AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Functional constipation （FC） is a common functional disorder of the intestines， mainly characterized by reduced bowel movement frequency， difficulty in defecation， a sensation of incomplete evacuation， and hard stools， which severely affect patients’ quality of life. Research indicates that the pathogenesis of FC is closely related to gut microbiota dysbiosis and abnormal bile acid secretion. Bile acids， as endogenous natural laxatives， promote bowel movements by enhancing colonic secretion and regulating intestinal motility； meanwhile， gut microbiota influence colonic transit function by regulating the enteric nervous system， immune system， and their metabolic products. Based on an overview of the relationship between gut microbiota and bile acid metabolism， this article systematically reviews the current research status on the mechanisms of traditional Chinese medicine （TCM） in treating FC by regulating the balance of the gut microbiota-bile acid axis. It is found that single Chinese medicinal herbs （such as Atractylodes macrocephala）， isolated compounds （such as Platycodon grandiflorum polysaccharides）， herbal formulas （such as Shanger huang pill）， acupuncture， and moxibustion can up-regulate the abundance of beneficial bacteria， reshape the microbial structure， correct bile acid metabolism， and activate the Takeda G-protein receptor 5/farnesoid X receptor pathway to treat FC.

ObjectiveThis paper aims to investigate the effects of icariin on spermatogenesis in mice with exercise-induced fatigue and explore the underlying mechanisms. MethodsICR male mice were screened by swimming and randomly divided into normal group， model group， vitamin C group， icariin groups with low， medium， and high doses， and medium-dose icariin+N-nitro-L-arginine methyl ester （L-NAME） group， with 10 mice per group. Except for the normal group， all the other groups underwent weighted swimming training to establish an exercise-induced fatigue model. No gavage was administered during the first two weeks of the weighted training. From week three to four， the icariin groups with low， medium， and high doses received 0.03， 0.06， and 0.12 g·kg^-1 icariin via gavage， respectively. The vitamin C group received 0.2 g·kg^-1 vitamin C. The L-NAME group received 0.06 g·kg^-1 icariin and 0.01 g·kg^-1 L-NAME via intraperitoneal injection. The normal and model groups received equivalent physiological saline. After the experiment， body weight and the last exhaustive swimming time were recorded. Blood urea nitrogen （BUN）， lactate （LA）， lactate dehydrogenase （LDH）， malondialdehyde （MDA）， testicular testosterone （T）， testicular Ca²⁺/Mg²⁺-adenosine triphosphatase （ATPase） （micro-assay）， and the levels of testicular cyclic guanosine monophosphate （cGMP） were measured by using kits. Sperm CD46 levels were detected by flow cytometry. Testicular seminiferous tubules were observed via hematoxylin-eosin （HE） staining， and the testicular morphometric score （TMS） was used to evaluate the spermatogenic function. Protein expression of regucalcin （RGN， SMP30）， cGMP-dependent protein kinase 1 （PKG）， and cGMP-dependent protein kinase anchoring protein （GKAP1） was detected by Western blot. Testicular regucalcin expression was examined by immunofluorescence （IF）. The epididymal sperm quality of mice was observed under a microscope. Fluorescence-stained sections of stimulated by retinoic acid gene 8 （STRA8）， synaptonemal complex protein 3 （SCP3）， and transition protein 1（TNP1） in testicular seminiferous tubules were assessed by immunohistochemistry （IHC）. ResultsCompared with the normal group， the model group showed decreased body weight and exhaustive swimming time （P<0.01）， significantly increased fatigue markers （LA， LDH， and BUN） and lipid peroxidation product MDA （P<0.01）， reduced testicular RGN， PKG， GKAP1， testosterone， Ca²⁺/Mg²⁺-ATPase， and cGMP levels （P<0.01）， decreased sperm motility， sperm count， and TMS scores， and downregulated the expression of STRA8， SCP3， and TNP1. Compared with the model group， the icariin group with high dose exhibited increased exhaustive swimming time （P<0.01）， reduced LA， LDH， BUN， and MDA levels （P<0.01）， elevated superoxide dismutase （SOD） （P<0.01）， upregulated testicular RGN， PKG， GKAP1， testosterone， Ca²⁺/Mg²⁺-ATPase， and cGMP levels （P<0.01）， improved sperm motility， sperm count， and TMS scores， and enhanced STRA8， SCP3， and TNP1 expression. Compared with the L-NAME group， the icariin group with medium dose showed increased expression of STRA8， SCP3， and TNP1 in the testicular tissue （P<0.01） and elevated cGMP and GKAP1 levels （P<0.01）. ConclusionExercise-induced fatigue reduces the expression of RGN and cGMP/PKG/GKAP1 in mice， thereby causing abnormal spermatogenesis and impairing reproductive function in mice. Icariin ameliorates spermatogenic dysfunction in exercise-induced fatigue mice by promoting the expression of RGN and cGMP/PKG/GKAP1， thereby mitigating the damage of exercise-induced fatigue to the reproductive system.

