than the control group. Subgroup analysis of the regression of hepatic fibrosis stages showed that compared to the same group before treatment， the observation group had better improvement in regression of stages F2 and F3 （P<0.05）. When compared to the control group after treatment， the observation group exhibited superior improvement in regression of stage F3 （P<0.05）. No adverse events occurred in either group during the treatment period. ConclusionCompared with entecavir alone， the combination of Qijia Rougan prescription and entecavir significantly improves the degree of hepatic fibrosis and clinical TCM symptoms in patients. The optimal intervention period is primarily during stage F3， which is a potential “interception” point of the “Zhu Ke Jiao” theory.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveThis paper aims to investigate the differential mechanisms underlying the staged therapeutic effects of Qijia Rougan formula on liver fibrosis using proteomic technology. MethodsThe staged rat model of liver fibrosis was established by subcutaneous injection of carbon tetrachloride （CCl₄） and olive oil. One hundred and four SD rats were randomized into thirteen groups：a normal group，a two-week model group，a four-week model group，a six-week model group，an eight-week model group，a two-week Qijia Rougan formula group，a four-week Qijia Rougan formula group，a six-week Qijia Rougan formula group，an eight-week Qijia Rougan formula group，a two-week compound Biejia Ruangan tablet group，a four-week Compound Biejia Ruangan Tablet group，a six-week Compound Biejia Ruangan Tablet group，and an eight-week compound Biejia Ruangan tablet group. After two weeks of drug intervention，liver tissue and abdominal aortic blood samples were collected from the rats for testing. Hematoxylin-eosin （HE） staining，Masson staining，and Picro Sirius red staining were used to observe pathological damage and collagen fiber deposition in liver tissues. Immunohistochemistry （IHC） was employed to detect the contents of fibrosis markers in liver tissues. The contents of liver function indicators in the serum were measured using a fully automated biochemical analyzer，and the levels of liver fibrosis indicators in the serum were assessed by enzyme-linked immunosorbent assay （ELISA）. Liver tissues from the normal group，each model group，and each Qijia Rougan formula group were subjected to label-free quantitative proteomic analysis to identify differential proteins among the groups，with key proteins validated by Western blot. Finally，bioinformatics analysis was performed on the differential proteins. Results（1） The staged rat model of liver fibrosis constructed with CCl₄ and olive oil showed pathological results at the 2^nd，4^th，6^th，and 8^th weeks of modeling that were consistent with the Metavir standards for the F1，F2，F3，and F4 stages. Compared with those in the normal control group，the protein expressions of α-smooth muscle actin （α-SMA） and Collagen Ⅰ were significantly increased in each stage （P<0.05）. The levels of liver function indicators in the serum，including alanine aminotransferase （ALT），aspartate aminotransferase （AST），alkaline phosphatase （ALP），direct bilirubin （DBIL），and total bilirubin （TBil） in each model group，were significantly elevated in each stage （P<0.01）. The levels of liver fibrosis indicators in the serum，including procollagen Ⅲ peptide （PⅢP），type Ⅳ collagen（Ⅳ-C），hyaluronic acid （HA），and laminin （LN） in each model group，were significantly increased in each stage （P<0.05，P<0.01）. This study successfully established a staged rat model of liver fibrosis. （2） Compared with the model groups at each stage，the administration groups showed a reduction in hepatocyte ballooning degeneration，a more orderly arrangement of hepatocytes，and a decrease of inflammatory cell infiltration. The blue-stained collagen fibers became significantly thinner and finer，with reduced and narrowed fibrous septa. The areas of collagen fibers and Picro Sirius red staining were reduced （P<0.05）. The positive areas of α-SMA and Collagen Ⅰ expression were significantly decreased （P<0.05）. The levels of ALT，AST，ALP，DBIL，and TBil in the rats of the model groups at each stage were significantly reduced （P<0.05，P<0.01）. The levels of PⅢP，Ⅳ-C，HA，and LN in the rats of the model groups at each stage were significantly decreased （P<0.05）. Among these，the improvements in all indicators were most significant in the F3 stage （P<0.01）.（3） The proteomic results show that a total of 165 differential proteins exhibit a callback trend when comparing the model groups at four stages with the normal group，and when comparing the Qijia Rougan formula group with the model group. Western blot analysis reveals that the levels of NAD（P）H：quinone oxidoreductase 1 （NQO1），mitogen-activated protein kinase 1 （MAPK1），arginase 1 （Arg1），and glutathione S-transferase α1 （GSTA1） were consistent with the proteomic results. Bioinformatics results reveal that 165 differentially expressed proteins are enriched in multiple signaling pathways. Notably，signaling pathways such as drug metabolism-cytochrome P450，arginine biosynthesis，and the peroxisome proliferator-activated receptor （PPAR） signaling pathway were found to be closely associated with liver fibrosis，suggesting that the Qijia Rougan formula may exert its staged regulatory effects on liver fibrosis by regulating these pathways. ConclusionThe Qijia Rougan formula may achieve staged regulation of liver fibrosis by regulating drug metabolism-cytochrome P450，arginine biosynthesis，and the PPAR signaling pathway.

