1.An assessment model for efficacy of autologous CD19 chimeric antigen receptor T-cell therapy and relapse or refractory diffuse large B-cell lymphoma risk.
Bin XUE ; Yifan LIU ; Min ZHANG ; Gangfeng XIAO ; Xiu LUO ; Lili ZHOU ; Shiguang YE ; Yan LU ; Wenbin QIAN ; Li WANG ; Ping LI ; Aibin LIANG
Chinese Medical Journal 2025;138(1):108-110
2.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
3.Dimethyl fumarate modulates M1/M2 macrophage polarization to ameliorate periodontal destruction by increasing TUFM-mediated mitophagy.
Liang CHEN ; Pengxiao HU ; Xinhua HONG ; Bin LI ; Yifan PING ; ShuoMin CHEN ; Tianle JIANG ; Haofu JIANG ; Yixin MAO ; Yang CHEN ; Zhongchen SONG ; Zhou YE ; Xiaoyu SUN ; Shufan ZHAO ; Shengbin HUANG
International Journal of Oral Science 2025;17(1):32-32
Periodontitis is a common oral disease characterized by progressive alveolar bone resorption and inflammation of the periodontal tissues. Dimethyl fumarate (DMF) has been used in the treatment of various immune-inflammatory diseases due to its excellent anti-inflammatory and antioxidant functions. Here, we investigated for the first time the therapeutic effect of DMF on periodontitis. In vivo studies showed that DMF significantly inhibited periodontal destruction, enhanced mitophagy, and decreased the M1/M2 macrophage ratio. In vitro studies showed that DMF inhibited macrophage polarization toward M1 macrophages and promoted polarization toward M2 macrophages, with improved mitochondrial function, inhibited oxidative stress, and increased mitophagy in RAW 264.7 cells. Furthermore, DMF increased intracellular mitochondrial Tu translation elongation factor (TUFM) levels to maintain mitochondrial homeostasis, promoted mitophagy, and modulated macrophage polarization, whereas TUFM knockdown decreased the protective effect of DMF. Finally, mechanistic studies showed that DMF increased intracellular TUFM levels by protecting TUFM from degradation via the ubiquitin-proteasomal degradation pathway. Our results demonstrate for the first time that DMF protects mitochondrial function and inhibits oxidative stress through TUFM-mediated mitophagy in macrophages, resulting in a shift in the balance of macrophage polarization, thereby attenuating periodontitis. Importantly, this study provides new insights into the prevention of periodontitis.
Dimethyl Fumarate/pharmacology*
;
Mitophagy/drug effects*
;
Animals
;
Mice
;
Macrophages/metabolism*
;
Periodontitis/prevention & control*
;
RAW 264.7 Cells
;
Oxidative Stress/drug effects*
;
Peptide Elongation Factor Tu/metabolism*
;
Mice, Inbred C57BL
;
Male
;
Mitochondria/drug effects*
4.Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey.
Xiao-Chao LUO ; Jia-Li LIU ; Ming-Hong YAO ; Ye-Meng CHEN ; Arthur Yin FAN ; Fan-Rong LIANG ; Ji-Ping ZHAO ; Ling ZHAO ; Xu ZHOU ; Xiao-Ying ZHONG ; Jia-Hui YANG ; Bo LI ; Ying ZHANG ; Xin SUN ; Ling LI
Journal of Integrative Medicine 2025;23(6):630-640
BACKGROUND:
The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment.
OBJECTIVE:
This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects.
SEARCH STRATEGY:
PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022.
INCLUSION CRITERIA:
RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment.
DATA EXTRACTION AND ANALYSIS:
The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES.
RESULTS:
This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs.