ObjectiveThis paper aims to investigate the effects of icariin on spermatogenesis in mice with exercise-induced fatigue and explore the underlying mechanisms. MethodsICR male mice were screened by swimming and randomly divided into normal group， model group， vitamin C group， icariin groups with low， medium， and high doses， and medium-dose icariin+N-nitro-L-arginine methyl ester （L-NAME） group， with 10 mice per group. Except for the normal group， all the other groups underwent weighted swimming training to establish an exercise-induced fatigue model. No gavage was administered during the first two weeks of the weighted training. From week three to four， the icariin groups with low， medium， and high doses received 0.03， 0.06， and 0.12 g·kg^-1 icariin via gavage， respectively. The vitamin C group received 0.2 g·kg^-1 vitamin C. The L-NAME group received 0.06 g·kg^-1 icariin and 0.01 g·kg^-1 L-NAME via intraperitoneal injection. The normal and model groups received equivalent physiological saline. After the experiment， body weight and the last exhaustive swimming time were recorded. Blood urea nitrogen （BUN）， lactate （LA）， lactate dehydrogenase （LDH）， malondialdehyde （MDA）， testicular testosterone （T）， testicular Ca²⁺/Mg²⁺-adenosine triphosphatase （ATPase） （micro-assay）， and the levels of testicular cyclic guanosine monophosphate （cGMP） were measured by using kits. Sperm CD46 levels were detected by flow cytometry. Testicular seminiferous tubules were observed via hematoxylin-eosin （HE） staining， and the testicular morphometric score （TMS） was used to evaluate the spermatogenic function. Protein expression of regucalcin （RGN， SMP30）， cGMP-dependent protein kinase 1 （PKG）， and cGMP-dependent protein kinase anchoring protein （GKAP1） was detected by Western blot. Testicular regucalcin expression was examined by immunofluorescence （IF）. The epididymal sperm quality of mice was observed under a microscope. Fluorescence-stained sections of stimulated by retinoic acid gene 8 （STRA8）， synaptonemal complex protein 3 （SCP3）， and transition protein 1（TNP1） in testicular seminiferous tubules were assessed by immunohistochemistry （IHC）. ResultsCompared with the normal group， the model group showed decreased body weight and exhaustive swimming time （P<0.01）， significantly increased fatigue markers （LA， LDH， and BUN） and lipid peroxidation product MDA （P<0.01）， reduced testicular RGN， PKG， GKAP1， testosterone， Ca²⁺/Mg²⁺-ATPase， and cGMP levels （P<0.01）， decreased sperm motility， sperm count， and TMS scores， and downregulated the expression of STRA8， SCP3， and TNP1. Compared with the model group， the icariin group with high dose exhibited increased exhaustive swimming time （P<0.01）， reduced LA， LDH， BUN， and MDA levels （P<0.01）， elevated superoxide dismutase （SOD） （P<0.01）， upregulated testicular RGN， PKG， GKAP1， testosterone， Ca²⁺/Mg²⁺-ATPase， and cGMP levels （P<0.01）， improved sperm motility， sperm count， and TMS scores， and enhanced STRA8， SCP3， and TNP1 expression. Compared with the L-NAME group， the icariin group with medium dose showed increased expression of STRA8， SCP3， and TNP1 in the testicular tissue （P<0.01） and elevated cGMP and GKAP1 levels （P<0.01）. ConclusionExercise-induced fatigue reduces the expression of RGN and cGMP/PKG/GKAP1 in mice， thereby causing abnormal spermatogenesis and impairing reproductive function in mice. Icariin ameliorates spermatogenic dysfunction in exercise-induced fatigue mice by promoting the expression of RGN and cGMP/PKG/GKAP1， thereby mitigating the damage of exercise-induced fatigue to the reproductive system.