Collagen is a major structural protein in the matrix of animal cells and the most widely distributed and abundant functional protein in mammals. Collagen’s good biocompatibility, biodegradability and biological activity make it a very valuable biomaterial. According to the source of collagen, it can be broadly categorized into two types: one is animal collagen; the other is recombinant collagen. Animal collagen is mainly extracted and purified from animal connective tissues by chemical methods, such as acid, alkali and enzyme methods, etc. Recombinant collagen refers to collagen produced by gene splicing technology, where the amino acid sequence is first designed and improved according to one’s own needs, and the gene sequence of improved recombinant collagen is highly consistent with that of human beings, and then the designed gene sequence is cloned into the appropriate vector, and then transferred to the appropriate expression vector. The designed gene sequence is cloned into a suitable vector, and then transferred to a suitable expression system for full expression, and finally the target protein is obtained by extraction and purification technology. Recombinant collagen has excellent histocompatibility and water solubility, can be directly absorbed by the human body and participate in the construction of collagen, remodeling of the extracellular matrix, cell growth, wound healing and site filling, etc., which has demonstrated significant effects, and has become the focus of the development of modern biomedical materials. This paper firstly elaborates the structure, type, and tissue distribution of human collagen, as well as the associated genetic diseases of different types of collagen, then introduces the specific process of producing animal source collagen and recombinant collagen, explains the advantages of recombinant collagen production method, and then introduces the various systems of expressing recombinant collagen, as well as their advantages and disadvantages, and finally briefly introduces the application of animal collagen, focusing on the use of animal collagen in the development of biopharmaceutical materials. In terms of application, it focuses on the use of animal disease models exploring the application effects of recombinant collagen in wound hemostasis, wound repair, corneal therapy, female pelvic floor dysfunction (FPFD), vaginal atrophy (VA) and vaginal dryness, thin endometritis (TE), chronic endometritis (CE), bone tissue regeneration in vivo, cardiovascular diseases, breast cancer (BC) and anti-aging. The mechanism of action of recombinant collagen in the treatment of FPFD and CE was introduced, and the clinical application and curative effect of recombinant collagen in skin burn, skin wound, dermatitis, acne and menopausal urogenital syndrome (GSM) were summarized. From the exploratory studies and clinical applications, it is evident that recombinant collagen has demonstrated surprising effects in the treatment of all types of diseases, such as reducing inflammation, promoting cell proliferation, migration and adhesion, increasing collagen deposition, and remodeling the extracellular matrix. At the end of the review, the challenges faced by recombinant collagen are summarized: to develop new recombinant collagen types and dosage forms, to explore the mechanism of action of recombinant collagen, and to provide an outlook for the future development and application of recombinant collagen.

Objective To explore the protective effect of hydroalcoholic extract of Portulaca oleracea L.(POHA)on ulcerative colitis(UC)and bone loss in mice.Methods The C57BL/6 mice were treated with dextran sulfate sodium(DSS)to establish UC model.A total of 50 mice were randomly assigned to including control group,DSS group,mesalazine(MS)group,low dose of POHA(POHAL)group,or high dose of POHA(POHAH)group.The control group freely drank drinking water,while the DSS,MS,POHAL and POHAH groups drank drinking water containing DSS for 8 weeks.Since the 2nd week,the control group and DSS group were given normal saline by gavage.The MS group was given MS(100 mg/kg)by gavage.The POHAL group and POHAH group were given POHA(1 000 mg/kg and 2 000 mg/kg)by gavage,respectively.Body weight and disease activity index(DAI)were recorded and calculated every 2 d.On the 56th day,the colon weight index,liver index,and spleen index were calculated,and the histological changes of colon were observed.Serum levels of bone metabolism markers and microstructure parameters of femur were detected.Results Compared with the control group,the DSS group showed significantly increased DAI score,colon weight index,liver index,and spleen index(all P＜0.01).The DSS group exhibited significant pathological damage in colon tissues and significantly increased serum levels of osteocalcin,C-terminal peptide of collagen type Ⅰ,and tartrate-resistant acid phosphatase 5b(P＜0.01).The bone loss was significant in the DSS group,manifested by markedly decreased bone mineral density(BMD),bone tissue volume to tissue volume ratio(BV/TV),trabecular bone number(Tb.N),and trabecular bone thickness(Tb.Th),and markedly increased bone surface to bone volume ratio(BS/BV)and trabecular bone separation(Tb.Sp)(P＜0.05 or P＜0.01).Compared with the DSS group,the BMD,BV/TV,Tb.N and Tb.Th of the femur in the MS group and POHAH group of mice were all increased(P＜0.05 or P＜0.01),the BS/BV all decreased(P＜0.05 or P＜0.01),and the Tb.Sp all decreased without significant differences(all P＞0.05).The above bone microstructure parameters in the POHAL group showed no significant differences compared with those in the DSS group(all P＞0.05).Conclusion POHA has protective effect on DSS-induced UC and bone loss,and the mechanism may be related to the inhibition of hyperactive bone metabolism.

