AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

Objective To investigate the effective components and therapeutic mechanism of Chaihu-Guizhi-Ganjiang decoction in treating chronic non-atrophic gastritis. Methods The primary and secondary ion fragments of chemical components of Chaihu-Guizhi-Ganjiang decoction were obtained by UHPLC-Q-TOF/MS. Comparing with reference standards and literature information, a comprehensive characterization of the chemical constituents of Chaihu-Guizhi-Ganjiang decoction was conducted. Then, the network pharmacology approach was applied to explore the therapeutic mechanism of Chaihu-Guizhi-Ganjiang decoction in treatment of chronic non-atrophic gastritis based on the components in plasma and verified by immunohistochemical results. Results A total of 24 absorbed components of Chaihu-Guizhi-Ganjiang decoction were characterized, including 11 flavonoid glycosides, 3 fatty acids, 3organic acids, 2 gingerols, 2 flavonoids and, 1 each of fatty aldehydes, triterpenoids and amino acids, which mainly acted on TNF-α, IL-6, STAT3, and PTGS2. It exerted therapeutic effects by modulating signaling pathways, including the IL-17 signaling pathway and the AGE-RAGE signaling pathway, etc. Conclusion This study provided the first exploration of the effective components and therapeutic mechanism of Chaihu-Guizhi-Ganjiang decoction in treatment of chronic non-atrophic gastritis by UHPLC-Q-TOF/MS, which could offer scientific references for its further research.

Fermented traditional Chinese medicine(TCM) has a long history of medicinal use, such as Sojae Semen Praeparatum, Arisaema Cum Bile, Pinelliae Rhizoma Fermentata, red yeast rice, and Jianqu. Fermentation technology was recorded in the earliest TCM work, Shen Nong's Classic of the Materia Medica. Microorganisms are essential components of the fermentation process. However, the contamination of fermented TCM by toxigenic fungi and mycotoxins due to unstandardized fermentation processes seriously affects the quality of TCM and poses a threat to the life and health of consumers. In this paper, the characteristics, microbial composition, and mycotoxin profile of fermented TCM are systematically summarized to provide a theoretical basis for its quality and safety control.
Fermentation ; Mycotoxins/analysis* ; Drugs, Chinese Herbal/analysis* ; Fungi/classification* ; Bacteria/genetics* ; Drug Contamination ; Medicine, Chinese Traditional

To investigate the effects and mechanisms of Yougui Pills(YGP) on oxidative damage induced by hydrogen peroxide(H_2O_2) in human ovarian granulosa cells(KGN). The components in serum with low-and high-doses of YGP were analyzed and compared through ultra-high performance liquid chromatography-quadrupole electrostatic field orbitrap mass spectrometry(UHPLC-QEMS), and selected the serum containing YGP high-dose group to follow-up experiments. To stimulated KGN with 200 μmol·L~(-1) H_2O_2to establish an oxidative damage model, which was divided into normal group, model group, low-, medium-, and high-dose of YGP groups, and the efficacy was further verified on the basis of silencing or overexpressing serine protease inhibitor(Serpina3k), further validating the efficacy based on the silencing or overexpression of Serpina3k. TUNEL staining was used to detect cell apoptosis,enzyme-linked immunosorbent assay(ELISA) was employed to measure the secretion levels of estradiol(E_2) and 17β-E_2 in KGN, and Western blot was utilized to assess the expression of Serpina3k and proteins related to the Keap1/Nrf2 signaling pathway. The results show that compared to the model group, each dose group of YGP not only significantly reduces granulocyte apoptosis and upregulates the secretion levels of E_2 and 17β-E_2, but also significantly upregulates Serpina3k and Nrf2 pathway. Further research has found that overexpression of Serpina3k not only enhances the therapeutic effect of YGP but also increases the expression of Nrf2 and inhibits the expression of Keap1. Conversely, interfering with Serpina3k partially reverses the therapeutic effect of YGP, while also partially. The results indicate that the mechanism by which YGP improves oxidative stress in KGN may be related to its upregulation of Serpina3k expression, which affects the conduction of the Keap1/Nrf2 signaling pathway. This study reveals the mechanism by which YGP protects granular cells, providing a certain theoretical basis for its clinical application.
NF-E2-Related Factor 2/genetics* ; Kelch-Like ECH-Associated Protein 1/genetics* ; Humans ; Female ; Signal Transduction/drug effects* ; Oxidative Stress/drug effects* ; Granulosa Cells/cytology* ; Drugs, Chinese Herbal/pharmacology* ; Apoptosis/drug effects* ; Serpins/genetics*