The innate immune system can be boosted in response to subsequent triggers by pre-exposure to microbes or microbial products, known as “trained immunity”. Compared to classical immune memory, innate trained immunity has several different features. Firstly, the molecules involved in trained immunity differ from those involved in classical immune memory. Innate trained immunity mainly involves innate immune cells (e.g., myeloid immune cells, natural killer cells, innate lymphoid cells) and their effector molecules (e.g., pattern recognition receptor (PRR), various cytokines), as well as some kinds of non-immune cells (e.g., microglial cells). Secondly, the increased responsiveness to secondary stimuli during innate trained immunity is not specific to a particular pathogen, but influences epigenetic reprogramming in the cell through signaling pathways, leading to the sustained changes in genes transcriptional process, which ultimately affects cellular physiology without permanent genetic changes (e.g., mutations or recombination). Finally, innate trained immunity relies on an altered functional state of innate immune cells that could persist for weeks to months after initial stimulus removal. An appropriate inducer could induce trained immunity in innate lymphocytes, such as exogenous stimulants (including vaccines) and endogenous stimulants, which was firstly discovered in bone marrow derived immune cells. However, mature bone marrow derived immune cells are short-lived cells, that may not be able to transmit memory phenotypes to their offspring and provide long-term protection. Therefore, trained immunity is more likely to be relied on long-lived cells, such as epithelial stem cells, mesenchymal stromal cells and non-immune cells such as fibroblasts. Epigenetic reprogramming is one of the key molecular mechanisms that induces trained immunity, including DNA modifications, non-coding RNAs, histone modifications and chromatin remodeling. In addition to epigenetic reprogramming, different cellular metabolic pathways are involved in the regulation of innate trained immunity, including aerobic glycolysis, glutamine catabolism, cholesterol metabolism and fatty acid synthesis, through a series of intracellular cascade responses triggered by the recognition of PRR specific ligands. In the view of evolutionary, trained immunity is beneficial in enhancing protection against secondary infections with an induction in the evolutionary protective process against infections. Therefore, innate trained immunity plays an important role in therapy against diseases such as tumors and infections, which has signature therapeutic effects in these diseases. In organ transplantation, trained immunity has been associated with acute rejection, which prolongs the survival of allografts. However, trained immunity is not always protective but pathological in some cases, and dysregulated trained immunity contributes to the development of inflammatory and autoimmune diseases. Trained immunity provides a novel form of immune memory, but when inappropriately activated, may lead to an attack on tissues, causing autoinflammation. In autoimmune diseases such as rheumatoid arthritis and atherosclerosis, trained immunity may lead to enhance inflammation and tissue lesion in diseased regions. In Alzheimer’s disease and Parkinson’s disease, trained immunity may lead to over-activation of microglial cells, triggering neuroinflammation even nerve injury. This paper summarizes the basis and mechanisms of innate trained immunity, including the different cell types involved, the impacts on diseases and the effects as a therapeutic strategy to provide novel ideas for different diseases.