CONCLUSION
The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods*
;
Humans
;
Randomized Controlled Trials as Topic
;
Placebo Effect
;
Placebos
;
Treatment Outcome
5.Risk factors and mortality for carbapenem-resistant Acinetobacter baumannii bloodstream infection in elderly patients:a 10-year retrospective study
Ye XUE ; Chao-Shi ZOU ; Tai-Jie LI ; Mei-Xiang QIN ; Chan LIANG ; Kang-Hai LIU ; Dan-Ping QIU
Chinese Journal of Infection Control 2024;23(2):155-161
Objective To assess the risk factors for carbapenem-resistant Acinetobacter baumannii(CRAB)bloodstream infection(BSI)and 28-day short-term mortality in elderly patients,and provide reference for the pre-vention and treatment of CRAB BSI.Methods Clinical data of patients aged ≥60 years and diagnosed with AB BSI in a hospital in Yulin City from January 2013 to December 2022 were retrospectively analyzed,including demogra-phic and microbiological characteristics,as well as clinical outcomes of the patients.Variables which were significant in univariate analysis were selected for multivariate analysis using binary logistic regression model and Cox propor-tional hazards model.Independent risk factors for infection were further determined,and survival analysis was per-formed using Kaplan-Meier curve.Results A total of 150 patients were included in the study,out of which 16 pa-tients(10.7%)had CRAB BSI and 134 had carbapenem-sensitive AB(CSAB)BSI.The 28-day short-term mortali-ty of AB BSI in elderly patients was 15.3%(23/150,95%CI:9.6%-21.1%),and the short-term mortality of CRAB BSI was higher than that of CSAB([56.3%,9/16]vs[10.4%,14/134]).Deep venous catheterization(OR:15.598,95%CI:1.831-132.910)and combined infections of other sites(OR:15.449,95%CI:1.497-159.489)were related to CRAB BSI in elderly patients.The independent risk factors for 28-day mortality in elderly patients with AB BSI were hemodialysis(OR:11.856,95%CI:2.924-48.076),intensive care unit admission(OR:9.387,95%CI:1.941-45.385),and pulmonary infection being suspected source of bacteremia(OR:7.019,95%CI:1.345-36.635).Conclusion The occurrence of CRAB BSI in elderly patients is related to the combined infection of other sites and deep vein catheterization.Hemodialysis,admission to ICU,and pulmonary infection being suspected source of bacteremia are independent risk factors for the prognosis of AB BSI in elderly patients.
6.Comparative study of indigo carmine staining and white light endoscopy in detection rate of right hemicolonic polyp
Ping LIANG ; Yi YANG ; Chuan LIANG ; Weizhen ZHOU ; Ye YANG ; Hai MOU ; Sijing HAN
Chongqing Medicine 2024;53(8):1209-1213
Objective To compare the detection rate of right hemicolonic polyp between indigo carmine staining and white light endoscopy.Methods A total of 1052 patients with colonoscopic examination in Qing-baijiang District People's Hospital of Chengdu City from July 2022 to March 2023 were selected as the study subjects and divided into the indigo carmine staining group and white light endoscopy group,526 cases in each group.The right hemicolon was observed by indigo carmine staining and white light pattern respectively.The difference in the detection rate of right hemicolonic polyp was compared between the two detection methods. Results Compared with the white light endoscopic examination group,the detection rate of the right hemico-lonic polyp (41.6%),detection rate of the right hemicolon adenoma (20.9%),detection rate of wide basal ser-rated lesion (2.1%),detection rate of proliferative polyps (20.3%),detection rate of Paris type 0-Ⅱ (38.0%),detection rate of NICE 1 type (pale lesion,22.2%),detection rate of polyps with a diameter<5 mm (30.5%) and the consistency rate of pathological biopsy (86.4%),specificity (84.7%) and sensitivity (88.2%) in the indigo carmine staining group were higher,and the differences were statistically significant (P<0.05).There was no statistical difference in the duration of mirror withdrawal between the white light endoscopy group and the indigo carmine staining group (t=1.407,P=0.160).Conclusion The endoscopic examination with indigo carmine staining has a higher detection rate for right hemicolonic polyp,and is easier to detect micropolyps and flat polyps with pale color.
