ObjectiveThis paper aims to investigate the effects of icariin on spermatogenesis in mice with exercise-induced fatigue and explore the underlying mechanisms. MethodsICR male mice were screened by swimming and randomly divided into normal group， model group， vitamin C group， icariin groups with low， medium， and high doses， and medium-dose icariin+N-nitro-L-arginine methyl ester （L-NAME） group， with 10 mice per group. Except for the normal group， all the other groups underwent weighted swimming training to establish an exercise-induced fatigue model. No gavage was administered during the first two weeks of the weighted training. From week three to four， the icariin groups with low， medium， and high doses received 0.03， 0.06， and 0.12 g·kg^-1 icariin via gavage， respectively. The vitamin C group received 0.2 g·kg^-1 vitamin C. The L-NAME group received 0.06 g·kg^-1 icariin and 0.01 g·kg^-1 L-NAME via intraperitoneal injection. The normal and model groups received equivalent physiological saline. After the experiment， body weight and the last exhaustive swimming time were recorded. Blood urea nitrogen （BUN）， lactate （LA）， lactate dehydrogenase （LDH）， malondialdehyde （MDA）， testicular testosterone （T）， testicular Ca²⁺/Mg²⁺-adenosine triphosphatase （ATPase） （micro-assay）， and the levels of testicular cyclic guanosine monophosphate （cGMP） were measured by using kits. Sperm CD46 levels were detected by flow cytometry. Testicular seminiferous tubules were observed via hematoxylin-eosin （HE） staining， and the testicular morphometric score （TMS） was used to evaluate the spermatogenic function. Protein expression of regucalcin （RGN， SMP30）， cGMP-dependent protein kinase 1 （PKG）， and cGMP-dependent protein kinase anchoring protein （GKAP1） was detected by Western blot. Testicular regucalcin expression was examined by immunofluorescence （IF）. The epididymal sperm quality of mice was observed under a microscope. Fluorescence-stained sections of stimulated by retinoic acid gene 8 （STRA8）， synaptonemal complex protein 3 （SCP3）， and transition protein 1（TNP1） in testicular seminiferous tubules were assessed by immunohistochemistry （IHC）. ResultsCompared with the normal group， the model group showed decreased body weight and exhaustive swimming time （P<0.01）， significantly increased fatigue markers （LA， LDH， and BUN） and lipid peroxidation product MDA （P<0.01）， reduced testicular RGN， PKG， GKAP1， testosterone， Ca²⁺/Mg²⁺-ATPase， and cGMP levels （P<0.01）， decreased sperm motility， sperm count， and TMS scores， and downregulated the expression of STRA8， SCP3， and TNP1. Compared with the model group， the icariin group with high dose exhibited increased exhaustive swimming time （P<0.01）， reduced LA， LDH， BUN， and MDA levels （P<0.01）， elevated superoxide dismutase （SOD） （P<0.01）， upregulated testicular RGN， PKG， GKAP1， testosterone， Ca²⁺/Mg²⁺-ATPase， and cGMP levels （P<0.01）， improved sperm motility， sperm count， and TMS scores， and enhanced STRA8， SCP3， and TNP1 expression. Compared with the L-NAME group， the icariin group with medium dose showed increased expression of STRA8， SCP3， and TNP1 in the testicular tissue （P<0.01） and elevated cGMP and GKAP1 levels （P<0.01）. ConclusionExercise-induced fatigue reduces the expression of RGN and cGMP/PKG/GKAP1 in mice， thereby causing abnormal spermatogenesis and impairing reproductive function in mice. Icariin ameliorates spermatogenic dysfunction in exercise-induced fatigue mice by promoting the expression of RGN and cGMP/PKG/GKAP1， thereby mitigating the damage of exercise-induced fatigue to the reproductive system.

