AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.

With the accelerating trend of population aging, the number of elderly patients with lung cancer continues to rise, and the disease burden is becoming increasingly heavy. The clinical management of these patients faces severe challenges due to their decreased physiological reserve, complex comorbidities, and significant individual heterogeneity. Consequently, under traditional diagnosis and treatment models, doctors often struggle to identify the individualized risks of elderly patients in a timely and comprehensive manner, which can easily lead to decision biases such as undertreatment or overtreatment. In view of this, this study advocates for the establishment of an umbrella decision-making model specifically tailored for elderly lung cancer patients. Grounded in a multidisciplinary team (MDT) platform, this model deeply integrates oncological indicators with the comprehensive geriatric assessment (CGA) system. By holistically considering multidimensional variables including tumor burden, organ function, frailty index, cognitive status, and social support, the model establishes an operational mechanism characterized by "single entry, precise stratification, and targeted selection". Accordingly, patients can be scientifically triaged into distinct intervention tiers, such as active surveillance, minimally invasive surgery, drug therapy, radiotherapy, and best supportive care, thereby achieving real-time alignment between treatment intensity and patient fitness. This article elaborates on the construction logic and key operational procedures of this novel decision-making framework, aiming to guide clinical practice beyond the limitations of a tumor-centric perspective toward a holistic, dynamic, whole-course management strategy. This transition seeks to ensure optimal quality of life and clinical net benefit for elderly patients alongside survival prolongation.

ObjectiveTo construct a prediction model for high responsiveness to short-term aerobic training in patients with Parkinson's disease (PD) based on dual-task gait assessment, and to provide evidence for identifying individuals who are most likely to benefit from such interventions. MethodsA total of 42 patients with PD who visited the outpatient clinic of Tianjin Huanhu Hospital between August 29, 2023 and December 19, 2024 were enrolled. All participants completed a 4-week home-based aerobic cycling training program and underwent dual-task gait assessments pre- and post-training. Patients were classified into high-response group (n = 12) and low-response group (n = 30) according to whether the improvement in gait speed reached the minimal clinically important difference of 0.1 m/s. The clinical validity of this grouping was verified by comparing differences in cardiopulmonary exercise testing parameters and dual-task gait indicators between the two groups pre- and post-training. Based on baseline characteristics, Firth's penalized maximum likelihood logistic regression was applied to construct a predictive model for high responsiveness, and the discriminative performance of the model was assessed preliminarily. ResultsThe high-response group showed significantly greater improvement in gait speed, step length, cadence and the anaerobic threshold to maximal oxygen uptake ratio after training compared with the low-response group (P < 0.05), confirming the clinical validity of the grouping. The baseline anaerobic threshold to maximal oxygen uptake ratio (OR = 3.348), body mass index (OR = 2.229) and age (OR = 0.428) demonstrated certain discriminative ability in the present sample. The area under the receiver operating characteristic curve was 0.831, with an overall prediction accuracy of 81.0%, specificity of 83.3% and sensitivity of 75.0%. Robustness of the model was confirmed via internal validation using the Bootstrap method, which suggested that the results were informative, but further validation was still required. ConclusionThe anaerobic threshold/maximal oxygen uptake ratio, body mass index and age may predict the response to short-term aerobic training in patients with PD.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Objective To examine the changing prevalence and antimicrobial resistance profiles of Burkholderia cepacia in 52 hospitals across China from 2015 to 2021.Methods A total of 9 261 strains of B.cepacia were collected from 52 hospitals between January 1,2015 and December 31,2021.Antimicrobial susceptibility of the strains was tested using Kirby-Bauer method or automated antimicrobial susceptibility testing systems according to a unified protocol.The results were interpreted according to the breakpoints released in the Clinical & Laboratory Standards Institute(CLSI)guidelines(2023 edition).Results A total of 9 261 strains of B.cepacia were isolated from all age groups,especially elderly patients.The proportion was 11.1％(1 032 strains)in children,significantly lower than the proportion in adults.About half(46.5％,4 310/9 261)of the strains were isolated from patients at least 60 years old and 42.3％(3 919/9 261)of the strains were isolated from young adults.Most isolates(71.1％)were isolated from sputum and respiratory secretions,followed by urine(10.7％)and blood samples(8.1％).B.cepacia isolates were highly susceptible to the five antimicrobial agents recommended in the CLSI M100 document(33rd edition,2023).B.cepacia isolates showed relatively higher resistance rates to meropenem and levofloxacin.However,the resistance rates to ceftazidime,trimethoprim-sulfamethoxazole,and minocycline remained below 8.1％.The percentage of B.cepacia strains resistant to levofloxacin was the highest compared to other antibiotics in any of the three age groups(from 12.4％in the patients＜18 years old to 20.6％in the patients aged 60 years or older).Conclusions B.cepacia is one of the clinically important non-fermenting gram-negative bacteria.Accurate and timely reporting of antimicrobial susceptibility test results and ongoing antimicrobial resistance surveillance are helpful for rational prescription of antimicrobial agents and proper prevention and control of nosocomial infections.