The chemical constituents of Commiphora myrrha was investigated by column chromatography on silica gel, ODS, Sephadex LH-20, and semi-preparative HPLC. Their structures were elucidated by comprehensive spectroscopic methods including UV, IR, MS, NMR, as well as ECD calculation. Seven compounds were isolated from the dichloromethane-soluble fraction of C. myrrha and their structures were identified as(1S,2R,4S,5R,8S)-guaiane-2-hydroxy-7(11),10(15)-dien-6-oxo-12,8-olide(1), commipholide E(2), myrrhterpenoid H(3), myrrhterpenoid I(4), myrrhterpenoid E(5), 2α-methoxy-8α-hydroxy-6-oxogermacra-1(10),7(11)-dien-8,12-olide(6), 8,12-epoxy-1α,9α-hydroxy-eudesma-7,11-diene-6-dione(7). Compound 1 was a new compound and named myrrhterpenoid P. Compound 7 was isolated from Commiphora genus for the first time. Compounds 2, 5, and 6 significantly inhibited nitric oxide(NO) production in LPS-stimulated RAW264.7 cells, with IC_(50) values of(49.67±4.16),(40.80±1.27),(47.22±0.87) μmol·L~(-1), respectively [indomethacin as the positive control, with IC_(50) value of(63.92±2.60) μmol·L~(-1)].
Commiphora/chemistry* ; Animals ; Mice ; Resins, Plant/chemistry* ; Sesquiterpenes/isolation & purification* ; Molecular Structure ; Nitric Oxide ; Macrophages/metabolism* ; RAW 264.7 Cells ; Drugs, Chinese Herbal/pharmacology*

The seed kernel of Momordica cochinchinensis, i.e., Momordicae Semen, is used for medicinal purposes, but to date, no research has been reported on its chemical constituents. In this study, the chemical constituents of Momordicae Semen were investigated for the first time using silica gel column chromatography, semi-preparative HPLC, HR-MS, and NMR. As a result, eight compounds were isolated and identified as: p-hydroxybenzoic acid-7-O-trehaloside(mubeside A, 1), 2,6-dimethoxyphenol-O-β-D-apiosyl-(1→2)-β-D-glucoside(mubeside B, 2), 1-O-p-methoxybenzoyl-1,4-benzenediol-4-O-β-D-apiosyl-(1→2)-β-D-glucoside(mubeside C, 3), 1-O-p-hydroxybenzoyl-1,4-benzenediol-4-O-β-D-apiosyl-(1→2)-β-D-glucoside(mubeside D, 4), gypsogenin-3-O-β-D-galactosyl-(1→2)-β-D-glucuronoside(5), quillaic acid-3-O-β-D-galactosyl-(1→2)-β-D-glucuronoside(6), violanthin(7), and kaempferitrin(8). Compounds 1-4 are new compounds, while compounds 5-8 were isolated from Momordicae Semen for the first time.
Glycosides/isolation & purification* ; Drugs, Chinese Herbal/isolation & purification* ; Molecular Structure ; Magnetic Resonance Spectroscopy ; Chromatography, High Pressure Liquid

The chemical components of Carthami Flos were investigated by using macroporous resin, silica gel column chromatography, reversed-phase octadecylsilane(ODS) column chromatography, Sephadex LH-20, and semi-preparative high-performance liquid chromatography(HPLC). The planar structures of the compounds were established based on their physicochemical properties and ultraviolet-visible(UV-Vis), infrared(IR), high-resolution electrospray ionization mass spectrometry(HR-ESI-MS), and nuclear magnetic resonance(NMR) spectroscopic technology. The absolute configurations were determined by comparing the calculated and experimental electronic circular dichroism(ECD). Six flavonoid C-glycosides were isolated from the 30% ethanol elution fraction of macroporous resin obtained from the 95% ethanol extract of Carthami Flos, and identified as saffloquinoside F(1), 5-hydroxysaffloneoside(2), iso-5-hydroxysaffloneoside(3), isosafflomin C(4), safflomin C(5), and vicenin 2(6). Among these, the compounds 1 to 3 were new chalcone C-glycosides. The compounds 1, 2, 4, and 5 could significantly increase the viability of H9c2 cardiomyocytes damaged by oxygen-glucose deprivation/reoxygenation(OGD/R) at a concentration of 50 μmol·L~(-1), showing their good cardioprotective activity.
Glycosides/pharmacology* ; Flowers/chemistry* ; Drugs, Chinese Herbal/pharmacology* ; Carthamus tinctorius/chemistry* ; Chalcones/pharmacology* ; Animals

