1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Action Mechanism of Huamoyan Granules in Treatment of Knee Osteoarthritis Based on TRPV1/p38 MAPK Pathway
Jin ZHANG ; Lili YANG ; Canwen ZHENG ; Jing KANG ; Yanlei MA ; Yue SHI ; Lei LI ; Hongxu MENG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(4):79-89
ObjectiveThis paper aims to observe the protective effect of Huamoyan granules on knee osteoarthritis (KOA) and explore whether its protective effect is oriented toward an anti-inflammatory direction by regulation of macrophage polarization, which can effectively inhibit the progression of pathological inflammatory response, reduce the release of inflammatory pain mediators, and downregulate the protein expression level of transient receptor potential vanilloid 1 (TRPV1), so as to provide experimental evidence for its clinical application and investigate its action mechanism. MethodsAfter adaptive feeding, Sprague-Dawley (SD) rats were randomly divided into six groups: sham group, model group, celecoxib group, and high, medium, and low-dose synovitis granule groups (9.6, 4.8, 2.4 g·kg-1). The administration dose of celecoxib capsules was 20 mg·kg-1. There were 10 rats in the sham group and 12 rats in the model group and each administration group. A KOA animal model was established by means of intra-articular injection of sodium iodoacetate into the knee joint. From the 10th day of the experiment, each administration group was given intragastric administration at a dose of 10 mL·kg-1 for 4 weeks. General conditions of rats in each group were assessed daily. The pressure pain threshold (PPT) to mechanical stimulation and joint diameter were recorded. X-ray examination was performed on the right knee joints of rats for imaging analysis. Enzyme linked immunosorbent assay (ELISA) was performed to detect the tumor necrosis factor-α (TNF-α), serum interleukin-1β (IL-1β), and other pro-inflammatory cytokines in rat serum samples, as well as the expression levels of neurogenic inflammatory mediators such as nerve growth factor (NGF) and calcitonin gene-related peptide (CGRP). Histopathological changes in the knee joint synovial tissues were examined by hematoxylineosin (HE) staining. Safranin O-fast green staining was performed to observe and evaluate the degree of knee cartilage lesions. Western blot was employed to quantitatively analyze TRPV1, p38 mitogen-activated protein kinase (p38 MAPK), and phosphorylated (p)-p38 MAPK in rat knee synovial tissues. Immunofluorescence (IF) was used to measure and assess M1/M2 macrophage polarization. ResultsCompared with those in the sham group, the circumference and joint diameter of the right knee were markedly enlarged in the model group (P<0.01), while PPTs of rats showed a significant reduction (P<0.01). The contents of IL-1β, TNF-α, CGRP, and NGF in rats' serum were significantly elevated (P<0.01), and the synovial Krenn score was increased (P<0.01). The Mankin score of cartilage tissue was increased (P<0.01), and the protein expressions of TRPV1 and p-p38 MAPK/p38 MAPK were significantly upregulated (P<0.01). The experimental intervention significantly reduced the proportion of pro-inflammatory M1 macrophages in the total macrophage population (P<0.01), and the percentage of M2 macrophages was decreased (P<0.01). The M1/M2 macrophage ratio was significantly elevated (P<0.01). Knee joint diameters of all dose groups of Huamoyan granules and the celecoxib group were reduced (P<0.01) compared with those of the model group, and the PPT recovery speeds in the high and medium-dose groups of Huamoyan granules were more obvious (P<0.05). The contents of IL-1β, CGRP, and NGF in the rats' serum in all administration groups were significantly reduced (P<0.05, P<0.01), and the content of TNF-α in rats' serum was significantly reduced (P<0.01). All dose groups of Huamoyan granules demonstrated significant reductions in both synovial Krenn score (P<0.05, P<0.01) and protein expression of TRPV1 and p-p38 MAPK/p38 MAPK in rats' synovial tissues (P<0.01). The percentage of M1 macrophages in the synovial tissues of the celecoxib group and all dose groups of Huamoyan granules was decreased (P<0.01). The percentage of M2 macrophages was increased (P<0.05), and the M1/M2 ratio was decreased (P<0.01). ConclusionHuamoyan granules can alleviate the inflammatory response of KOA, reduce the release of inflammatory pain mediators, and downregulate TRPV1 protein expression by regulating macrophage polarization. Its mechanism may be related to the TRPV1/p38 MAPK signaling pathway, thereby achieving the effect of improving peripheral pain hypersensitivity in KOA.