AIM:The aim of this study was to explore the effects of Yiqi-Yangyin-Quyu prescription(YP)on skeletal muscle injury and related metabolic disorders in mice with Sj?gren syndrome(SS),and to clarify the role of hy-droxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit beta(Hadhb)in mediating the effect of YP on skeletal muscle in SS.METHODS:The SS mice underwent YP treatment for 8 weeks.The morphological changes of the submandibular gland and muscle tissue were examined using hematoxylin-eosin staining.The mitochondrial status in mus-cle tissue was assessed through transmission electron microscopy.Additionally,combined transcriptome and proteome se-quencing was conducted on skeletal muscle samples.The omics sequencing results were validated by RT-qPCR.Immuno-fluorescence was used to confirm the levels of key proteins involved in the P53/peroxisome proliferator-activated receptor gamma(PPARG)signaling pathway.Immunohistochemistry and Western blot were employed to determine the levels of Hadhb key targets.RESULTS:Combined transcriptome and proteome analysis identified 1 523 differentially expressed genes(DEGs)and 182 differentially expressed proteins(DEPs)between the muscle tissue of SS mice(model group)and that of control animals(ICR group),12 of which showed co-differential expression at both transcriptomic and proteomic levels.Compared with model group,1 232 genes and 432 proteins were found to be differentially expressed in the muscle tissue of the mice in YP group.Among these,23 exhibited co-differential expression at both mRNA and protein levels.Gene Ontology(GO)analysis showed that the DEGs and DEPs between ICR and model groups were mainly involved in ener-gy metabolism and fatty acid oxidation,while the DEGs and DEPs between YP and model groups were primarily associated with sarcomere tissue and actin structure.Kyoto Encyclopedia of Genes and Genomes(KEGG)enrichment analysis indi-cated that the DEGs and DEPs between ICR and model groups and between model and YP groups were enriched in the com-plement and coagulation cascade and lipid and pyruvate metabolism.The RT-qPCR validation results were consistent with those of the transcriptome analysis.Furthermore,the protein expression of the tumor suppressor P53 was significantly de-creased in YP group compared with model group,whereas that of PPARG was significantly increased.Western blot analy-sis showed that compared with ICR group,Hadhb protein expression was significantly decreased in model group,whereas the opposite trend was detected in YP group.CONCLUSION:The SS-related skeletal muscle damage is closely related to amino acid metabolism disorder and fatty acid degradation.Treatment with YP modulates innate immune defenses,lipid metabolism and energy metabolism in SS,and Hadhb is the key target of YP in SS-related skeletal muscle.

