1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Application of Recombinant Collagen in Biomedicine
Huan HU ; Hong ZHANG ; Jian WANG ; Li-Wen WANG ; Qian LIU ; Ning-Wen CHENG ; Xin-Yue ZHANG ; Yun-Lan LI
Progress in Biochemistry and Biophysics 2025;52(2):395-416
Collagen is a major structural protein in the matrix of animal cells and the most widely distributed and abundant functional protein in mammals. Collagen’s good biocompatibility, biodegradability and biological activity make it a very valuable biomaterial. According to the source of collagen, it can be broadly categorized into two types: one is animal collagen; the other is recombinant collagen. Animal collagen is mainly extracted and purified from animal connective tissues by chemical methods, such as acid, alkali and enzyme methods, etc. Recombinant collagen refers to collagen produced by gene splicing technology, where the amino acid sequence is first designed and improved according to one’s own needs, and the gene sequence of improved recombinant collagen is highly consistent with that of human beings, and then the designed gene sequence is cloned into the appropriate vector, and then transferred to the appropriate expression vector. The designed gene sequence is cloned into a suitable vector, and then transferred to a suitable expression system for full expression, and finally the target protein is obtained by extraction and purification technology. Recombinant collagen has excellent histocompatibility and water solubility, can be directly absorbed by the human body and participate in the construction of collagen, remodeling of the extracellular matrix, cell growth, wound healing and site filling, etc., which has demonstrated significant effects, and has become the focus of the development of modern biomedical materials. This paper firstly elaborates the structure, type, and tissue distribution of human collagen, as well as the associated genetic diseases of different types of collagen, then introduces the specific process of producing animal source collagen and recombinant collagen, explains the advantages of recombinant collagen production method, and then introduces the various systems of expressing recombinant collagen, as well as their advantages and disadvantages, and finally briefly introduces the application of animal collagen, focusing on the use of animal collagen in the development of biopharmaceutical materials. In terms of application, it focuses on the use of animal disease models exploring the application effects of recombinant collagen in wound hemostasis, wound repair, corneal therapy, female pelvic floor dysfunction (FPFD), vaginal atrophy (VA) and vaginal dryness, thin endometritis (TE), chronic endometritis (CE), bone tissue regeneration in vivo, cardiovascular diseases, breast cancer (BC) and anti-aging. The mechanism of action of recombinant collagen in the treatment of FPFD and CE was introduced, and the clinical application and curative effect of recombinant collagen in skin burn, skin wound, dermatitis, acne and menopausal urogenital syndrome (GSM) were summarized. From the exploratory studies and clinical applications, it is evident that recombinant collagen has demonstrated surprising effects in the treatment of all types of diseases, such as reducing inflammation, promoting cell proliferation, migration and adhesion, increasing collagen deposition, and remodeling the extracellular matrix. At the end of the review, the challenges faced by recombinant collagen are summarized: to develop new recombinant collagen types and dosage forms, to explore the mechanism of action of recombinant collagen, and to provide an outlook for the future development and application of recombinant collagen.