3.Expert consensus on clinical application of parenteral direct thrombin inhibitors in perioperative period
Mingyu JIANG ; Yuan BIAN ; Lizhu HAN ; Qinan YIN ; Fengjiao KANG ; Anhua WEI ; Danjie ZHAO ; Lin WANG ; Ying SHAO ; Li TANG ; Yi WANG ; Shuhong LIANG ; Huijuan LIU ; Guirong XIAO ; Yue LI
China Pharmacy 2026;37(6):689-699
OBJECTIVE To form an expert consensus on the clinical application of parenteral direct thrombin inhibitors (DTIs) in patients during the perioperative period. METHODS Led by Sichuan Academy of Medical Sciences & Sichuan Provincial People’s Hospital (the Affiliated Hospital of UESTC), a multidisciplinary working group was established. Through literature review and the Delphi method, clinical questions related to the rational perioperative use of parenteral DTIs were identified. A structured design was adopted using the “Population-Intervention-Comparison-Outcome” framework; systematic searches were conducted in CNKI, Medline, Embase and other databases. Relevant evidence from randomized controlled trials and cohort studies was included and synthesized. Evidence quality was assessed using the Grades of Recommendations Assessment,Development and Evaluation (GRADE) approach, and recommendations were formulated through multiple rounds of Delphi surveys and expert consensus meetings. RESULTS &CONCLUSIONS Seven recommendations (each with an expert consensus rate exceeding 90%) on the use of parenteral DTIs in perioperative patients were developed. These recommendations specify drug selection, dosing ranges, key monitoring points, and safety management strategies for parenteral DTIs in various scenarios, including the perioperative period of ventricular assist device implantation, the perioperative period of cardiac surgery, perioperative patients with lower-extremity atherosclerotic disease, the perioperative period of percutaneous coronary intervention in patients with acute coronary syndrome, the perioperative period of carotid artery stenting in patients with carotid stenosis, the perioperative period of patients with right heart thrombosis, and patients who develop related thrombosis and dysfunction after a central venous catheter insertion. In addition, warning and management pathways for perioperative bleeding and thrombotic events were proposed. This expert consensus, which is formulated based on the best available evidence, provides evidence-based guidance for standardized and individualized use of parenteral DTIs in perioperative period.
4.Study on anti-atherosclerosis mechanism of blood components of Guanxin Qiwei tablets based on HPLC-Q-Exactive-MS/MS and network pharmacology
Yuan-hong LIAO ; Jing-kun LU ; Yan NIU ; Jun LI ; Ren BU ; Peng-peng ZHANG ; Yue KANG ; Yue-wu WANG
Acta Pharmaceutica Sinica 2025;60(2):449-458
The analysis presented here is based on the blood components of Guanxin Qiwei tablets, the key anti-atherosclerosis pathway of Guanxin Qiwei tablets was screened by network pharmacology, and the anti-atherosclerosis mechanism of Guanxin Qiwei tablets was clarified and verified by cell experiments. HPLC-Q-Exactive-MS/MS technique was used to analyze the components of Guanxin Qiwei tablets into blood, to determine the precise mass charge ratio of the compounds, and to conduct a comprehensive analysis of the components by using secondary mass spectrometry fragments and literature comparison. Finally, a total of 42 components of Guanxin Qiwei tablets into blood were identified. To better understand the interactions, we employed the Swiss Target Prediction database to predict the associated targets. Atherosclerosis (AS) disease targets were searched in disease databases Genecard, OMIM and Disgent, and 181 intersection targets of disease targets and component targets were obtained by Venny 2.1.0 software. Protein interactions were analyzed by String database. The 32 core targets were selected by Cytscape software. Gene Ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were performed in DAVID database. It was found that the anti-atherosclerosis pathways of Guanxin Qiwei tablets mainly include lipid metabolism and atherosclerosis and AGE-RAGE signaling pathway in diabetic complications and other signal pathways. The core targets and the core compounds were interlinked, and it was found that cryptotanshinone and tanshinone ⅡA in Guanxin Qiwei tablets were well bound to TNF, PPAR
5.Disease burden and annual change trends of gastric cancer in China in 1990 - 2021
Siming NING ; Ruixia YANG ; Yanan JIN ; Yue YANG ; Xiaoning KANG
Journal of Public Health and Preventive Medicine 2025;36(4):17-21
Objective To analyze the burden and epidemic trends of gastric cancer in China from 1990 to 2021, and to provide a scientific basis for the formulation of effective prevention and control strategies. Methods Data from the 2021 Global Burden of Disease (GBD) database were used to extract the number of the incidence, prevalence, and death cases, as well as the disability-adjusted life years (DALY) for gastric cancer in China from 1990 to 2021. The corresponding crude rates and age-standardized rates were calculated. The Joinpoint regression model was employed to analyze the trends in the burden of gastric cancer, and a comprehensive examination was conducted from multiple dimensions including age, gender, and time. Results From 1990 to 2021, the age-standardized incidence rate (ASIR) of gastric cancer in China decreased from 48.03 per 100,000 to 29.05 per 100,000, the age-standardized prevalence rate (ASPR) decreased from 67.17 per 100,000 to 57.23 per 100,000, the age-standardized mortality rate (ASMR) decreased from 46.05 per 100,000 to 21.51 per 100,000, and the age-standardized DALY rate (ASDR) decreased from 1181.61 per 100,000 to 501.26 per 100,000. The AAPCs of ASIR, ASPR, ASMR, and ASDR were -1.61%, -0.50%, -2.44%, and -2.75%, respectively. The incidence, prevalence, mortality and DALY rates showed a trend of increasing first and then decreasing with age. Although females had higher incidence, prevalence, mortality, and DALY numbers in the older age groups, males exhibited higher crude rates across all age groups. Conclusion The overall disease burden of gastric cancer in China showed a downward trend from 1990 to 2021, and men and middle-aged and elderly people are the key populations for prevention and control efforts.