Objective:To explore the mediating role of coping style and fear of disease progression between health literacy and self-management in postoperative chemotherapy patients with colorectal cancer. It provided a theoretical basis for improving the self-management ability of postoperative chemotherapy patients with colorectal cancer.Methods:Convenience sampling method was used to select postoperative chemotherapy patients with colorectal cancer admitted to the Second Affiliated Hospital of Anhui Medical University from October 2023 to May 2024, and a cross-sectional survey was conducted using Health Literacy Management Scale, Medical Coping Modes Scale, Fear of Progression Questionnaire-Short Form, and Cancer Patient Self-Management Assessment Scale.Results:A total of 229 questionnaires were distributed, of which 220 were returned as valid questionnaires, including 142 males and 78 females, aged (60.05 ± 10.14) years. The total health literacy score was (85.30 ± 9.45) points and self-management score was (150.36 ± 14.10) points among patients undergoing postoperative chemotherapy for colorectal cancer. Self-management was positively correlated with health literacy and facing ( r=0.576, 0.525, both P<0.01), while negatively correlated with avoidance, yielding, and fear of disease progression ( r=-0.660, -0.616, -0.566, all P<0.01). The mediation model showed that facing coping style and fear of disease progression had a chained mediation effect of 0.050 between health literacy and self-management, accounting for 8.36% of the total effect. Conclusions:Self-management in patients with postoperative chemotherapy for colorectal cancer was moderately low. The chain mediating role of coping style and fear of disease progression between health literacy and self-management in postoperative chemotherapy patients with colorectal cancer was established. Nursing staff should strengthen health education for postoperative chemotherapy patients with colorectal cancer, guide patients to face the disease positively, reduce fear, and promote patient self-management.

The left maxilla of a patient was resected because of tumor,and the defect was reconstruted with fibular transplantation.The autonomous dental implant robot technology was used to achieve precise implantation of multiple implants and immediate denture restoration within the limited left maxilla.The surgery was minimally invasive and efficient,and significantly reducing patient post-operative discomfort.The final restoration was completed 6 months after surgery.

Objective To investigate the distribution and antimicrobial resistance profiles of common pathogens isolated from cerebrospinal fluid(CSF)in CHINET program from 2015 to 2021.Methods The bacterial strains isolated from CSF were identified in accordance with clinical microbiology practice standards.Antimicrobial susceptibility test was conducted using Kirby-Bauer method and automated systems per the unified CHINET protocol.Results A total of 14 014 bacterial strains were isolated from CSF samples from 2015 to 2021,including the strains isolated from inpatients(95.3％)and from outpatient and emergency care patients(4.7％).Overall,19.6％of the isolates were from children and 80.4％were from adults.Gram-positive and Gram-negative bacteria accounted for 68.0％and 32.0％,respectively.Coagulase negative Staphylococcus accounted for 73.0％of the total Gram-positive bacterial isolates.The prevalence of MRSA was 38.2％in children and 45.6％in adults.The prevalence of MRCNS was 67.6％in adults and 69.5％in children.A small number of vancomycin-resistant Enterococcus faecium(2.2％)and linezolid-resistant Enterococcus faecalis(3.1％)were isolated from adult patients.The resistance rates of Escherichia coli and Klebsiella pneumoniae to ceftriaxone were 52.2％and 76.4％in children,70.5％and 63.5％in adults.The prevalence of carbapenem-resistant E.coli and K.pneumoniae(CRKP)was 1.3％and 47.7％in children,6.4％and 47.9％in adults.The prevalence of carbapenem-resistant Acinetobacter baumannii(CRAB)and Pseudomonas aeruginosa(CRPA)was 74.0％and 37.1％in children,81.7％and 39.9％in adults.Conclusions The data derived from antimicrobial resistance surveillance are crucial for clinicians to make evidence-based decisions regarding antibiotic therapy.Attention should be paid to the Gram-negative bacteria,especially CRKP and CRAB in central nervous system(CNS)infections.Ongoing antimicrobial resistance surveillance is helpful for optimizing antibiotic use in CNS infections.