ObjectiveThis paper aims to investigate the effects of icariin on spermatogenesis in mice with exercise-induced fatigue and explore the underlying mechanisms. MethodsICR male mice were screened by swimming and randomly divided into normal group， model group， vitamin C group， icariin groups with low， medium， and high doses， and medium-dose icariin+N-nitro-L-arginine methyl ester （L-NAME） group， with 10 mice per group. Except for the normal group， all the other groups underwent weighted swimming training to establish an exercise-induced fatigue model. No gavage was administered during the first two weeks of the weighted training. From week three to four， the icariin groups with low， medium， and high doses received 0.03， 0.06， and 0.12 g·kg^-1 icariin via gavage， respectively. The vitamin C group received 0.2 g·kg^-1 vitamin C. The L-NAME group received 0.06 g·kg^-1 icariin and 0.01 g·kg^-1 L-NAME via intraperitoneal injection. The normal and model groups received equivalent physiological saline. After the experiment， body weight and the last exhaustive swimming time were recorded. Blood urea nitrogen （BUN）， lactate （LA）， lactate dehydrogenase （LDH）， malondialdehyde （MDA）， testicular testosterone （T）， testicular Ca²⁺/Mg²⁺-adenosine triphosphatase （ATPase） （micro-assay）， and the levels of testicular cyclic guanosine monophosphate （cGMP） were measured by using kits. Sperm CD46 levels were detected by flow cytometry. Testicular seminiferous tubules were observed via hematoxylin-eosin （HE） staining， and the testicular morphometric score （TMS） was used to evaluate the spermatogenic function. Protein expression of regucalcin （RGN， SMP30）， cGMP-dependent protein kinase 1 （PKG）， and cGMP-dependent protein kinase anchoring protein （GKAP1） was detected by Western blot. Testicular regucalcin expression was examined by immunofluorescence （IF）. The epididymal sperm quality of mice was observed under a microscope. Fluorescence-stained sections of stimulated by retinoic acid gene 8 （STRA8）， synaptonemal complex protein 3 （SCP3）， and transition protein 1（TNP1） in testicular seminiferous tubules were assessed by immunohistochemistry （IHC）. ResultsCompared with the normal group， the model group showed decreased body weight and exhaustive swimming time （P<0.01）， significantly increased fatigue markers （LA， LDH， and BUN） and lipid peroxidation product MDA （P<0.01）， reduced testicular RGN， PKG， GKAP1， testosterone， Ca²⁺/Mg²⁺-ATPase， and cGMP levels （P<0.01）， decreased sperm motility， sperm count， and TMS scores， and downregulated the expression of STRA8， SCP3， and TNP1. Compared with the model group， the icariin group with high dose exhibited increased exhaustive swimming time （P<0.01）， reduced LA， LDH， BUN， and MDA levels （P<0.01）， elevated superoxide dismutase （SOD） （P<0.01）， upregulated testicular RGN， PKG， GKAP1， testosterone， Ca²⁺/Mg²⁺-ATPase， and cGMP levels （P<0.01）， improved sperm motility， sperm count， and TMS scores， and enhanced STRA8， SCP3， and TNP1 expression. Compared with the L-NAME group， the icariin group with medium dose showed increased expression of STRA8， SCP3， and TNP1 in the testicular tissue （P<0.01） and elevated cGMP and GKAP1 levels （P<0.01）. ConclusionExercise-induced fatigue reduces the expression of RGN and cGMP/PKG/GKAP1 in mice， thereby causing abnormal spermatogenesis and impairing reproductive function in mice. Icariin ameliorates spermatogenic dysfunction in exercise-induced fatigue mice by promoting the expression of RGN and cGMP/PKG/GKAP1， thereby mitigating the damage of exercise-induced fatigue to the reproductive system.