3.Bufei Tongbi Decoction Inhibits Pulmonary Fibrosis in Diabetic Rats via TGF-β1/p-Smad3 Signaling Pathway
Gang WANG ; Rensong YUE ; Qiyue YANG ; Dan ZHANG ; Xin CHEN
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(10):176-184
ObjectiveTo study the effect of Bufei Tongbi decoction on pulmonary fibrosis in diabetic rats via the transforming growth factor-β1 (TGF-β1)/phosphorylated Smad family member 3 (p-Smad3) signaling pathway. MethodsStreptozotocin (60 mg·kg-1) and bleomycin (24.80 U·kg-1) were used to prepare the rat model of diabetes with pulmonary fibrosis by intratracheal injection. Sixty rats were randomly assigned into blank, model, low-, medium-, and high-dose (3.98, 7.95, and 15.90 g·kg-1, respectively) Bufei Tongbi decoction, and pirfenidone (0.36 mg·kg-1) groups (n=10). The successfully modeled rats in each group were administrated with corresponding agents once per day for four consecutive weeks. After drug administration, fasting blood glucose and lung function indicators were measured. Chemical immunoassay was employed to determine the serum levels of hydroxyproline (Hyp), hyaluronic acid (HA), and laminin (LN). The lung index was determined by the wet and dry methods. The pathological changes in the lung tissue were observed by hematoxylin-eosin (HE) staining, and the degree of fibrosis was detected by Masson staining. The mRNA and protein levels of TGF-β1, p-Smad3, Smad3, α-smooth muscle actin (α-SMA), collagen type Ⅰ alpha 1 (Col1A1), and fibronectin were determined by PCR and Western blotting, respectively. ResultsCompared with the blank group, the model group showed alveolar septa thickening, obvious thickening of the basement membrane of pulmonary blood vessels, severe destruction of the alveolar structure, structural disarrangement of the lung parenchyma, and an increase in the proportion of inflammatory cell infiltration in the lung tissue, together with a large amount of blue collagen deposition and a large amount of collagen fibroplasia in the bronchial wall, vessel wall, interstitium, and alveolar wall, which indicated severe fibrosis. Bufei Tongbi decoction groups and the pirfenidone group showed lower fasting blood glucose level (P<0.05) and higher forced vital capacity (FVC), cytoplasmic dynein (Cydn), FEV0.3/FEV ratio, and lung index (P<0.05) than the model group. Moreover, these groups demonstrated alleviated lung fibrosis, elevated Hyp, HA, and LN levels, down-regulated mRNA levels of α-SMA, Col1A1, and fibronectin, and down-regulated protein levels of TGF-β1, Smad3, p-Smad3, α-SMA, Col1A1, and fibronectin (P<0.05). ConclusionBufei Tongbi decoction can inhibit pulmonary fibrosis in diabetic rats by inhibiting the TGF-β1/p-Smad3 signaling pathway.
4.Heterogeneity of Adipose Tissue From a Single-cell Transcriptomics Perspective
Yong-Lang WANG ; Si-Si CHEN ; Qi-Long LI ; Yu GONG ; Xin-Yue DUAN ; Ye-Hui DUAN ; Qiu-Ping GUO ; Feng-Na LI
Progress in Biochemistry and Biophysics 2025;52(4):820-835
Adipose tissue is a critical energy reservoir in animals and humans, with multifaceted roles in endocrine regulation, immune response, and providing mechanical protection. Based on anatomical location and functional characteristics, adipose tissue can be categorized into distinct types, including white adipose tissue (WAT), brown adipose tissue (BAT), beige adipose tissue, and pink adipose tissue. Traditionally, adipose tissue research has centered on its morphological and functional properties as a whole. However, with the advent of single-cell transcriptomics, a new level of complexity in adipose tissue has been unveiled, showing that even under identical conditions, cells of the same type may exhibit significant variation in morphology, structure, function, and gene expression——phenomena collectively referred to as cellular heterogeneity. Single-cell transcriptomics, including techniques like single-cell RNA sequencing (scRNA-seq) and single-nucleus RNA sequencing (snRNA-seq), enables in-depth analysis of the diversity and heterogeneity of adipocytes at the single-cell level. This high-resolution approach has not only deepened our understanding of adipocyte functionality but also facilitated the discovery of previously unidentified cell types and gene expression patterns that may play key roles in adipose tissue function. This review delves into the latest advances in the application of single-cell transcriptomics in elucidating the heterogeneity and diversity within adipose tissue, highlighting how these findings have redefined the understanding of cell subpopulations within different adipose depots. Moreover, the review explores how single-cell transcriptomic technologies have enabled the study of cellular communication pathways and differentiation trajectories among adipose cell subgroups. By mapping these interactions and differentiation processes, researchers gain insights into how distinct cellular subpopulations coordinate within adipose tissues, which is crucial for maintaining tissue homeostasis and function. Understanding these mechanisms is essential, as dysregulation in adipose cell interactions and differentiation underlies a range of metabolic disorders, including obesity and diabetes mellitus type 2. Furthermore, single-cell transcriptomics holds promising implications for identifying therapeutic targets; by pinpointing specific cell types and gene pathways involved in adipose tissue dysfunction, these technologies pave the way for developing targeted interventions aimed at modulating specific adipose subpopulations. In summary, this review provides a comprehensive analysis of the role of single-cell transcriptomic technologies in uncovering the heterogeneity and functional diversity of adipose tissues.