ObjectiveTo investigate the processing technology of calcined Haematitum based on the concept of quality by design（QbD） and to assess its health risk. MethodsTaking whole iron content， Fe²⁺ dissolution content and looseness as critical quality attributes（CQAs）， and calcination temperature， calcination time， spreading thickness and particle size as critical process parameters（CPPs） determined by the failure mode and effect analysis（FMEA）， the processing technology of calcined Haematitum was optimized by orthogonal test combined with analytic hierarchy process-criteria importance through intercriteria correlation（AHP-CRITIC） hybrid weighting method. The contents of heavy metals and harmful elements were determined by inductively coupled plasma mass spectrometry， and the health risk assessment was carried out by daily exposure（EXP）， target hazard quotient（THQ） and lifetime cancer risk（LCR）， and the theoretical value of the maximum limit was deduced. ResultsThe optimal processing technology for calcined Haematitum was calcination at 650 ℃， calcination time of 1 h， particle size of 0.2-0.5 cm， spreading thickness of 1 cm， and vinegar quenching for 1 time［Haematitum-vinegar（10：3）］. The contents of 5 heavy metals and harmful elements in 13 batches of calcined Haematitum were all decreased with reductions of up to 5-fold. The cumulative THQ of 2 batches of samples was>1， while the cumulative THQ of all batches of Haematitum was>1. The LCR of As in 1 batches of Haematitum was 1×10^-6-1×10^-4， and the LCR of the rest was<1×10^-6， and the LCRs of calcined Haematitum were all<1×10^-6， indicating that the carcinogenic risk of calcined Haematitum was low， but special attention should still be paid to Haematitum medicinal materials. Preliminary theoretical values of the maximum limits of Cu， As， Cd， Pb and Hg were formulated as 1 014， 25， 17， 27， 7 mg·kg^-1. ConclusionThe optimized processing technology of calcined Haematitum is stable and feasible， and the contents of heavy metals and harmful elements are reduced after processing. Preliminary theoretical values of the maximum limits of Cu， As， Cd， Pb and Hg are formulated to provide a scientific basis for the formulation of standards for the limits of harmful elements in Haematitum.

ObjectiveBased on the concept of quality by design（QbD）， the processing process of calcined Pyritum was optimized， and its X-ray diffraction（XRD） fingerprint was established. MethodsThe safety， effectiveness and quality controllability of calcined Pyritum were taken as the quality profile（QTPP）， the color， hardness， metallic luster， phase composition， the contents of heavy metals and hazardous elements were taken as the critical quality attributes（CQAs）， and the calcination temperature， calcination time， paving thickness and particle size were determined as the critical process parameters（CPPs）. Differential thermal analysis， X-ray diffraction（XRD） and inductively coupled plasma mass spectrometry（ICP-MS） were used to analyze the correlation between the calcination temperature and CQAs of calcined Pyritum. Then， based on the criteria importance through intercriteria correlation（CRITIC）-entropy weight method， the optimal processing process of calcined Pyritum was optimized by orthogonal test. Powder XRD was used to analyze the phase of calcined Pyritum samples processed according to the best process， and the mean and median maps of calcined Pyritum were established by the superposition of geometric topological figures， and similarity evaluation and cluster analysis were carried out. ResultsThe results of single factor experiments showed that the physical phase of Pyritum changed from FeS₂ to Fe₇S₈ during the process of temperature increase， the color gradually deepened from dark yellow， and the contents of heavy metals and harmful elements decreased. The optimized processing process of calcined Pyritum was as follows：calcination temperature at 750 ℃， calcination time of 2.5 h， paving thickness of 3 cm， particle size of 0.8-1.2 cm， vinegar quenching 1 time［Pyritum-vinegar（10∶3）］. After calcination， the internal structure of Pyritum was honeycomb-shaped， which was conducive to the dissolution of active ingredients. XRD fingerprints of 13 batches of calcined Pyritum characterized by 10 common peaks were established. The similarities of the relative peak intensities of the XRD fingerprints of the analyzed samples were>0.96， and it could effectively distinguish the raw products and unqualified products. ConclusionTemperature is the main factor affecting the quality of calcined Pyritum. After processing， the dissolution of the effective components in Pyritum increases， and the contents of heavy metals and harmful substances decrease， reflecting the function of processing to increase efficiency and reduce toxicity. The optimized processing process is stable and feasible， and the established XRD fingerprint can be used as one of the quality control standards of calcined Pyritum.