Cancer remains a leading cause of global mortality, necessitating the development of advanced therapeutic strategies with enhanced efficacy and reduced systemic toxicity. Among promising bioactive agents, lactoferrin (LF)—a multifunctional iron-binding glycoprotein abundantly found in mammalian milk and exocrine secretions—has garnered significant interest for its potent and multifaceted anti-cancer properties. This review provides a comprehensive analysis of the current understanding of LF’s role in oncology, encompassing its structural biology, diverse mechanisms of action, and groundbreaking advancements in its application through nano-engineering. LF exerts anti-tumor effects through multiple pathways, including extracellular action, intracellular action, and immune regulation. It demonstrates a remarkable affinity for cancer cell membranes, binding to overexpressed anionic components such as glycosaminoglycans and sialic acids, as well as to specific receptors including the low-density lipoprotein receptor-related protein-1 (LRP-1). This selective binding facilitates targeted uptake. Upon internalization, LF orchestrates a direct assault by inducing cell-cycle arrest in phases such as G0/G1 or S phase through the modulation of key regulators including cyclins, CDKs, and p53. Furthermore, it promotes programmed cell death via apoptotic pathways, involving caspase activation and downregulation of anti-apoptotic proteins such as survivin. A more recently elucidated mechanism is the induction of ferroptosis, an iron-dependent form of cell death characterized by overwhelming lipid peroxidation. Beyond direct cytotoxicity, LF acts as a potent immunomodulator. It enhances natural killer (NK) cell activity, modulates T-lymphocyte populations, and crucially reprograms tumor-associated macrophages (TAMs) from a pro-tumor M2 state to an anti-tumor M1 state, thereby reversing the immunosuppressive tumor microenvironment (TME). The translation of LF’s potential has been significantly accelerated by nanotechnology. The inherent biocompatibility and natural tumor-targeting capabilities of LF make it an ideal platform for sophisticated drug-delivery systems. This review details various fabrication strategies for LF-based nanoparticles (NPs), including self-assembly, sol-in-oil emulsion, and electrostatic nanocomplexes, among others. Research demonstrates that nano-formulations not only protect LF from degradation but also enhance its bioactivity and anti-cancer potency. More importantly, LF NPs serve as versatile carriers for a wide array of therapeutic agents, including conventional chemotherapeutics, natural compounds, and imaging agents. These engineered systems enable synergistic therapy and facilitate site-specific delivery. Notably, the ability of LF to bind to receptors on the blood-brain barrier (BBB) has been leveraged to develop nano-systems for glioblastoma treatment. Other innovative designs utilize LF to modulate the TME—for instance, by alleviating tumor hypoxia to sensitize cells to radiotherapy and chemotherapy. Despite compelling pre-clinical evidence, the clinical translation of LF and its nano-formulations remains nascent. While early-phase trials have established a favorable safety profile for recombinant human LF, larger Phase III studies have yielded mixed results, underscoring the complexity of its action in humans. Key challenges include enhancing drug targeting, optimizing loading efficiency, ensuring batch-to-batch reproducibility, and achieving deep tumor penetration. Future research must focus on the rational design of next-generation LF-NPs. This entails developing standardized manufacturing protocols, engineering “smart” stimuli-responsive systems for targeted drug release in the TME, and constructing multi-targeting platforms. A concerted interdisciplinary effort is paramount to bridge the gap between bench and bedside. In conclusion, LF, particularly in its nano-engineered forms, represents a highly promising and versatile agent in the oncological arsenal, holding immense potential for precise and effective cancer therapy.