5.Process Optimization and Health Risk Assessment of Calcined Haematitum Based on QbD Concept
Yue YANG ; Jingwei ZHOU ; Jialiang ZOU ; Guorong MEI ; Yifan SHI ; Lei ZHONG ; Jiaojiao WANG ; Xuelian GAN ; Dewen ZENG ; Xin CHEN ; Lin CHEN ; Hongping CHEN ; Shilin CHEN ; Yuan HU ; Youping LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(13):187-196
ObjectiveTo investigate the processing technology of calcined Haematitum based on the concept of quality by design(QbD) and to assess its health risk. MethodsTaking whole iron content, Fe2+ dissolution content and looseness as critical quality attributes(CQAs), and calcination temperature, calcination time, spreading thickness and particle size as critical process parameters(CPPs) determined by the failure mode and effect analysis(FMEA), the processing technology of calcined Haematitum was optimized by orthogonal test combined with analytic hierarchy process-criteria importance through intercriteria correlation(AHP-CRITIC) hybrid weighting method. The contents of heavy metals and harmful elements were determined by inductively coupled plasma mass spectrometry, and the health risk assessment was carried out by daily exposure(EXP), target hazard quotient(THQ) and lifetime cancer risk(LCR), and the theoretical value of the maximum limit was deduced. ResultsThe optimal processing technology for calcined Haematitum was calcination at 650 ℃, calcination time of 1 h, particle size of 0.2-0.5 cm, spreading thickness of 1 cm, and vinegar quenching for 1 time[Haematitum-vinegar(10:3)]. The contents of 5 heavy metals and harmful elements in 13 batches of calcined Haematitum were all decreased with reductions of up to 5-fold. The cumulative THQ of 2 batches of samples was>1, while the cumulative THQ of all batches of Haematitum was>1. The LCR of As in 1 batches of Haematitum was 1×10-6-1×10-4, and the LCR of the rest was<1×10-6, and the LCRs of calcined Haematitum were all<1×10-6, indicating that the carcinogenic risk of calcined Haematitum was low, but special attention should still be paid to Haematitum medicinal materials. Preliminary theoretical values of the maximum limits of Cu, As, Cd, Pb and Hg were formulated as 1 014, 25, 17, 27, 7 mg·kg-1. ConclusionThe optimized processing technology of calcined Haematitum is stable and feasible, and the contents of heavy metals and harmful elements are reduced after processing. Preliminary theoretical values of the maximum limits of Cu, As, Cd, Pb and Hg are formulated to provide a scientific basis for the formulation of standards for the limits of harmful elements in Haematitum.
