AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

With the accelerating trend of population aging, the number of elderly patients with lung cancer continues to rise, and the disease burden is becoming increasingly heavy. The clinical management of these patients faces severe challenges due to their decreased physiological reserve, complex comorbidities, and significant individual heterogeneity. Consequently, under traditional diagnosis and treatment models, doctors often struggle to identify the individualized risks of elderly patients in a timely and comprehensive manner, which can easily lead to decision biases such as undertreatment or overtreatment. In view of this, this study advocates for the establishment of an umbrella decision-making model specifically tailored for elderly lung cancer patients. Grounded in a multidisciplinary team (MDT) platform, this model deeply integrates oncological indicators with the comprehensive geriatric assessment (CGA) system. By holistically considering multidimensional variables including tumor burden, organ function, frailty index, cognitive status, and social support, the model establishes an operational mechanism characterized by "single entry, precise stratification, and targeted selection". Accordingly, patients can be scientifically triaged into distinct intervention tiers, such as active surveillance, minimally invasive surgery, drug therapy, radiotherapy, and best supportive care, thereby achieving real-time alignment between treatment intensity and patient fitness. This article elaborates on the construction logic and key operational procedures of this novel decision-making framework, aiming to guide clinical practice beyond the limitations of a tumor-centric perspective toward a holistic, dynamic, whole-course management strategy. This transition seeks to ensure optimal quality of life and clinical net benefit for elderly patients alongside survival prolongation.

ObjectiveTo construct a prediction model for high responsiveness to short-term aerobic training in patients with Parkinson's disease (PD) based on dual-task gait assessment, and to provide evidence for identifying individuals who are most likely to benefit from such interventions. MethodsA total of 42 patients with PD who visited the outpatient clinic of Tianjin Huanhu Hospital between August 29, 2023 and December 19, 2024 were enrolled. All participants completed a 4-week home-based aerobic cycling training program and underwent dual-task gait assessments pre- and post-training. Patients were classified into high-response group (n = 12) and low-response group (n = 30) according to whether the improvement in gait speed reached the minimal clinically important difference of 0.1 m/s. The clinical validity of this grouping was verified by comparing differences in cardiopulmonary exercise testing parameters and dual-task gait indicators between the two groups pre- and post-training. Based on baseline characteristics, Firth's penalized maximum likelihood logistic regression was applied to construct a predictive model for high responsiveness, and the discriminative performance of the model was assessed preliminarily. ResultsThe high-response group showed significantly greater improvement in gait speed, step length, cadence and the anaerobic threshold to maximal oxygen uptake ratio after training compared with the low-response group (P < 0.05), confirming the clinical validity of the grouping. The baseline anaerobic threshold to maximal oxygen uptake ratio (OR = 3.348), body mass index (OR = 2.229) and age (OR = 0.428) demonstrated certain discriminative ability in the present sample. The area under the receiver operating characteristic curve was 0.831, with an overall prediction accuracy of 81.0%, specificity of 83.3% and sensitivity of 75.0%. Robustness of the model was confirmed via internal validation using the Bootstrap method, which suggested that the results were informative, but further validation was still required. ConclusionThe anaerobic threshold/maximal oxygen uptake ratio, body mass index and age may predict the response to short-term aerobic training in patients with PD.

Quality control (QC) of biospecimens from oral and maxillofacial tumors patients constitutes a critical foundation for the prevention, diagnosis, treatment, and precision medicine research of these diseases. Biospecimen quality directly governs the discovery and validation of disease biomarkers, the elucidation of pathogenesis, and the efficacy of clinical translation. QC spans the entire biospecimen lifecycle—encompassing collection, processing, storage, transportation, and utilization. Its primary objectives are to ensure sample integrity, reliability, traceability, and consistency, thereby guaranteeing the robustness of research data; the accuracy of molecular subtyping, biomarker identification, and treatment response prediction; and the precision of clinical decision-making. However, current QC frameworks for these biospecimens remain underdeveloped. Drawing on domestic and international technical standards, regulatory guidelines, and recent research advances, this paper elaborates on the importance of implementing a QC management system throughout the biospecimen lifecycle. It focuses on QC methodologies tailored to diverse biospecimen types, examining how standardized sampling procedures, regulated preprocessing workflows, and optimized long-term storage conditions influence sample quality. We aim to provide concrete guidance and a transferable paradigm for establishing standardized QC protocols and an informatics-enabled traceability system specific to oral and maxillofacial tumors. Such efforts are intended to enhance the research value and clinical utility of these biospecimens, furnishing reliable sample resources and technical support for the development of precision diagnostics and therapeutics. Furthermore, we advocate for a dual-track “QC plus Ethics” management framework within biobanks. This approach would reinforce ethical and legal safeguards, establishing a robust barrier to support safe scientific innovation and clinical translation.