Cancer remains a leading cause of global mortality, necessitating the development of advanced therapeutic strategies with enhanced efficacy and reduced systemic toxicity. Among promising bioactive agents, lactoferrin (LF)—a multifunctional iron-binding glycoprotein abundantly found in mammalian milk and exocrine secretions—has garnered significant interest for its potent and multifaceted anti-cancer properties. This review provides a comprehensive analysis of the current understanding of LF’s role in oncology, encompassing its structural biology, diverse mechanisms of action, and groundbreaking advancements in its application through nano-engineering. LF exerts anti-tumor effects through multiple pathways, including extracellular action, intracellular action, and immune regulation. It demonstrates a remarkable affinity for cancer cell membranes, binding to overexpressed anionic components such as glycosaminoglycans and sialic acids, as well as to specific receptors including the low-density lipoprotein receptor-related protein-1 (LRP-1). This selective binding facilitates targeted uptake. Upon internalization, LF orchestrates a direct assault by inducing cell-cycle arrest in phases such as G0/G1 or S phase through the modulation of key regulators including cyclins, CDKs, and p53. Furthermore, it promotes programmed cell death via apoptotic pathways, involving caspase activation and downregulation of anti-apoptotic proteins such as survivin. A more recently elucidated mechanism is the induction of ferroptosis, an iron-dependent form of cell death characterized by overwhelming lipid peroxidation. Beyond direct cytotoxicity, LF acts as a potent immunomodulator. It enhances natural killer (NK) cell activity, modulates T-lymphocyte populations, and crucially reprograms tumor-associated macrophages (TAMs) from a pro-tumor M2 state to an anti-tumor M1 state, thereby reversing the immunosuppressive tumor microenvironment (TME). The translation of LF’s potential has been significantly accelerated by nanotechnology. The inherent biocompatibility and natural tumor-targeting capabilities of LF make it an ideal platform for sophisticated drug-delivery systems. This review details various fabrication strategies for LF-based nanoparticles (NPs), including self-assembly, sol-in-oil emulsion, and electrostatic nanocomplexes, among others. Research demonstrates that nano-formulations not only protect LF from degradation but also enhance its bioactivity and anti-cancer potency. More importantly, LF NPs serve as versatile carriers for a wide array of therapeutic agents, including conventional chemotherapeutics, natural compounds, and imaging agents. These engineered systems enable synergistic therapy and facilitate site-specific delivery. Notably, the ability of LF to bind to receptors on the blood-brain barrier (BBB) has been leveraged to develop nano-systems for glioblastoma treatment. Other innovative designs utilize LF to modulate the TME—for instance, by alleviating tumor hypoxia to sensitize cells to radiotherapy and chemotherapy. Despite compelling pre-clinical evidence, the clinical translation of LF and its nano-formulations remains nascent. While early-phase trials have established a favorable safety profile for recombinant human LF, larger Phase III studies have yielded mixed results, underscoring the complexity of its action in humans. Key challenges include enhancing drug targeting, optimizing loading efficiency, ensuring batch-to-batch reproducibility, and achieving deep tumor penetration. Future research must focus on the rational design of next-generation LF-NPs. This entails developing standardized manufacturing protocols, engineering “smart” stimuli-responsive systems for targeted drug release in the TME, and constructing multi-targeting platforms. A concerted interdisciplinary effort is paramount to bridge the gap between bench and bedside. In conclusion, LF, particularly in its nano-engineered forms, represents a highly promising and versatile agent in the oncological arsenal, holding immense potential for precise and effective cancer therapy.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Functional constipation （FC） is a common functional disorder of the intestines， mainly characterized by reduced bowel movement frequency， difficulty in defecation， a sensation of incomplete evacuation， and hard stools， which severely affect patients’ quality of life. Research indicates that the pathogenesis of FC is closely related to gut microbiota dysbiosis and abnormal bile acid secretion. Bile acids， as endogenous natural laxatives， promote bowel movements by enhancing colonic secretion and regulating intestinal motility； meanwhile， gut microbiota influence colonic transit function by regulating the enteric nervous system， immune system， and their metabolic products. Based on an overview of the relationship between gut microbiota and bile acid metabolism， this article systematically reviews the current research status on the mechanisms of traditional Chinese medicine （TCM） in treating FC by regulating the balance of the gut microbiota-bile acid axis. It is found that single Chinese medicinal herbs （such as Atractylodes macrocephala）， isolated compounds （such as Platycodon grandiflorum polysaccharides）， herbal formulas （such as Shanger huang pill）， acupuncture， and moxibustion can up-regulate the abundance of beneficial bacteria， reshape the microbial structure， correct bile acid metabolism， and activate the Takeda G-protein receptor 5/farnesoid X receptor pathway to treat FC.