ObjectiveTo investigate the processing technology of calcined Haematitum based on the concept of quality by design（QbD） and to assess its health risk. MethodsTaking whole iron content， Fe²⁺ dissolution content and looseness as critical quality attributes（CQAs）， and calcination temperature， calcination time， spreading thickness and particle size as critical process parameters（CPPs） determined by the failure mode and effect analysis（FMEA）， the processing technology of calcined Haematitum was optimized by orthogonal test combined with analytic hierarchy process-criteria importance through intercriteria correlation（AHP-CRITIC） hybrid weighting method. The contents of heavy metals and harmful elements were determined by inductively coupled plasma mass spectrometry， and the health risk assessment was carried out by daily exposure（EXP）， target hazard quotient（THQ） and lifetime cancer risk（LCR）， and the theoretical value of the maximum limit was deduced. ResultsThe optimal processing technology for calcined Haematitum was calcination at 650 ℃， calcination time of 1 h， particle size of 0.2-0.5 cm， spreading thickness of 1 cm， and vinegar quenching for 1 time［Haematitum-vinegar（10：3）］. The contents of 5 heavy metals and harmful elements in 13 batches of calcined Haematitum were all decreased with reductions of up to 5-fold. The cumulative THQ of 2 batches of samples was>1， while the cumulative THQ of all batches of Haematitum was>1. The LCR of As in 1 batches of Haematitum was 1×10^-6-1×10^-4， and the LCR of the rest was<1×10^-6， and the LCRs of calcined Haematitum were all<1×10^-6， indicating that the carcinogenic risk of calcined Haematitum was low， but special attention should still be paid to Haematitum medicinal materials. Preliminary theoretical values of the maximum limits of Cu， As， Cd， Pb and Hg were formulated as 1 014， 25， 17， 27， 7 mg·kg^-1. ConclusionThe optimized processing technology of calcined Haematitum is stable and feasible， and the contents of heavy metals and harmful elements are reduced after processing. Preliminary theoretical values of the maximum limits of Cu， As， Cd， Pb and Hg are formulated to provide a scientific basis for the formulation of standards for the limits of harmful elements in Haematitum.

ObjectiveBased on the concept of quality by design（QbD）， the processing process of calcined Pyritum was optimized， and its X-ray diffraction（XRD） fingerprint was established. MethodsThe safety， effectiveness and quality controllability of calcined Pyritum were taken as the quality profile（QTPP）， the color， hardness， metallic luster， phase composition， the contents of heavy metals and hazardous elements were taken as the critical quality attributes（CQAs）， and the calcination temperature， calcination time， paving thickness and particle size were determined as the critical process parameters（CPPs）. Differential thermal analysis， X-ray diffraction（XRD） and inductively coupled plasma mass spectrometry（ICP-MS） were used to analyze the correlation between the calcination temperature and CQAs of calcined Pyritum. Then， based on the criteria importance through intercriteria correlation（CRITIC）-entropy weight method， the optimal processing process of calcined Pyritum was optimized by orthogonal test. Powder XRD was used to analyze the phase of calcined Pyritum samples processed according to the best process， and the mean and median maps of calcined Pyritum were established by the superposition of geometric topological figures， and similarity evaluation and cluster analysis were carried out. ResultsThe results of single factor experiments showed that the physical phase of Pyritum changed from FeS₂ to Fe₇S₈ during the process of temperature increase， the color gradually deepened from dark yellow， and the contents of heavy metals and harmful elements decreased. The optimized processing process of calcined Pyritum was as follows：calcination temperature at 750 ℃， calcination time of 2.5 h， paving thickness of 3 cm， particle size of 0.8-1.2 cm， vinegar quenching 1 time［Pyritum-vinegar（10∶3）］. After calcination， the internal structure of Pyritum was honeycomb-shaped， which was conducive to the dissolution of active ingredients. XRD fingerprints of 13 batches of calcined Pyritum characterized by 10 common peaks were established. The similarities of the relative peak intensities of the XRD fingerprints of the analyzed samples were>0.96， and it could effectively distinguish the raw products and unqualified products. ConclusionTemperature is the main factor affecting the quality of calcined Pyritum. After processing， the dissolution of the effective components in Pyritum increases， and the contents of heavy metals and harmful substances decrease， reflecting the function of processing to increase efficiency and reduce toxicity. The optimized processing process is stable and feasible， and the established XRD fingerprint can be used as one of the quality control standards of calcined Pyritum.

