OBJECTIVE To comprehensively evaluate the 16 commonly used kinds of enteral nutrition preparations in Hebei province， aiming to provide a reference for the selection of drugs in medical institutions and clinical drug decision-making. METHODS Based on the Quick Guide for Drug Evaluation and Selection in Chinese Medical Institutions （the Second Edition）， evaluation evidence was collected， and the included drugs were scored and evaluated from four dimensions of pharmaceutical characteristics， clinical characteristics， economy and other attributes. RESULTS & CONCLUSIONS The scores for Enteral nutritional emulsion （TPF-T）， Enteral nutritional emulsion （TPF-D）， Enteral nutritional emulsion （TPF）， Enteral nutritional emulsion （TPF-HE）， Enteral nutritional emulsion （TP）， Enteral nutritional emulsion （SP）， Enteral nutritional suspension （TPF） （1.5 kcal/mL， 1 kcal＝4.184 kJ）， Enteral nutritional suspension （TPF） （1.0 kcal/mL）， Intact protein enteral nutrition （powder）， Enteral nutritional suspension （TPF-DM）， Enteral nutritional suspension （TPF-MCT）， Enteral nutritional suspension （SP）， Short- peptide enteral nutrition， Enteral nutritional powder （TP）， Enteral nutritional suspension （TPF-D） and Enteral nutritional suspension （TPF-FOS） were 82.9， 84.1， 84.1， 86.1， 78.4， 79.1， 82.6， 82.3， 82.4， 80.2， 83.0， 82.4， 82.1， 85.7， 76.0， 82.4 points， respectively. All medications scored above 70 points. In practice， appropriate drugs can be selected according to clinical requirements and patient needs.

Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

Stroke is the leading cause of death and disability among adults in China， and its common complications include digestive system abnormalities， cognitive impairment， depression， stroke-associated pneumonia， and hemiplegia. The combination of traditional Chinese and Western medicine has great potential in treating post-stroke complications. Xinglou Chengqitang （XLCQT） is a representative prescription of alleviating the disease in the upper part by treating the lower part. It has definite therapeutic effect and high safety. Clinically， XLCQT is often used to treat stroke and its complications. However， the quantity and quality of clinical trials of XLCQT in treating post-stroke complications need to be improved. Additionally， since the basic research is weak， the material basis and multi-target mechanism for the efficacy of this prescription are unknown. This article reviews XLCQT in terms of the pharmacodynamic basis， medicinal properties， safety evaluation， and progress in clinical research and mechanisms in treating post-stroke complications. This article summarizes 22 key active ingredients of XLCQT in treating acute stroke complicated with syndrome of phlegm heat and fu-organ excess. Among these key active ingredients， resveratrol， kaempferol， luteolin， chrysoeriol， apigenin， （+）-catechin， and adenosine have good pharmacokinetic properties and high bioavailability. The mechanisms of XLCQT in treating post-stroke complications are complex， including inflammatory response， brain-gut axis， hypothalamic-pituitary-adrenal （HPA） axis， intestinal flora， neurotrophic factors， autophagy， oxidative stress， and free radical damage. This review helps to deeply understand the pharmacodynamic basis and mechanisms of XLCQT in treating post-stroke complications and provides a theoretical basis for the clinical application of XLCQT against post-stroke complications and the development of drugs.

Liver cancer is one of the most common malignant tumors in the digestive system and ranks sixth among newly diagnosed malignant tumors worldwide. Transforming growth factor-β （TGF-β） regulates cell differentiation， proliferation， apoptosis， and other physiological and pathological mechanisms and exerts cancer-suppressive and pro-cancerous dual effects in the process of tumor development. In recent years， with the continuous exploration of the mechanism of liver cancer， it has been found that the conversion of the cancer-suppressive effect into a pro-cancerous effect of this pathway plays a key role in the development of liver cancer. Traditional Chinese medicine （TCM） provides a unique perspective for the classification， diagnosis， and treatment of liver cancer with its comprehensive regulatory effects of multi-components， multi-targets， and multi-pathways. This paper summarized that the cancer-suppressive mechanisms of the TGF-β signaling pathway included promoting cancer cell cycle arrest， apoptosis， autophagy， et al， while the pro-cancerous mechanisms included promoting cancer cell proliferation， invasion and metastasis， immunosuppression， angiogenesis， et al. The TCM compounds intervening this pathway were sorted out， including Jianpi Huayu compound， Fuyang Baoyuan compound， Yipi Yanggan compound， Fuzheng Jiedu compound， compound Astragalus and Salvia， Biejia Jianwan， Dahuang Zhechong pill， and Qingxiang powder. The single TCMs mainly included Schizocapsa plantaginea， Dendrobii Caulis， Gleditsia sinensis， and Dracaena cochinchinensis. The active ingredients of TCM are mainly concentrated on flavonoids， alkaloids， glycosides， phenolics， terpenoids， polysaccharides， and other kinds of compounds. At the same time， it summarized that the liver cancer inhibition mechanism of TCM by regulating this pathway mainly included promoting apoptosis of liver cancer cells， blocking the cell cycle， and inhibiting liver cancer cell proliferation， migration， invasion， angiogenesis， immune escape， etc. The mechanism aims to give full play to the advantages of TCM and precisely regulate the TGF-β signal， thereby exerting positive anti-tumor effects， opening up a new direction for the precise targeted treatment of liver cancer， and providing a scientific basis and a new strategy for the application of TCM in the treatment of liver cancer.