7.Clinical Efficacy of Guiyuan Shujin Mixture in the Treatment of Lumbar Disc Herniation and Its Effect on Serum Nuclear Factor κB p65 Expression Level
Shu-Hui LIN ; Pian LI ; Ye RUAN ; Jin-Zhu LIANG ; Zi-Ming CAI ; He TIAN ; Wen-Ping LIN
Journal of Guangzhou University of Traditional Chinese Medicine 2024;41(7):1772-1778
Objective To investigate the clinical efficacy of Guiyuan Shujin Mixture in the treatment of patients with lumbar disc herniation(LDH)and to explore its possible therapeutic mechanism.Methods Sixty-eight patients with LDH of qi stagnation and blood stasis syndrome were randomly divided into trial group and control group,with 34 cases in each group.The control group was treated with Celecoxib Tablets and Mecobalamin Tablets orally,and the trial group was treated with Guiyuan Shujin Mixture on the basis of treatment for the control group.The course of treatment lasted for 4 weeks.Before and after treatment,the two groups were observed in the changes of the Visual Analogue Scale(VAS)score of low back pain and lower limb pain,Oswestry Disability Index(ODI)score,modified Japanese Orthopedic Association(JOA)score,serum levels of inflammatory factors of tumor necrosis factor α(TNF-α),interleukin 6(IL-6)and interleukin 1β(IL-1β),and serum nuclear factor-κB p65(NF-κB p65)level.After treatment,the clinical efficacy and safety of the two groups were evaluated.Results(1)During the trial,one case fell off in the trial group and 3 cases fell off in the control group.Eventually,33 cases in the trial group and 31 cases in the control group were included for the efficacy statistics.(2)After 4 weeks of treatment,the total effective rate of the trial group was 96.97%(32/33),and that of the control group was 87.10%(27/31).The intergroup comparison(tested by rank sum test)showed that the curative effect of the trial group was significantly superior to that of the control group(P<0.05).(3)After treatment,the VAS score and ODI score of low back pain and lower limb pain in the two groups were lower than those before treatment(P<0.05 or P<0.01),and the modified JOA score was higher than that before treatment(P<0.01).The decrease of VAS score and ODI score of low back pain and lower limb pain and the increase of modified JOA score in the trial group were significantly superior to those in the control group(P<0.05 or P<0.01).(4)After treatment,the serum levels of inflammation-related indicators of TNF-α,IL-6,IL-1β and NF-κB p65 in the two groups were lower than those before treatment(P<0.01),and the decrease in the trial group was significantly superior to that in the control group(P<0.01).(5)During the treatment,the incidence of adverse events in the trial group was 2.94%(1/34)and that in the control group was 8.82%(3/34),and the difference between the two groups was not significant(P>0.05).Conclusion Guiyuan Shujin Mixture exerts certain effect in the treatment of LDH patients with qi stagnation and blood stasis syndrome.It can effectively relieve the pain symptoms of patients,improve the lumbar function of patients,and reduce the expression levels of serum inflammatory factors and NF-κB p65.The mechanism may be related with the decrease of the level of inflammatory factors and with the inhibition of the activation of NF-κB signaling pathway.
8.Co-infection of Chlamydia pneumoniae and SARS-CoV-2 and its effect on the secretion of inflammatory cytokines
Jia-Yan LI ; Li-Ping YUAN ; Qing-Kai LUO ; Ye-Fei LEI ; Yuan LI ; Feng-Hua ZHANG ; Li-Xiu PENG ; Yu-Qi OUYANG ; Shi-Xing TANG ; Hong-Liang CHEN
Chinese Journal of Infection Control 2024;23(11):1391-1397