6.Optimization of Processing Technology of Calcined Pyritum Based on QbD Concept and Its XRD Fingerprint Analysis
Xin CHEN ; Jingwei ZHOU ; Haiying GOU ; Lei ZHONG ; Tianxing HE ; Wenbo FEI ; Jialiang ZOU ; Yue YANG ; Dewen ZENG ; Lin CHEN ; Hongping CHEN ; Shilin CHEN ; Yuan HU ; Youping LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(13):197-205
ObjectiveBased on the concept of quality by design(QbD), the processing process of calcined Pyritum was optimized, and its X-ray diffraction(XRD) fingerprint was established. MethodsThe safety, effectiveness and quality controllability of calcined Pyritum were taken as the quality profile(QTPP), the color, hardness, metallic luster, phase composition, the contents of heavy metals and hazardous elements were taken as the critical quality attributes(CQAs), and the calcination temperature, calcination time, paving thickness and particle size were determined as the critical process parameters(CPPs). Differential thermal analysis, X-ray diffraction(XRD) and inductively coupled plasma mass spectrometry(ICP-MS) were used to analyze the correlation between the calcination temperature and CQAs of calcined Pyritum. Then, based on the criteria importance through intercriteria correlation(CRITIC)-entropy weight method, the optimal processing process of calcined Pyritum was optimized by orthogonal test. Powder XRD was used to analyze the phase of calcined Pyritum samples processed according to the best process, and the mean and median maps of calcined Pyritum were established by the superposition of geometric topological figures, and similarity evaluation and cluster analysis were carried out. ResultsThe results of single factor experiments showed that the physical phase of Pyritum changed from FeS2 to Fe7S8 during the process of temperature increase, the color gradually deepened from dark yellow, and the contents of heavy metals and harmful elements decreased. The optimized processing process of calcined Pyritum was as follows:calcination temperature at 750 ℃, calcination time of 2.5 h, paving thickness of 3 cm, particle size of 0.8-1.2 cm, vinegar quenching 1 time[Pyritum-vinegar(10∶3)]. After calcination, the internal structure of Pyritum was honeycomb-shaped, which was conducive to the dissolution of active ingredients. XRD fingerprints of 13 batches of calcined Pyritum characterized by 10 common peaks were established. The similarities of the relative peak intensities of the XRD fingerprints of the analyzed samples were>0.96, and it could effectively distinguish the raw products and unqualified products. ConclusionTemperature is the main factor affecting the quality of calcined Pyritum. After processing, the dissolution of the effective components in Pyritum increases, and the contents of heavy metals and harmful substances decrease, reflecting the function of processing to increase efficiency and reduce toxicity. The optimized processing process is stable and feasible, and the established XRD fingerprint can be used as one of the quality control standards of calcined Pyritum.
7.Process Optimization and Health Risk Assessment of Calcined Haematitum Based on QbD Concept
Yue YANG ; Jingwei ZHOU ; Jialiang ZOU ; Guorong MEI ; Yifan SHI ; Lei ZHONG ; Jiaojiao WANG ; Xuelian GAN ; Dewen ZENG ; Xin CHEN ; Lin CHEN ; Hongping CHEN ; Shilin CHEN ; Yuan HU ; Youping LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(13):187-196
ObjectiveTo investigate the processing technology of calcined Haematitum based on the concept of quality by design(QbD) and to assess its health risk. MethodsTaking whole iron content, Fe2+ dissolution content and looseness as critical quality attributes(CQAs), and calcination temperature, calcination time, spreading thickness and particle size as critical process parameters(CPPs) determined by the failure mode and effect analysis(FMEA), the processing technology of calcined Haematitum was optimized by orthogonal test combined with analytic hierarchy process-criteria importance through intercriteria correlation(AHP-CRITIC) hybrid weighting method. The contents of heavy metals and harmful elements were determined by inductively coupled plasma mass spectrometry, and the health risk assessment was carried out by daily exposure(EXP), target hazard quotient(THQ) and lifetime cancer risk(LCR), and the theoretical value of the maximum limit was deduced. ResultsThe optimal processing technology for calcined Haematitum was calcination at 650 ℃, calcination time of 1 h, particle size of 0.2-0.5 cm, spreading thickness of 1 cm, and vinegar quenching for 1 time[Haematitum-vinegar(10:3)]. The contents of 5 heavy metals and harmful elements in 13 batches of calcined Haematitum were all decreased with reductions of up to 5-fold. The cumulative THQ of 2 batches of samples was>1, while the cumulative THQ of all batches of Haematitum was>1. The LCR of As in 1 batches of Haematitum was 1×10-6-1×10-4, and the LCR of the rest was<1×10-6, and the LCRs of calcined Haematitum were all<1×10-6, indicating that the carcinogenic risk of calcined Haematitum was low, but special attention should still be paid to Haematitum medicinal materials. Preliminary theoretical values of the maximum limits of Cu, As, Cd, Pb and Hg were formulated as 1 014, 25, 17, 27, 7 mg·kg-1. ConclusionThe optimized processing technology of calcined Haematitum is stable and feasible, and the contents of heavy metals and harmful elements are reduced after processing. Preliminary theoretical values of the maximum limits of Cu, As, Cd, Pb and Hg are formulated to provide a scientific basis for the formulation of standards for the limits of harmful elements in Haematitum.