Post-translational modification of protein is a key mechanism for regulating cancer development and immune re-sponses,and has become an important target for cancer diagnosis and treatment.Among them,lactylation modification provides a new perspective for the precise prevention and control of tumors by affecting metabolism and epigenetics.Lactylation modification precisely regulates the functions of histone and non-histone,affecting tumor cell characteristics,microenvironment acidification,and immune cell functions,becoming a key hub connecting metabolic reprogramming and malignant phenotypes.This article reviews the regulatory roles of lactylation modification in tumor development,immune escape,clinical translation,and explores the potential of targeted inhi-bition of lactylation modification and its related pathways,as well as the inhibition of key enzyme activity.

Aim To investigate the mechanism by which Aiweixin oral liquid(AWX)alleviates myocar-dial ischemia-reperfusion injury in rats through the reg-ulation of mitochondrial fusion and fission.Methods Seventy-two healthy male Sprague-Dawley rats were randomly assigned to six groups(n=12)using a ran-dom number table:sham surgery group,model group,low-dose AWX(1 mL·kg-1)group,medium-dose AWX(2 mL·kg-1)group,high-dose AWX(4 mL·kg-1)group,and positive control drug trimetazidine(10 mg·kg-1)group.A myocardial ischemia-reper-fusion injury(MIRI)model was established by ligating the left anterior descending coronary artery of the rat heart,followed by 30 minutes of ischemia and 90 mi-nutes of reperfusion.In the sham surgery group,only a suture was placed without ligation.The rats in the treatment groups were pre-gavaged with AWX starting 10 days prior to the modeling procedure.Lead Ⅱ elec-trocardiograms were recorded before and after reperfu-sion in each group to observe the changes in electrocar-diographic parameters.The myocardial infarct size in each group was assessed using TTC staining.The his-topathological changes in myocardial tissue were exam-ined under a light microscope using hematoxylin and eosin(HE)staining.The serum levels of adenosine triphosphate(ATP)and cardiac troponin I(cTnI)were measured using enzyme-linked immunosorbent as-say(ELISA).Superoxide dismutase(SOD)activity and the levels of malondialdehyde(MDA)and lactate dehydrogenase(LDH)were determined using bio-chemical assay kits.The protein expression levels of dynamin-related protein 1(dynamin-relatedprotein 1,DRP1),mitochondrial fission factor(mitochondrial fis-sion factor,MFF),mitochondrial fission protein 1(mi-tochondrial fission protein 1,FIS1),mitofusin 1(mito-fusion-1,MFN1),and mitofusin 2(mitofusion-2,MFN2)were evaluated by Western blot analysis.Re-sults Compared with the sham group,the model group exhibited aggravated myocardial tissue pathological damage,an increased percentage of myocardial infarct size,decreased serum SOD activity and ATP levels,and significantly elevated levels of MDA,cTnI,and LDH activity.Additionally,the protein expression of mito-chondrial fission factors DRP1,MFF,and FIS1 was up-regulated,while the expression of fusion-related factors MFN1 and MFN2 was downregulated.Compared with the model group,Aiweixin oral liquid significantly alle-viated myocardial injury,reduced the percentage of my-ocardial infarct size,increased serum SOD activity and ATP levels,decreased MDA content and cTnI and LDH activity,downregulated the protein expression of mito-chondrial fission factors DRP1,MFF,and FIS1,and up-regulated the protein expression of fusion-related factors MFN1 and MFN2.Conclusion Aiweixin oral liquid alleviates myocardial ischemia-reperfusion injury in rats by regulating abnormal mitochondrial fusion and fis-sion.