OBJECTIVE: To explore the corrective strategies and effectiveness of osteotomy surgery for severe lower limb deformities in hypophosphatemic rickets. METHODS: A retrospective analysis was conducted on 29 patients with severe lower limb deformities of hypophosphatemic rickets who underwent surgical treatment between February 2012 and August 2024. There were 9 males and 20 females. The age ranged from 13 to 53 years, with an average of 24.6 years. All patients were deformities of both lower limbs, presenting as 24 cases of O-shaped legs, 2 cases of wind-blown deformities, and 3 cases of X-shaped legs. Based on the full-length films of both lower limbs in the standing position before operation, the osteotomy planes of the femur, tibia, and fibula were designed. Among them, if both the same-sided thigh and leg were deformed, staged surgeries of both lower limbs were selected. If only the thigh or leg were deformed, simultaneous surgeries of both lower limbs were selected. The femur deformity was corrected immediately after osteotomy at the deformed plane; the osteotomy fragment was temporarily controlled with an external fixator, which was removed after perform internal fixation with a steel plate. After fibular osteotomy, the Ilizarov frame or Taylor frame was installed on the tibia and fibula. The threaded rods were removed and then tibial osteotomy was performed on the deformed plane. Patients using the Taylor frame did not undergo deformity correction during operation. The external fixators were adjusted starting 7 days after operation to correct the varus, valgus, and rotational deformities of the lower limb. Patients using the Ilizarov frame corrected the rotational deformity of the tibia during operation. The external fixator was adjusted starting 7 days after operation to correct the varus and valgus deformities of the lower limb. During the treatment period, the patient could walk with partial weight-bearing on the operated limb with crutches. The external fixator was removed after the bone healed. Before operation and at last follow-up, the medial proximal tibial angle (MPTA), lateral distal tibial angle (LDTA), posterior proximal tibial angle (PPTA), anterior distal tibial angle (ADTA), anatomic lateral distal femoral angle (aLDFA), posterior distal femoral angle (PDFA), and mechanical axis deviation (MAD), lower limb rotation, limb length discrepancy (LLD) were measured. The self-made scoring criteria were adopted to evaluate the degree of lower limb deformity of the patients. RESULTS: All operations were successfully completed, and no complications such as nerve or vascular injury occurred. The adjustment time of the external fixator of the lower limb after operation was 28-46 days, with an average of 37.4 days. The wearing time of the external fixator ranged from 134 to 398 days, with an average of 181.5 days. Mild pin tract infections occurred in 2 limbs. The osteofascial compartment syndrome occurred in 1 limb after operation. No complications related to orthopedic adjustment of the external fixator occurred in other patients. All patients were followed up 6-56 months, with an average of 28.2 months. At last follow-up, full-length films of both lower limbs in the standing position showed that the coronal mechanical axes of the lower limbs of all patients returned to the normal. At last follow-up, MPTA, LDTA, PPTA, aLDFA, PDFA, MAD, lower limb rotation, LLD, and the score of lower limb deformity significantly improved when compared with those before operation ( P<0.05). There was no significant difference in ADTA between pre- and post-operation ( P>0.05). The degree of lower limb deformity were rated as moderate in 2 cases and poor in 27 cases before operation and as excellent in 7 cases, good in 18 cases, and moderate in 4 cases at last follow-up, with an excellent and good rate of 86.2%. CONCLUSION For severe lower limb deformities in hypophosphatemic rickets, immediate correction of deformities with femoral osteotomy and internal plate fixation, as well as gradually correction of deformities with tibiofibular osteotomy and circular external fixation (Ilizarov frame or Taylor frame), have satisfactory therapeutic effects.
Humans ; Male ; Osteotomy/instrumentation* ; Female ; Adult ; Retrospective Studies ; Tibia/abnormalities* ; Adolescent ; Femur/abnormalities* ; Middle Aged ; Fibula/surgery* ; Rickets, Hypophosphatemic/complications* ; Young Adult ; Treatment Outcome ; External Fixators ; Bone Plates ; Lower Extremity Deformities, Congenital/etiology*