Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

With the accelerating trend of population aging, the number of elderly patients with lung cancer continues to rise, and the disease burden is becoming increasingly heavy. The clinical management of these patients faces severe challenges due to their decreased physiological reserve, complex comorbidities, and significant individual heterogeneity. Consequently, under traditional diagnosis and treatment models, doctors often struggle to identify the individualized risks of elderly patients in a timely and comprehensive manner, which can easily lead to decision biases such as undertreatment or overtreatment. In view of this, this study advocates for the establishment of an umbrella decision-making model specifically tailored for elderly lung cancer patients. Grounded in a multidisciplinary team (MDT) platform, this model deeply integrates oncological indicators with the comprehensive geriatric assessment (CGA) system. By holistically considering multidimensional variables including tumor burden, organ function, frailty index, cognitive status, and social support, the model establishes an operational mechanism characterized by "single entry, precise stratification, and targeted selection". Accordingly, patients can be scientifically triaged into distinct intervention tiers, such as active surveillance, minimally invasive surgery, drug therapy, radiotherapy, and best supportive care, thereby achieving real-time alignment between treatment intensity and patient fitness. This article elaborates on the construction logic and key operational procedures of this novel decision-making framework, aiming to guide clinical practice beyond the limitations of a tumor-centric perspective toward a holistic, dynamic, whole-course management strategy. This transition seeks to ensure optimal quality of life and clinical net benefit for elderly patients alongside survival prolongation.

ObjectiveTo construct a prediction model for high responsiveness to short-term aerobic training in patients with Parkinson's disease (PD) based on dual-task gait assessment, and to provide evidence for identifying individuals who are most likely to benefit from such interventions. MethodsA total of 42 patients with PD who visited the outpatient clinic of Tianjin Huanhu Hospital between August 29, 2023 and December 19, 2024 were enrolled. All participants completed a 4-week home-based aerobic cycling training program and underwent dual-task gait assessments pre- and post-training. Patients were classified into high-response group (n = 12) and low-response group (n = 30) according to whether the improvement in gait speed reached the minimal clinically important difference of 0.1 m/s. The clinical validity of this grouping was verified by comparing differences in cardiopulmonary exercise testing parameters and dual-task gait indicators between the two groups pre- and post-training. Based on baseline characteristics, Firth's penalized maximum likelihood logistic regression was applied to construct a predictive model for high responsiveness, and the discriminative performance of the model was assessed preliminarily. ResultsThe high-response group showed significantly greater improvement in gait speed, step length, cadence and the anaerobic threshold to maximal oxygen uptake ratio after training compared with the low-response group (P < 0.05), confirming the clinical validity of the grouping. The baseline anaerobic threshold to maximal oxygen uptake ratio (OR = 3.348), body mass index (OR = 2.229) and age (OR = 0.428) demonstrated certain discriminative ability in the present sample. The area under the receiver operating characteristic curve was 0.831, with an overall prediction accuracy of 81.0%, specificity of 83.3% and sensitivity of 75.0%. Robustness of the model was confirmed via internal validation using the Bootstrap method, which suggested that the results were informative, but further validation was still required. ConclusionThe anaerobic threshold/maximal oxygen uptake ratio, body mass index and age may predict the response to short-term aerobic training in patients with PD.

Quality control (QC) of biospecimens from oral and maxillofacial tumors patients constitutes a critical foundation for the prevention, diagnosis, treatment, and precision medicine research of these diseases. Biospecimen quality directly governs the discovery and validation of disease biomarkers, the elucidation of pathogenesis, and the efficacy of clinical translation. QC spans the entire biospecimen lifecycle—encompassing collection, processing, storage, transportation, and utilization. Its primary objectives are to ensure sample integrity, reliability, traceability, and consistency, thereby guaranteeing the robustness of research data; the accuracy of molecular subtyping, biomarker identification, and treatment response prediction; and the precision of clinical decision-making. However, current QC frameworks for these biospecimens remain underdeveloped. Drawing on domestic and international technical standards, regulatory guidelines, and recent research advances, this paper elaborates on the importance of implementing a QC management system throughout the biospecimen lifecycle. It focuses on QC methodologies tailored to diverse biospecimen types, examining how standardized sampling procedures, regulated preprocessing workflows, and optimized long-term storage conditions influence sample quality. We aim to provide concrete guidance and a transferable paradigm for establishing standardized QC protocols and an informatics-enabled traceability system specific to oral and maxillofacial tumors. Such efforts are intended to enhance the research value and clinical utility of these biospecimens, furnishing reliable sample resources and technical support for the development of precision diagnostics and therapeutics. Furthermore, we advocate for a dual-track “QC plus Ethics” management framework within biobanks. This approach would reinforce ethical and legal safeguards, establishing a robust barrier to support safe scientific innovation and clinical translation.