Liver cancer is one of the most common malignant tumors in the digestive system and ranks sixth among newly diagnosed malignant tumors worldwide. Transforming growth factor-β （TGF-β） regulates cell differentiation， proliferation， apoptosis， and other physiological and pathological mechanisms and exerts cancer-suppressive and pro-cancerous dual effects in the process of tumor development. In recent years， with the continuous exploration of the mechanism of liver cancer， it has been found that the conversion of the cancer-suppressive effect into a pro-cancerous effect of this pathway plays a key role in the development of liver cancer. Traditional Chinese medicine （TCM） provides a unique perspective for the classification， diagnosis， and treatment of liver cancer with its comprehensive regulatory effects of multi-components， multi-targets， and multi-pathways. This paper summarized that the cancer-suppressive mechanisms of the TGF-β signaling pathway included promoting cancer cell cycle arrest， apoptosis， autophagy， et al， while the pro-cancerous mechanisms included promoting cancer cell proliferation， invasion and metastasis， immunosuppression， angiogenesis， et al. The TCM compounds intervening this pathway were sorted out， including Jianpi Huayu compound， Fuyang Baoyuan compound， Yipi Yanggan compound， Fuzheng Jiedu compound， compound Astragalus and Salvia， Biejia Jianwan， Dahuang Zhechong pill， and Qingxiang powder. The single TCMs mainly included Schizocapsa plantaginea， Dendrobii Caulis， Gleditsia sinensis， and Dracaena cochinchinensis. The active ingredients of TCM are mainly concentrated on flavonoids， alkaloids， glycosides， phenolics， terpenoids， polysaccharides， and other kinds of compounds. At the same time， it summarized that the liver cancer inhibition mechanism of TCM by regulating this pathway mainly included promoting apoptosis of liver cancer cells， blocking the cell cycle， and inhibiting liver cancer cell proliferation， migration， invasion， angiogenesis， immune escape， etc. The mechanism aims to give full play to the advantages of TCM and precisely regulate the TGF-β signal， thereby exerting positive anti-tumor effects， opening up a new direction for the precise targeted treatment of liver cancer， and providing a scientific basis and a new strategy for the application of TCM in the treatment of liver cancer.

Esophageal cancer is a prevalent malignant tumor of the digestive tract in China, and radical surgery remains the cornerstone of its comprehensive treatment. However, multifactorial challenges such as postoperative gastrointestinal tract reconstruction, traumatic stress, and tumor-related metabolic disturbances render esophageal cancer patients highly susceptible to malnutrition. Perioperative nutritional support therapy plays a crucial role in enhancing surgical safety, improving clinical outcomes, and elevating patients' quality of life by regulating metabolic homeostasis, preserving organ function, and optimizing the immune microenvironment. This article reviews the mechanisms underlying malnutrition in esophageal cancer, methods for nutritional status assessment, and precision intervention pathways based on multi-omics evaluations. The aim is to strengthen clinicians' awareness of standardized perioperative nutritional management for esophageal cancer patients and promote its clinical implementation, thereby facilitating postoperative recovery and improving long-term quality of life.

Objective: To analyze the current burden of autism spectrum disorder (ASD) among children and adolescents in China and globally, and to predict the disease burden from 2024 to 2035, providing a scientific basis for formulating relevant public health policies and intervention measures. Methods: Based on the Global Burden of Disease (GBD) database in 2023, the Joinpoint regression model was used to analyze the changing trends of the disease burden of ASD among children and adolescents in China and globally from 1990 to 2023, and the average annual percent change (AAPC) was calculated. An autoregressive integrated moving average (ARIMA) model was constructed to predict the disease burden trends of ASD among children and adolescents in China and globally from 2024 to 2035. Results: The prevalence and disability adjusted life years (DALYs) rate of ASD among children and adolescents in China increased from 452.69/100 000 and 86.67/100 000 in 1990 to 762.84/100 000 and 148.52/ 100 000 in 2023(AAPC=1.60%, 1.65%, both P <0.01). The prevalence and DALYs rate of ASD among children and adolescents globally increased from 648.49/100 000 and 123.47/100 000 to 862.44/100 000 and 167.16/100 000(AAPC=0.87%, 0.93%, both P <0.01). In 2023, the highest ASD prevalence and DALY rates occurred in children under 5 years old, with China reporting 848.14/100 000 and 166.69/100 000, both below the global averages of 928.80/100 000 and 181.34/100 000. Projections indicated that by 2035, the ASD prevalence and DALY rates in China would rise to 906.83/100 000 and 168.71/100 000, still below the global averages of 938.04/100 000 and 184.49/100 000. Conclusion The disease burden of ASD among children and adolescents in China and globally has generally increased from 1990 to 2023, with a higher risk of disease at younger ages.

