1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.A Review of Methods for Establishing and Evaluating Animal Models of Stroke
Yunrong YANG ; Wenyu WU ; Yue TAN ; Guofeng YAN ; Yao LI ; Jin LU
Laboratory Animal and Comparative Medicine 2026;46(1):94-106
Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.
3.Analyzing the relationship between occupational stress and radiation protection knowledge-attitude-practice among radiation workers
Huiyu HOU ; Yue JIANG ; Dingqi JIAO ; Yiqing TIAN ; Huaxing ZHANG
China Occupational Medicine 2025;52(1):61-65
Objective To explore the influence of radiation protection knowledge-attitude-practice (RP-KAP) on occupational stress of radiation workers. Methods A total of 314 radiation workers from five hospitals in Shijiazhuang City were selected as the study subjects using the convenient sampling method. The Chinese version of the "Effort-Reward Imbalance (ERI) Questionnaire" and the "Radiation Protection Knowledge, Attitude, and Practice Questionnaire" were used for investigation. Results The detection rate of occupational stress in ERI model among the radiation workers was 74.5% (234/314). The RP-KAP practice dimension score of the population in the occupational stress group was lower than that in the non-occupational stress group (P<0.05). The results of binary logistic regression analysis showed that radiation workers with lower RP-KAP practice dimension score had a higher risk of occupational stress (P<0.01), and the risks of occupational stress among population of interventional radiology group and radiotherapy group were higher than that of X-ray diagnosis group and nuclear medicine group (both P<0.05), after controlling for confounding factors such as gender, age, type of work, professional title, daily working hours, weekly working hours and regular vacation. Conclusion RP-KAP is the influencing factor of occupational stress in the radiation workers. To improve the radiation workers' knowledge of radiation protection, protection awareness and compliance with protective behavior can effectively reduce or even eliminate occupational stress.
4.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.
5.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.
6.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.
7.Analysis of visual field manifestations of non-arteritic anterior ischemic optic neuropathy
Yue LI ; Ying WANG ; Wenxin JIAO ; Jilu LIN ; Jianing WANG
International Eye Science 2025;25(4):671-675
AIM: To observe the manifestations and distribution patterns of visual field in non-arteritic anterior ischemic optic neuropathy(NAION).METHODS: Retrospective observational study. The investigation encompassed 183 patients(246 eyes)diagnosed with NAION who were evaluated at the Neuro-Ophthalmology/Acupuncture Department within the Eye Hospital, China Academy of Chinese Medical Sciences from June 2018 to December 2023. Recorded clinical data covered demographic details, incidence, disease duration, presence of systemic diseases, and histories of tobacco and alcohol use, along with best-corrected visual acuity(BCVA), visual field index(VFI), type of visual field defect, and thickness of the peripapillary retinal nerve fiber layer(pRNFL).RESULTS: A total of 183 patients(246 eyes)were enrolled. The cohort consisted of 101 males and 82 females; 120 exhibited unilateral symptoms, while 63 showed bilateral symptoms, with a mean age of 56.20±9.78 years(range 29-81 years). The types of visual field defects observed were varied: 90 eyes(36.6%)had diffuse loss, 63 eyes(25.6%)experienced inferior hemifield loss, 32 eyes(13.0%)displayed ring scotomas, 22 eyes(8.9%)had arcuate scotomas, 11 eyes(4.5%)presented with quadrant defects, 15 eyes(6.1%)had sectorial or wedge defects, and 13 eyes(5.3%)showed superior hemifield loss. The BCVA(LogMAR)and VFI of patients with diffuse visual field loss were poorer than patients with other types of visual defects(all P<0.05). There were statistically significant differences in visual field defects among patients of different genders and ages(all P<0.05). However, history of hypertension, diabetes, hyperlipidemia, sleep apnea and other systemic diseases, history of smoking and alcohol, and course of disease did not show specificity in the NAION visual field(all P>0.05).CONCLUSION:NAION manifests with a broad spectrum of visual field impairments across different genders, age, and levels of visual functionality. Extensive future research is necessary to identify additional reasons influencing the types of visual field damage in NAION.
8.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.
9.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.
10.Five new triterpenoid saponins from the kernels of Momordica cochinchinensis
Ru DING ; Jia-qi WANG ; Yi-yang LUO ; Yong-long HAN ; Xiao-bo LI ; Meng-yue WANG
Acta Pharmaceutica Sinica 2025;60(2):442-448
Five saponins were isolated from the kernels of

Result Analysis
Print
Save
E-mail