low transit constipation （STC） is a common functional intestinal disorder caused by impaired colonic transit function， characterized by reduced bowel movement frequency， hard stools， and difficulty in defecation. The mitogen-activated protein kinase （MAPK） signaling pathway， which mainly includes extracellular signal-regulated kinase （ERK）， c-Jun N-terminal kinase （JNK）， and p38 subtypes， plays a critical regulatory role in the occurrence and development of STC. This paper systematically reviews the multiple pathogenic mechanisms of the MAPK signaling pathway in STC and the research progress of traditional Chinese medicine （TCM） intervention.At the mechanistic level， the MAPK signaling pathway promotes the progression of STC through the following links：（1） Activation of p38 upregulates the expression of aquaporin 3 （AQP3）/AQP4 in the colon， leading to excessive reabsorption of water in the intestinal lumen； （2） It forms a positive feedback loop with nuclear factor-κB （NF-κB） to maintain low-grade intestinal inflammation， releases inflammatory factors such as tumor necrosis factor-α （TNF-α） and interleukin-1β （IL-1β）， and inhibits smooth muscle contraction； （3） Overactivation of p38 downregulates the expression of occludin and mucin 2 while upregulates the expression of claudin-2， thereby disrupting the mucosal barrier； （4） The JNK/p38 signaling pathway activates the caspase cascade to induce apoptosis of intestinal epithelial cells， neurons， and interstitial cells of Cajal； （5） Abnormal ERK signaling and excessive activation of p38/JNK inhibit intestinal smooth muscle contraction and reduce 5-hydroxytryptamine secretion， ultimately resulting in impaired colonic transit function.At the intervention level， TCM compound formulas and single herbs have been proven to improve STC by regulating the MAPK signaling pathway. Their effects are syndrome type-dependent：yin-nourishing formulas （Zengye Chengqi Tang， Tongbian Tang） mainly regulate the ERK/AQP axis； yang-warming formulas （Jichuan Jian） target both ERK/JNK and anti-apoptosis； heat-clearing formulas （Sanren Tang） focus on p38/NF-κB anti-inflammation. A single drug can simultaneously cover multiple aspects including water metabolism， inflammation， barrier function， apoptosis， and intestinal motility.Current relevant studies still have limitations such as mechanisms mostly remaining at the correlational level and a lack of disease-syndrome integrated research models. Future studies should combine specific inhibitors or gene knockout to identify core targets， establish disease-syndrome integrated STC models， and use network pharmacology and molecular docking techniques to deeply analyze the fine mechanism of “component-target-phenotype”， so as to provide high-quality evidence for the precise regulation of the MAPK signaling pathway by TCM in the intervention of STC.

Purpose: In this study, the neural communication patterns between hypothalamic structures and cortical areas in girls diagnosed with central precocious puberty (CPP) were explored. Endocrine profiles were incorporated to clarify the pathophysiological interactions between cerebral networks and hormonal regulation. The hypothalamus was designated as the key focus area for connectivity analysis. Methods: Fifty-seven girls (37 CPP, 20 non-CPP) were recruited from the Pediatric Development Clinic at the Second Affiliated Hospital of Anhui Medical University. The collected data included demographic information, gonadotropin-releasing hormone stimulation tests, and magnetic resonance imaging scans. Hypothalamic functional connectivity (FC) was analyzed using predefined region of interest coordinates, and correlations between hormone levels and FC values were assessed. Results: Compared to the non-CPP group, the CPP group exhibited elevated baseline follicle-stimulating hormone (FSH), baseline luteinizing hormone (LH), peak FSH, peak LH, and peak LH/FSH ratios. Patients with CPP exhibited enhanced neural synchronization linking the right lateral hypothalamic effector zone to the right superior frontal gyrus (displaying a borderline significant correlation with peak LH concentrations), concurrent with diminished functional coupling of the right lateral hypothalamic efferent to the right fusiform/supramarginal gyri. The left lateral hypothalamic projections demonstrated amplified connectivity with the right cuneus. No FC differences were observed in the medial hypothalamus. Conclusion Abnormal lateral hypothalamus FC patterns were identified in CPP girls and were particularly linked to peak LH levels. The findings offer novel insights into the neuroendocrine mechanisms underlying CPP.