Based on copper death, this study investigates the effect and mechanism of Shenmai Injection on isoproterenol(ISO)-induced myocardial fibrosis(MF) in rats. SPF-grade male SD rats were randomly divided into a normal group, model group, captopril(5 mg·kg~(-1)) positive control group, and Shenmai Injection low(6 mL·kg~(-1)), medium(9 mL·kg~(-1)), and high(12 mL·kg~(-1)) dose groups. Except for the normal group, the rats in the other groups were subcutaneously injected with ISO(5 mg·kg~(-1)) once a day for 10 consecutive days to establish an MF model. Starting from the second day after successful modeling, intraperitoneal injections of the respective treatments were administered for 28 consecutive days. Hematoxylin-eosin(HE) and Masson staining were used to observe pathological changes and fibrosis levels in the myocardial tissue. Colorimetry was employed to detect serum Cu~(2+) concentration in rats. The levels of inflammatory cytokines interleukin-6(IL-6), interleukin-1β(IL-1β), interleukin-18(IL-18), tumor necrosis factor-α(TNF-α), as well as mitochondrial energy metabolites adenosine triphosphate(ATP), adenosine diphosphate(ADP), and adenosine monophosphate(AMP) in serum were measured using enzyme-linked immunosorbent assay(ELISA). Western blot was performed to detect the expression of collagen Ⅰ(Col-Ⅰ), collagen Ⅲ(Col-Ⅲ), and copper death-related proteins dihydrolipoamide acetyltransferase(DLAT), ferredoxin 1(FDX1), lipoic acid synthetase(LIAS), and heat shock protein 70(HSP70) in myocardial tissue. Immunofluorescence was used to detect the expression of DLAT, FDX1, and HSP70, while immunohistochemistry was conducted to examine the expressions of DLAT, FDX1, LIAS, and HSP70. The results showed that, compared to the model group, the myocardial structure disorder and collagen fiber deposition in the drug treatment groups were significantly improved, the cardiac index level was reduced, serum Cu~(2+), IL-6, IL-1β, IL-18, TNF-α, ADP, and AMP levels were significantly decreased, ATP levels were significantly increased, and the expressions of Col-Ⅰ, Col-Ⅲ, and HSP70 proteins in myocardial tissue were significantly reduced, while the expressions of DLAT, FDX1, and LIAS proteins were significantly elevated. In conclusion, Shenmai Injection effectively alleviates myocardial structure disorder and interstitial collagen fiber deposition in ISO-induced MF rats, promotes copper excretion, and reduces copper death in the ISO-induced rat MF model.
Animals ; Male ; Drugs, Chinese Herbal/administration & dosage* ; Rats, Sprague-Dawley ; Rats ; Myocardium/metabolism* ; Drug Combinations ; Fibrosis/metabolism* ; Copper/blood* ; Cardiomyopathies/genetics* ; Humans