With the accelerating aging of the population, the proportion of elderly patients with lung cancer continues to rise, presenting multiple challenges to perioperative management. This paper systematically reviews the clinical characteristics of elderly lung cancer patients. Based on the comprehensive geriatric assessment, it proposes incorporating seven major geriatric syndromes—frailty, delirium, sarcopenia, cognitive impairment, malnutrition, dysphagia, and mood disorders—into the core evaluation system. By integrating multimorbidity management with complication prevention and control, an integrated "geriatric syndrome-multimorbidity-complication" perioperative management model is constructed. Furthermore, this paper outlines stratified intervention strategies for geriatric syndromes, a "five-step" workflow for comorbidity management, and a comprehensive intervention pathway for complications across the preoperative, intraoperative, and postoperative phases. Multidisciplinary team (MDT) collaboration serves as the core mechanism to achieve individualized comprehensive treatment. This paper aims to provide a novel perioperative comprehensive treatment model for elderly lung cancer patients, which is centered on geriatrics, supported by multidisciplinary collaboration, and guided by precision medicine.

AIM: To observe the manifestations and distribution patterns of visual field in non-arteritic anterior ischemic optic neuropathy(NAION).METHODS: Retrospective observational study. The investigation encompassed 183 patients(246 eyes)diagnosed with NAION who were evaluated at the Neuro-Ophthalmology/Acupuncture Department within the Eye Hospital, China Academy of Chinese Medical Sciences from June 2018 to December 2023. Recorded clinical data covered demographic details, incidence, disease duration, presence of systemic diseases, and histories of tobacco and alcohol use, along with best-corrected visual acuity(BCVA), visual field index(VFI), type of visual field defect, and thickness of the peripapillary retinal nerve fiber layer(pRNFL).RESULTS: A total of 183 patients(246 eyes)were enrolled. The cohort consisted of 101 males and 82 females; 120 exhibited unilateral symptoms, while 63 showed bilateral symptoms, with a mean age of 56.20±9.78 years(range 29-81 years). The types of visual field defects observed were varied: 90 eyes(36.6%)had diffuse loss, 63 eyes(25.6%)experienced inferior hemifield loss, 32 eyes(13.0%)displayed ring scotomas, 22 eyes(8.9%)had arcuate scotomas, 11 eyes(4.5%)presented with quadrant defects, 15 eyes(6.1%)had sectorial or wedge defects, and 13 eyes(5.3%)showed superior hemifield loss. The BCVA(LogMAR)and VFI of patients with diffuse visual field loss were poorer than patients with other types of visual defects(all P<0.05). There were statistically significant differences in visual field defects among patients of different genders and ages(all P<0.05). However, history of hypertension, diabetes, hyperlipidemia, sleep apnea and other systemic diseases, history of smoking and alcohol, and course of disease did not show specificity in the NAION visual field(all P>0.05).CONCLUSION:NAION manifests with a broad spectrum of visual field impairments across different genders, age, and levels of visual functionality. Extensive future research is necessary to identify additional reasons influencing the types of visual field damage in NAION.

Five saponins were isolated from the kernels of Momordica cochinchinensis, by macroporous resin, silica gel, ODS column chromatography, and semi preparative HPLC. Based on MS and NMR analysis, combining with alkaline hydrolysis and acid hydrolysis, their structures were identified as: gypsogenin-3-O-{β-D-galactopyranosyl (1→2)-[α-L-rhamnopyranosyl (1→3)]-β-D-glucuropyranonosyl}-28-O-β-D-xylopyranosyl (1→3)-[β-D-xylopyranosyl (1→4)]-α-L-rhamnopyranosyl (1→2)-β-D-fucopyranoside (1), quillaic acid-3-O-{β-D-galactopyranosyl (1→2)-[α-L-rhamnopyranosyl (1→3)]-β-D-glucuropyranonosyl}-28-O-β-D-xylopyranosyl (1→3)-[β-D-xylopyranosyl (1→4)]-α-L-rhamnopyranosyl (1→2)-β-D-fucopyranoside (2), gypsogenin-3-O-β-D-galactopyranosyl (1→2)-[α-L-rhamnopyranosyl (1→3)]-β-D-glucuropyranonoside sodium (3), quillaic acid-3-O-β-D-galactopyranosyl (1→2)-[α-L-rhamnopyranosyl (1→3)]-β-D-glucuropyranonoside sodium (4), 18α-quillaic acid-3-O-β-D-galactopyranosyl (1→2)-[α-L-rhamnopyranosyl (1→3)]-β-D-glucuropyranonoside (5). Compounds 1-5 were new compounds, and named as mubezhisides A, B, C, D, E, respectively. They all could obviously inhibited the growth of Candida albicans, C. parapsilosis, and C. tropicalis.