8.Optimization of Processing Technology of Calcined Pyritum Based on QbD Concept and Its XRD Fingerprint Analysis
Xin CHEN ; Jingwei ZHOU ; Haiying GOU ; Lei ZHONG ; Tianxing HE ; Wenbo FEI ; Jialiang ZOU ; Yue YANG ; Dewen ZENG ; Lin CHEN ; Hongping CHEN ; Shilin CHEN ; Yuan HU ; Youping LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(13):197-205
ObjectiveBased on the concept of quality by design(QbD), the processing process of calcined Pyritum was optimized, and its X-ray diffraction(XRD) fingerprint was established. MethodsThe safety, effectiveness and quality controllability of calcined Pyritum were taken as the quality profile(QTPP), the color, hardness, metallic luster, phase composition, the contents of heavy metals and hazardous elements were taken as the critical quality attributes(CQAs), and the calcination temperature, calcination time, paving thickness and particle size were determined as the critical process parameters(CPPs). Differential thermal analysis, X-ray diffraction(XRD) and inductively coupled plasma mass spectrometry(ICP-MS) were used to analyze the correlation between the calcination temperature and CQAs of calcined Pyritum. Then, based on the criteria importance through intercriteria correlation(CRITIC)-entropy weight method, the optimal processing process of calcined Pyritum was optimized by orthogonal test. Powder XRD was used to analyze the phase of calcined Pyritum samples processed according to the best process, and the mean and median maps of calcined Pyritum were established by the superposition of geometric topological figures, and similarity evaluation and cluster analysis were carried out. ResultsThe results of single factor experiments showed that the physical phase of Pyritum changed from FeS2 to Fe7S8 during the process of temperature increase, the color gradually deepened from dark yellow, and the contents of heavy metals and harmful elements decreased. The optimized processing process of calcined Pyritum was as follows:calcination temperature at 750 ℃, calcination time of 2.5 h, paving thickness of 3 cm, particle size of 0.8-1.2 cm, vinegar quenching 1 time[Pyritum-vinegar(10∶3)]. After calcination, the internal structure of Pyritum was honeycomb-shaped, which was conducive to the dissolution of active ingredients. XRD fingerprints of 13 batches of calcined Pyritum characterized by 10 common peaks were established. The similarities of the relative peak intensities of the XRD fingerprints of the analyzed samples were>0.96, and it could effectively distinguish the raw products and unqualified products. ConclusionTemperature is the main factor affecting the quality of calcined Pyritum. After processing, the dissolution of the effective components in Pyritum increases, and the contents of heavy metals and harmful substances decrease, reflecting the function of processing to increase efficiency and reduce toxicity. The optimized processing process is stable and feasible, and the established XRD fingerprint can be used as one of the quality control standards of calcined Pyritum.
9.CyberKnife Stereotactic Radiosurgery System for Pituitary Tumors and Pulmonary Cancer Bone Metastases: Initiating a New Chapter in Stereotactic Radiotherapy
Weishi CHENG ; Xin LIAN ; Tingtian PANG ; Yue ZHANG ; Yuliang SUN ; Zhikai LIU
Medical Journal of Peking Union Medical College Hospital 2025;16(3):790-796
The CyberKnife, an acronym for the stereotactic radiosurgery platform, represents an image-guided stereotactic radiotherapy technique. This technology precisely delivers ionizing radiation to tissues, effectively damaging tumor cells, and is suitable for radiotherapy of both intracranial and extracranial tumors. This article reports the first performance of CyberKnife by radiotherapy at Peking Union Medical College Hospital, including a patient with uncontrolled pituitary adenoma after surgery and radiotherapy, and another patient with vertebral metastasis following targeted therapy for lung adenocarcinoma. The application of CyberKnife technology in radiotherapy has achieved highly accurate dose delivery, enabling targeted irradiation of tumor lesions while minimizing damage to surrounding normal tissues, thereby yielding relatively ideal clinical outcomes.
10.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Result Analysis
Print
Save
E-mail