ObjectiveThis paper aims to investigate and evaluate the staged efficacy and safety of the representative empirical prescription of the “Zhu Ke Jiao” theory， Qijia Rougan prescription， combined with entecavir in the treatment of hepatic fibrosis in chronic hepatitis B. MethodsA multicenter randomized controlled clinical study was conducted， and 101 patients diagnosed with chronic hepatitis B-related hepatic fibrosis （CHB-HF） who met the diagnosis and inclusion criteria were randomly assigned to an observation group （Qijia Rougan prescription + entecavir） and a control group （entecavir）. The treatment duration was 24 weeks. Liver stiffness measurement （LSM）， fibrosis-4 index （FIB-4）， portal vein diameter， hepatitis B serology， biochemical indicators， hepatic fibrosis markers in serum ［hyaluronic acid （HA）， laminin （LN）， procollagen Ⅲ peptide （PⅢP）， and type Ⅳ collagen （Ⅳ-C）］， and traditional Chinese medicine syndrome scores were used as efficacy evaluation indicators. Efficacy assessments and explorations of different staged subgroups of Qijia Rougan prescription were conducted according to LSM values based on the Metavir pathological staging standard. ResultsA total of 98 cases were included for statistical analysis， with 49 cases in the observation group and 49 in the control group. The general data of the patients in both groups were comparable. Compared with the same group before treatment， the observation group showed a significant reduction in LSM and FIB-4 （P<0.01）， as well as notable improvements in LN， Ⅳ-C， and various TCM syndrome scores （P<0.05， P<0.01）. When compared to the control group after treatment， the observation group demonstrated significant improvements in LSM， FIB-4， and various TCM syndrome score indicators （P<0.05， P<0.01）， indicating that the observation group performed better than the control group. Subgroup analysis of the regression of hepatic fibrosis stages showed that compared to the same group before treatment， the observation group had better improvement in regression of stages F2 and F3 （P<0.05）. When compared to the control group after treatment， the observation group exhibited superior improvement in regression of stage F3 （P<0.05）. No adverse events occurred in either group during the treatment period. ConclusionCompared with entecavir alone， the combination of Qijia Rougan prescription and entecavir significantly improves the degree of hepatic fibrosis and clinical TCM symptoms in patients. The optimal intervention period is primarily during stage F3， which is a potential “interception” point of the “Zhu Ke Jiao” theory.

OBJECTIVE To form an expert consensus on the clinical application of parenteral direct thrombin inhibitors （DTIs） in patients during the perioperative period. METHODS Led by Sichuan Academy of Medical Sciences & Sichuan Provincial People’s Hospital （the Affiliated Hospital of UESTC）， a multidisciplinary working group was established. Through literature review and the Delphi method， clinical questions related to the rational perioperative use of parenteral DTIs were identified. A structured design was adopted using the “Population-Intervention-Comparison-Outcome” framework； systematic searches were conducted in CNKI， Medline， Embase and other databases. Relevant evidence from randomized controlled trials and cohort studies was included and synthesized. Evidence quality was assessed using the Grades of Recommendations Assessment，Development and Evaluation （GRADE） approach， and recommendations were formulated through multiple rounds of Delphi surveys and expert consensus meetings. RESULTS &CONCLUSIONS Seven recommendations （each with an expert consensus rate exceeding 90%） on the use of parenteral DTIs in perioperative patients were developed. These recommendations specify drug selection， dosing ranges， key monitoring points， and safety management strategies for parenteral DTIs in various scenarios， including the perioperative period of ventricular assist device implantation， the perioperative period of cardiac surgery， perioperative patients with lower-extremity atherosclerotic disease， the perioperative period of percutaneous coronary intervention in patients with acute coronary syndrome， the perioperative period of carotid artery stenting in patients with carotid stenosis， the perioperative period of patients with right heart thrombosis， and patients who develop related thrombosis and dysfunction after a central venous catheter insertion. In addition， warning and management pathways for perioperative bleeding and thrombotic events were proposed. This expert consensus， which is formulated based on the best available evidence， provides evidence-based guidance for standardized and individualized use of parenteral DTIs in perioperative period.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.