Objective To explore characteristics of co-infection of Chlamydia pneumoniae(Cpn)and severe acute respiratory syndrome coronavirus 2(SARS-CoV-2),and identify their effect on SARS-CoV-2-induced inflammatory response.Methods Patients with coronavirus disease 2019(COVID-19)who received treatment in a hospital in Chenzhou City from December 20,2022 to February 20,2023 were selected.According to the severity of COVID-19,severe and critical cases were classified as the severe symptom group,while mild and moderate cases were classified as the mild symptom group.Meanwhile,according to the age of patients(≥18 years old as adults,<18 years old as juveniles),they were divided into the adult severe symptom group,adult mild symptom group,juvenile severe symptom group,and juvenile mild symptom group.Propensity score was adopted to match age,gender,and under-lying diseases of patients in severe symptom and mild symptom group in a 1∶1 ratio.Bronchoalveolar lavage fluid(BALF),throat swabs,and serum specimens of patients were collected.Cpn IgG/IgM antibody was detected by enzyme-linked immunosorbent assay(ELISA),levels of 12 common cytokines(including interleukin-8[IL-8])in BALF were detected by flow cytometry,differences among groups were compared.Results A total of 102 patients were included,with 61 severe and critical(severe symptom)patients,as well as 41 mild and moderate(mild symp-tom)patients.There were 71 patients aged ≥18 years and 31 juvenile patients aged<18 years.There were 39 pa-tients in the adult severe symptom group and 32 in the adult mild symptom group,and 30 pairs were successfully matched through propensity score analysis.There were 22 patients in the juvenile severe symptom group and 9 in the juvenile mild symptom group,and 8 pairs were successfully matched through propensity score analysis.Among COVID-19 patients,the positive rates of Cpn IgG and IgM were 36.27%(n=37)and 8.82%(n=9),respective-ly,with 1 case positive for both Cpn IgG and IgM.The level of interferon(IFN)-α in serum specimens from adult patients with severe symptom combined with positive Cpn IgG was higher than that of IgG negative patients(P=0.037).There was no statistically significant difference in the levels of other cytokines in BALF and serum speci-mens between the two groups of patients(all P>0.05).The levels of IL-8 and IL-17 in serum specimens of patients with positive Cpn IgG in the adult mild symptom group were both higher than those in Cpn IgG negative patients(both P<0.05).The levels of IL-8 in both BALF and serum specimens from Cpn IgM positivity patients in the ju-venile mild symptom group were higher than those from patients with negative Cpn IgM(both P<0.05).Logistic regression analysis results showed that Cpn IgG and IgM positivity were not risk factors for the development of se-vere COVID-19.Conclusion Combined Cpn infection is not a risk factor for the development of severe symptom in COVID-19 patients,and Cpn infection has limited impact on the secretion of inflammatory factors caused by SARS-CoV-2.
9.Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients (version 2024)
Yao LU ; Yang LI ; Leiying ZHANG ; Hao TANG ; Huidan JING ; Yaoli WANG ; Xiangzhi JIA ; Li BA ; Maohong BIAN ; Dan CAI ; Hui CAI ; Xiaohong CAI ; Zhanshan ZHA ; Bingyu CHEN ; Daqing CHEN ; Feng CHEN ; Guoan CHEN ; Haiming CHEN ; Jing CHEN ; Min CHEN ; Qing CHEN ; Shu CHEN ; Xi CHEN ; Jinfeng CHENG ; Xiaoling CHU ; Hongwang CUI ; Xin CUI ; Zhen DA ; Ying DAI ; Surong DENG ; Weiqun DONG ; Weimin FAN ; Ke FENG ; Danhui FU ; Yongshui FU ; Qi FU ; Xuemei FU ; Jia GAN ; Xinyu GAN ; Wei GAO ; Huaizheng GONG ; Rong GUI ; Geng GUO ; Ning HAN ; Yiwen HAO ; Wubing HE ; Qiang HONG ; Ruiqin HOU ; Wei HOU ; Jie HU ; Peiyang HU ; Xi HU ; Xiaoyu HU ; Guangbin HUANG ; Jie HUANG ; Xiangyan HUANG ; Yuanshuai HUANG ; Shouyong HUN ; Xuebing JIANG ; Ping JIN ; Dong LAI ; Aiping LE ; Hongmei LI ; Bijuan LI ; Cuiying LI ; Daihong LI ; Haihong LI ; He LI ; Hui LI ; Jianping LI ; Ning LI ; Xiying LI ; Xiangmin LI ; Xiaofei LI ; Xiaojuan LI ; Zhiqiang LI ; Zhongjun LI ; Zunyan LI ; Huaqin LIANG ; Xiaohua LIANG ; Dongfa LIAO ; Qun LIAO ; Yan LIAO ; Jiajin LIN ; Chunxia