Objective To investigate the effective components and therapeutic mechanism of Chaihu-Guizhi-Ganjiang decoction in treating chronic non-atrophic gastritis. Methods The primary and secondary ion fragments of chemical components of Chaihu-Guizhi-Ganjiang decoction were obtained by UHPLC-Q-TOF/MS. Comparing with reference standards and literature information, a comprehensive characterization of the chemical constituents of Chaihu-Guizhi-Ganjiang decoction was conducted. Then, the network pharmacology approach was applied to explore the therapeutic mechanism of Chaihu-Guizhi-Ganjiang decoction in treatment of chronic non-atrophic gastritis based on the components in plasma and verified by immunohistochemical results. Results A total of 24 absorbed components of Chaihu-Guizhi-Ganjiang decoction were characterized, including 11 flavonoid glycosides, 3 fatty acids, 3organic acids, 2 gingerols, 2 flavonoids and, 1 each of fatty aldehydes, triterpenoids and amino acids, which mainly acted on TNF-α, IL-6, STAT3, and PTGS2. It exerted therapeutic effects by modulating signaling pathways, including the IL-17 signaling pathway and the AGE-RAGE signaling pathway, etc. Conclusion This study provided the first exploration of the effective components and therapeutic mechanism of Chaihu-Guizhi-Ganjiang decoction in treatment of chronic non-atrophic gastritis by UHPLC-Q-TOF/MS, which could offer scientific references for its further research.

Fermented traditional Chinese medicine(TCM) has a long history of medicinal use, such as Sojae Semen Praeparatum, Arisaema Cum Bile, Pinelliae Rhizoma Fermentata, red yeast rice, and Jianqu. Fermentation technology was recorded in the earliest TCM work, Shen Nong's Classic of the Materia Medica. Microorganisms are essential components of the fermentation process. However, the contamination of fermented TCM by toxigenic fungi and mycotoxins due to unstandardized fermentation processes seriously affects the quality of TCM and poses a threat to the life and health of consumers. In this paper, the characteristics, microbial composition, and mycotoxin profile of fermented TCM are systematically summarized to provide a theoretical basis for its quality and safety control.
Fermentation ; Mycotoxins/analysis* ; Drugs, Chinese Herbal/analysis* ; Fungi/classification* ; Bacteria/genetics* ; Drug Contamination ; Medicine, Chinese Traditional

To investigate the effects and mechanisms of Yougui Pills(YGP) on oxidative damage induced by hydrogen peroxide(H_2O_2) in human ovarian granulosa cells(KGN). The components in serum with low-and high-doses of YGP were analyzed and compared through ultra-high performance liquid chromatography-quadrupole electrostatic field orbitrap mass spectrometry(UHPLC-QEMS), and selected the serum containing YGP high-dose group to follow-up experiments. To stimulated KGN with 200 μmol·L~(-1) H_2O_2to establish an oxidative damage model, which was divided into normal group, model group, low-, medium-, and high-dose of YGP groups, and the efficacy was further verified on the basis of silencing or overexpressing serine protease inhibitor(Serpina3k), further validating the efficacy based on the silencing or overexpression of Serpina3k. TUNEL staining was used to detect cell apoptosis,enzyme-linked immunosorbent assay(ELISA) was employed to measure the secretion levels of estradiol(E_2) and 17β-E_2 in KGN, and Western blot was utilized to assess the expression of Serpina3k and proteins related to the Keap1/Nrf2 signaling pathway. The results show that compared to the model group, each dose group of YGP not only significantly reduces granulocyte apoptosis and upregulates the secretion levels of E_2 and 17β-E_2, but also significantly upregulates Serpina3k and Nrf2 pathway. Further research has found that overexpression of Serpina3k not only enhances the therapeutic effect of YGP but also increases the expression of Nrf2 and inhibits the expression of Keap1. Conversely, interfering with Serpina3k partially reverses the therapeutic effect of YGP, while also partially. The results indicate that the mechanism by which YGP improves oxidative stress in KGN may be related to its upregulation of Serpina3k expression, which affects the conduction of the Keap1/Nrf2 signaling pathway. This study reveals the mechanism by which YGP protects granular cells, providing a certain theoretical basis for its clinical application.
NF-E2-Related Factor 2/genetics* ; Kelch-Like ECH-Associated Protein 1/genetics* ; Humans ; Female ; Signal Transduction/drug effects* ; Oxidative Stress/drug effects* ; Granulosa Cells/cytology* ; Drugs, Chinese Herbal/pharmacology* ; Apoptosis/drug effects* ; Serpins/genetics*

The chemical constituents of Commiphora myrrha was investigated by column chromatography on silica gel, ODS, Sephadex LH-20, and semi-preparative HPLC. Their structures were elucidated by comprehensive spectroscopic methods including UV, IR, MS, NMR, as well as ECD calculation. Seven compounds were isolated from the dichloromethane-soluble fraction of C. myrrha and their structures were identified as(1S,2R,4S,5R,8S)-guaiane-2-hydroxy-7(11),10(15)-dien-6-oxo-12,8-olide(1), commipholide E(2), myrrhterpenoid H(3), myrrhterpenoid I(4), myrrhterpenoid E(5), 2α-methoxy-8α-hydroxy-6-oxogermacra-1(10),7(11)-dien-8,12-olide(6), 8,12-epoxy-1α,9α-hydroxy-eudesma-7,11-diene-6-dione(7). Compound 1 was a new compound and named myrrhterpenoid P. Compound 7 was isolated from Commiphora genus for the first time. Compounds 2, 5, and 6 significantly inhibited nitric oxide(NO) production in LPS-stimulated RAW264.7 cells, with IC_(50) values of(49.67±4.16),(40.80±1.27),(47.22±0.87) μmol·L~(-1), respectively [indomethacin as the positive control, with IC_(50) value of(63.92±2.60) μmol·L~(-1)].
Commiphora/chemistry* ; Animals ; Mice ; Resins, Plant/chemistry* ; Sesquiterpenes/isolation & purification* ; Molecular Structure ; Nitric Oxide ; Macrophages/metabolism* ; RAW 264.7 Cells ; Drugs, Chinese Herbal/pharmacology*