7.Outcome indicators in randomized controlled trials of traditional Chinese medicine treatment of post-stroke depression.
Jin HAN ; Yue YUAN ; Fang-Biao XU ; Yan-Bo SONG ; Yong-Kang SUN ; Xin-Zhi WANG
China Journal of Chinese Materia Medica 2025;50(2):542-559
This study systematically reviewed the randomized controlled trial(RCT) of traditional Chinese medicine(TCM) treatment of post-stroke depression(PSD) and analyzed the clinical study characteristics and outcome indicators, aiming to optimize the design and establish the core outcome set in the future clinical trials of the TCM treatment of PSD. PubMed, Web of Science, Cochrane Library, EMbase, CNKI, VIP, Wanfang, and SinoMed were searched for the relevant RCT published in recent 3 years. The basic characteristics, intervention measures, and outcome indicators of the included RCT were extracted, and the descriptive analysis was carried out. A total of 76 RCTs were eventually included, with the sample size concentrated in 80-100 cases. The most frequent TCM syndromes were liver depression and Qi stagnation(15 times, 31.91%) and phlegm combined with stasis(5 times, 10.63%). The frequency of intervention methods followed a descending trend of TCM decoction(35 times, 46.05%) and TCM decoction + acupuncture(4 times, 5.26%), Chinese patent medicine(3 times, 3.94%), and the intervention mainly lasted for 1 to 3 months(43 times, 60.56%). The adverse reactions of patients were mainly digestive system reaction(150 patients, 39.37%) and nervous system reaction(112 patients, 29.39%). Most of the included studies had unclear risk of bias, involving 84 outcome indicators, which belonged to 8 indicator domains. The RCTs of TCM treatment of PSD showed a variety of problems, such as non-standard TCM syndrome differentiation, inconsistent names of TCM syndrome scores and measurement tools, low quality, unclear risk of bias, neglect of endpoint indicators, unreasonable selection of substitute indicators, lack of differentiation between primary and secondary outcome indicators, non-standard reporting of safety indicators, insufficient attention to economic indicators, and lack of long-term prognosis evaluation. It is suggested that the future research should improve the quality of methodology and build a standardized core outcome set to promote the development of high-quality clinical research in this field.
Humans
;
Randomized Controlled Trials as Topic
;
Drugs, Chinese Herbal/administration & dosage*
;
Stroke/psychology*
;
Depression/etiology*
;
Treatment Outcome
;
Medicine, Chinese Traditional
8.Characteristics, microbial composition, and mycotoxin profile of fermented traditional Chinese medicines.
Hui-Ru ZHANG ; Meng-Yue GUO ; Jian-Xin LYU ; Wan-Xuan ZHU ; Chuang WANG ; Xin-Xin KANG ; Jiao-Yang LUO ; Mei-Hua YANG
China Journal of Chinese Materia Medica 2025;50(1):48-57
Fermented traditional Chinese medicine(TCM) has a long history of medicinal use, such as Sojae Semen Praeparatum, Arisaema Cum Bile, Pinelliae Rhizoma Fermentata, red yeast rice, and Jianqu. Fermentation technology was recorded in the earliest TCM work, Shen Nong's Classic of the Materia Medica. Microorganisms are essential components of the fermentation process. However, the contamination of fermented TCM by toxigenic fungi and mycotoxins due to unstandardized fermentation processes seriously affects the quality of TCM and poses a threat to the life and health of consumers. In this paper, the characteristics, microbial composition, and mycotoxin profile of fermented TCM are systematically summarized to provide a theoretical basis for its quality and safety control.
Fermentation
;
Mycotoxins/analysis*
;
Drugs, Chinese Herbal/analysis*
;
Fungi/classification*
;
Bacteria/genetics*
;
Drug Contamination
;
Medicine, Chinese Traditional
9.Ameliorative effects of Lycii Fructus-Chrysanthemi Flos at different ratios on retinal damage in mice.