Objective To construct a model combining with traditional Chinese medicine(TCM)syndrome for predicting the risk of disease progression in patients with idiopathic membranous nephropathy(IMN)by machine learning methods,thus to quantitatively evaluating the value of TCM syndrome in the prediction of the risk of disease progression in IMN.Methods Monofactor analysis,recursive feature elimination(RFE)and multivariate binary Logistic regression analysis were used to screen the independent related factors affecting the risk of disease progression of IMN,and then a risk prediction model was constructed.A total of 102 patients with IMN were randomly assigned to the training set and the test set in a ratio of 65∶35,and then the comparison was conducted in the performance indicators of accuracy,sensitivity,specificity,F1 value,and area under the receiver operating characteristic(ROC)area under the curve(AUC)of the risk prediction model with or without the inclusion of the TCM syndrome information.Results Before the inclusion of TCM syndrome information,12 clinical characteristic variables for patients with MN were obtained after monofactor analysis combined with RFE screening,and they were age,hemoglobin quantification,urinary occult blood,24-hour urine protein quantification,urine protein-creatinine ratio,estimated glomerular filtration rate(eGFR),creatinine,uric acid,alanine transaminase,anti-phospholipase A2 receptor antibody(PLA2R-Ab),total cholesterol,and low-density lipoprotein cholesterd.A risk cholesterol prediction model containing the above variables was constructed.The multivariate binary Logistic regression analysis showed that the differences of the clinical variables mentioned above between the training-set group and test-set group were statistically significant,and the risk prediction model presented good sensitivity and predictability.Monofactor analysis combined with RFE screening was performed again after the inclusion of TCM syndrome information,and then 14 variables were obtained,which included blood stasis syndrome and dampness obstruction syndrome.The sensitivity and specificity of the model with the inclusion of the TCM syndrome information were significantly improved when compared with those without the inclusion of TCM syndrome information.Conclusion The results of the study initially indicate that TCM syndrome can be used as an important supplementary variable for predicting the risk of disease progression in IMN,and will provide a reference for intelligent diagnosis through the integration of traditional Chinese and western medicine information,and will supply the guidance for the treatment of IMN with TCM.

ObjectiveTo investigate the processing technology of calcined Haematitum based on the concept of quality by design（QbD） and to assess its health risk. MethodsTaking whole iron content， Fe²⁺ dissolution content and looseness as critical quality attributes（CQAs）， and calcination temperature， calcination time， spreading thickness and particle size as critical process parameters（CPPs） determined by the failure mode and effect analysis（FMEA）， the processing technology of calcined Haematitum was optimized by orthogonal test combined with analytic hierarchy process-criteria importance through intercriteria correlation（AHP-CRITIC） hybrid weighting method. The contents of heavy metals and harmful elements were determined by inductively coupled plasma mass spectrometry， and the health risk assessment was carried out by daily exposure（EXP）， target hazard quotient（THQ） and lifetime cancer risk（LCR）， and the theoretical value of the maximum limit was deduced. ResultsThe optimal processing technology for calcined Haematitum was calcination at 650 ℃， calcination time of 1 h， particle size of 0.2-0.5 cm， spreading thickness of 1 cm， and vinegar quenching for 1 time［Haematitum-vinegar（10：3）］. The contents of 5 heavy metals and harmful elements in 13 batches of calcined Haematitum were all decreased with reductions of up to 5-fold. The cumulative THQ of 2 batches of samples was>1， while the cumulative THQ of all batches of Haematitum was>1. The LCR of As in 1 batches of Haematitum was 1×10^-6-1×10^-4， and the LCR of the rest was<1×10^-6， and the LCRs of calcined Haematitum were all<1×10^-6， indicating that the carcinogenic risk of calcined Haematitum was low， but special attention should still be paid to Haematitum medicinal materials. Preliminary theoretical values of the maximum limits of Cu， As， Cd， Pb and Hg were formulated as 1 014， 25， 17， 27， 7 mg·kg^-1. ConclusionThe optimized processing technology of calcined Haematitum is stable and feasible， and the contents of heavy metals and harmful elements are reduced after processing. Preliminary theoretical values of the maximum limits of Cu， As， Cd， Pb and Hg are formulated to provide a scientific basis for the formulation of standards for the limits of harmful elements in Haematitum.