OBJECTIVE To construct a predictive tool for surgical site infections(SSIs)in spinal surgery for Chi-nese population to provide evidence support for reducing SSIs.METHODS A systematic review of Chinese and English database literature was conducted for Meta-analysis to obtain pooled risk values for influencing factors,and a risk prediction scoring tool was constructed based on the logistic regression model.Patients who underwent spinal surgery and completed postoperative follow-up in a tertiary hospital in Beijing from Jan.to Dec.2021 were selected to validate the predictive effect of the tool.RESULTS The predictive model for SSIs in Chinese spinal sur-gery patients was Logit(P)=—3.47+0.63(age 60 years)+0.31 ×(patient with cardiovascular disease)+0.69 ×(rheumatoid arthritis)+1.07 ×(diabetes)+1.06 ×(operation duration＞3 h)+1.17 ×(preopera-tive albumin＜35 g/L)+0.71 ×(history of spinal surgery)+0.67 ×(carrying internal implants)+0.73 ×(blood transfusion).The total score of the predictive tool was 92,with a cutoff score of≥24.50 indicating high-risk individuals.The area under the curve was 0.733,with the sensitivity 58.30％and the specificity 79.60％.CONCLUSION The established predictive model for SSIs in Chinese spine surgery demonstrates good predictive performance and can be used as a reference assessment tool in clinical practice.

Objective:To identify the prognostic value of the Revised 15-item Myelodysplastic Syndrome-specific frailty scale (FS-15) in Chinese patients with myelodysplastic syndromes (MDS) .Methods:This retrospective study analyzed 812 patients with newly diagnosed MDS admitted to the Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences, and Peking Union Medical College from August 2016 to June 2023. Patients were assessed using the FS-15 and subsequently categorized into frail and non-frail groups. Clinical and laboratory characteristics, as well as overall survival (OS), were compared between these groups.Results:① The median patient age was 55 years ( IQR 45–64), with a median follow-up of 22.5 months (95% CI: 20.2–24.9) and a median OS of 43.3 months (95% CI: 36.8–49.8). The median FS-15 score was 0.42, with a cutoff value of 0.44. Male patients demonstrated higher median FS-15 scores than female patients (0.42 vs 0.38, P=0.006). In both the Revised International Prognostic Scoring System (IPSS-R; P=0.001) and Molecular International Prognostic Scoring System (IPSS-M; P=0.014) stratifications, FS-15 scores were significantly higher in the very high-risk group compared with the very low-risk group. ② The median OS was 54.7 months (95% CI: 47.5–NA) and 31.5 months (95% CI: 22.9–41.0) in the nonfrail ( n=452) and frail groups ( n=360), respectively ( P<0.001). The 3-year OS rates were (63.2 ± 3.2) % and (46.4 ± 3.6) % for the non-frail and frail groups, with 5-year OS rates of (49.9 ± 4.7) % and (32.0 ± 4.3) %, respectively ( P<0.001). ③Subgroup analysis revealed that nonfrail patients demonstrated significantly higher 3-year OS rates than frail patients in both the IPSS-M low-risk and very high-risk groups (all P<0.05). Similarly, nonfrail patients demonstrated superior 3-year OS rates compared with frail patients in the IPSS-R very low-risk, low-risk, and high-risk groups (all P<0.05). ④Among patients receiving hypomethylating agent therapy, the overall response rate was significantly higher in the non-frail group than in the frail group (86.7% vs 64.6%, P=0.007). Moreover, the frail group experienced higher rates of treatment-related adverse events, including febrile neutropenia (67.1% vs 47.4%, P=0.016) and liver function abnormalities (30.0% vs 14.5%, P=0.023), compared with the non-frail group. Conclusion:The FS-15 frailty score is a feasible and effective tool for assessing frailty in patients newly diagnosed with MDS in China and serves as a valuable prognostic indicator.