Bing LI ; Sheng GUO ; Yue ZHU ; Xue-Sen WANG ; Dan-Dan WEI ; Hong-Jie KANG ; Wen-Hua ZHANG ; Jin-Ao DUAN
China Journal of Chinese Materia Medica 2025;50(3):732-740
This study aimed to compare the ameliorative effects of Lycii Fructus and Chrysanthemi Flos at different ratios on retinal damage in mice and to elucidate the underlying mechanisms. A retinal injury model was established by intraperitoneal injection of sodium iodate(NaIO_3) solution. The mice were divided into the following groups: blank group, model group, positive drug(AREDS 2) group, low-and high-dose groups of Lycii Fructus and Chrysanthemi Flos at 1∶1, low-and high-dose groups at 3∶1, and low-and high-dose groups at 1∶3. Administration was carried out 15 days after modeling. The visual acuity of the mice was assessed using the black-and-white box test. The fundus was observed using an optical coherence tomography device, and retinal thickness was measured. HE staining was used to observe the morphology and pathological changes of the retina. The levels of oxidative factors in serum and ocular tissues were measured using assay kits. The levels of inflammatory factors in serum and ocular tissues were detected by enzyme-linked immunosorbent assay(ELISA), and the expression of Nrf2, HO-1, and NF-κB proteins in ocular tissues was analyzed by Western blot. The results showed that after administration of Lycii Fructus and Chrysanthemi Flos at different ratios, the model group showed improved retinal thinning and disordered arrangement of retinal layers, elevated content of SOD and GSH in the serum and ocular tissues, and reduced levels of MDA, TNF-α, IL-1β, and IL-6. Lycii Fructus and Chrysanthemi Flos at 1∶1 and 1∶3 showed better improvement effects. The combination significantly upregulated the expression levels of Nrf2 and HO-1 and downregulated the expression of NF-κB p65. These results indicate that Lycii Fructus and Chrysanthemi Flos at different ratios can improve retinal damage, reduce oxidative stress, and alleviate inflammation in both the body and ocular tissues of mice. The mechanism may be related to the regulation of the Nrf2/HO-1 and NF-κB signaling pathways in ocular tissues. These findings provide a theoretical basis for the clinical application of Lycii Fructus and Chrysanthemi Flos in the treatment of dry age-related macular degeneration.
Animals
;
Mice
;
Retina/injuries*
;
Male
;
Lycium/chemistry*
;
Drugs, Chinese Herbal/administration & dosage*
;
Chrysanthemum/chemistry*
;
NF-kappa B/genetics*
;
Humans
;
Retinal Diseases/metabolism*
;
NF-E2-Related Factor 2/metabolism*
;
Oxidative Stress/drug effects*
;
Flowers/chemistry*
;
Heme Oxygenase-1/genetics*
10.Effects of Saccharomyces cerevisiae chassis cells with different squalene content on triterpenoid synthesis.
Feng ZHANG ; Kang-Xin HOU ; Yue ZHANG ; Hong-Ping HOU ; Yue ZHANG ; Chao-Yue LIU ; Xue-Mi HAO ; Jia LIU ; Cai-Xia WANG
China Journal of Chinese Materia Medica 2025;50(8):2130-2136
Many triterpenoid compounds have been successfully heterologously synthesized in Saccharomyces cerevisiae. To increase the yield of triterpenoids, various metabolic engineering strategies have been developed. One commonly applied strategy is to enhance the supply of precursors, which has been widely used by researchers. Squalene, as a precursor to triterpenoid biosynthesis, plays a crucial role in the synthesis of these compounds. This study primarily investigates the effect of different squalene levels in chassis strains on the synthesis of triterpenoids(oleanolic acid and ursolic acid), and the underlying mechanisms are further explored using real-time quantitative PCR(qPCR) analysis. The results demonstrate that the chassis strain CB-9-5, which produces high levels of squalene, inhibits the synthesis of oleanolic acid and ursolic acid. In contrast, chassis strains with moderate to low squalene production, such as Y8-1 and CNPK, are more conducive to the synthesis of oleanolic acid and ursolic acid. The qPCR analysis reveals that the expression levels of ERG1, βAS, and CrCYP716A154 in the oleanolic acid-producing strain CB-OA are significantly lower than those in the control strains C-OA and Y-OA, suggesting that high squalene production in the chassis strains suppresses the transcription of certain genes, leading to a reduced yield of triterpenoids. Our findings indicate that when constructing S. cerevisiae strains for triterpenoid production, chassis strains with high squalene content may suppress the expression of certain genes, ultimately lowering their production, whereas chassis strains with moderate squalene levels are more favorable for triterpenoid biosynthesis.
Squalene/analysis*
;
Saccharomyces cerevisiae/genetics*
;
Triterpenes/metabolism*
;
Metabolic Engineering
;
Oleanolic Acid/biosynthesis*
;
Ursolic Acid


Result Analysis
Print
Save
E-mail