LIU ; Fenghua LIU ; Peixian LIU ; Tiemei LIU ; Xiaoxin LIU ; Zhiwei LIU ; Zhongdi LIU ; Hua LU ; Jianfeng LUAN ; Jianjun LUO ; Qun LUO ; Dingfeng LYU ; Qi LYU ; Xianping LYU ; Aijun MA ; Liqiang MA ; Shuxuan MA ; Xainjun MA ; Xiaogang MA ; Xiaoli MA ; Guoqing MAO ; Shijie MU ; Shaolin NIE ; Shujuan OUYANG ; Xilin OUYANG ; Chunqiu PAN ; Jian PAN ; Xiaohua PAN ; Lei PENG ; Tao PENG ; Baohua QIAN ; Shu QIAO ; Li QIN ; Ying REN ; Zhaoqi REN ; Ruiming RONG ; Changshan SU ; Mingwei SUN ; Wenwu SUN ; Zhenwei SUN ; Haiping TANG ; Xiaofeng TANG ; Changjiu TANG ; Cuihua TAO ; Zhibin TIAN ; Juan WANG ; Baoyan WANG ; Chunyan WANG ; Gefei WANG ; Haiyan WANG ; Hongjie WANG ; Peng WANG ; Pengli WANG ; Qiushi WANG ; Xiaoning WANG ; Xinhua WANG ; Xuefeng WANG ; Yong WANG ; Yongjun WANG ; Yuanjie WANG ; Zhihua WANG ; Shaojun WEI ; Yaming WEI ; Jianbo WEN ; Jun WEN ; Jiang WU ; Jufeng WU ; Aijun XIA ; Fei XIA ; Rong XIA ; Jue XIE ; Yanchao XING ; Yan XIONG ; Feng XU ; Yongzhu XU ; Yongan XU ; Yonghe YAN ; Beizhan YAN ; Jiang YANG ; Jiangcun YANG ; Jun YANG ; Xinwen YANG ; Yongyi YANG ; Chunyan YAO ; Mingliang YE ; Changlin YIN ; Ming YIN ; Wen YIN ; Lianling YU ; Shuhong YU ; Zebo YU ; Yigang YU ; Anyong YU ; Hong YUAN ; Yi YUAN ; Chan ZHANG ; Jinjun ZHANG ; Jun ZHANG ; Kai ZHANG ; Leibing ZHANG ; Quan ZHANG ; Rongjiang ZHANG ; Sanming ZHANG ; Shengji ZHANG ; Shuo ZHANG ; Wei ZHANG ; Weidong ZHANG ; Xi ZHANG ; Xingwen ZHANG ; Guixi ZHANG ; Xiaojun ZHANG ; Guoqing ZHAO ; Jianpeng ZHAO ; Shuming ZHAO ; Beibei ZHENG ; Shangen ZHENG ; Huayou ZHOU ; Jicheng ZHOU ; Lihong ZHOU ; Mou ZHOU ; Xiaoyu ZHOU ; Xuelian ZHOU ; Yuan ZHOU ; Zheng ZHOU ; Zuhuang ZHOU ; Haiyan ZHU ; Peiyuan ZHU ; Changju ZHU ; Lili ZHU ; Zhengguo WANG ; Jianxin JIANG ; Deqing WANG ; Jiongcai LAN ; Quanli WANG ; Yang YU ; Lianyang ZHANG ; Aiqing WEN
Chinese Journal of Trauma 2024;40(10):865-881
Patients with severe trauma require an extremely timely treatment and transfusion plays an irreplaceable role in the emergency treatment of such patients. An increasing number of evidence-based medicinal evidences and clinical practices suggest that patients with severe traumatic bleeding benefit from early transfusion of low-titer group O whole blood or hemostatic resuscitation with red blood cells, plasma and platelet of a balanced ratio. However, the current domestic mode of blood supply cannot fully meet the requirements of timely and effective blood transfusion for emergency treatment of patients with severe trauma in clinical practice. In order to solve the key problems in blood supply and blood transfusion strategies for emergency treatment of severe trauma, Branch of Clinical Transfusion Medicine of Chinese Medical Association, Group for Trauma Emergency Care and Multiple Injuries of Trauma Branch of Chinese Medical Association, Young Scholar Group of Disaster Medicine Branch of Chinese Medical Association organized domestic experts of blood transfusion medicine and trauma treatment to jointly formulate Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients ( version 2024). Based on the evidence-based medical evidence and Delphi method of expert consultation and voting, 10 recommendations were put forward from two aspects of blood support mode and transfusion strategies, aiming to provide a reference for transfusion resuscitation in the emergency treatment of severe trauma and further improve the success rate of treatment of patients with severe trauma.
10.Tislelizumab monotherapy for the treatment of recurrent/metastatic head and neck squamous cell carcinoma.
Pan SONG ; Faya LIANG ; Yuchu YE ; Yongsheng HUANG ; Taowei WU ; Xiaoming HUANG ; Ping HAN
Journal of Clinical Otorhinolaryngology Head and Neck Surgery 2023;37(10):778-785
Objective:The aim of this retrospective study is to evaluate the safety and efficacy of tislelizumab in patients with recurrent/metastatic head and neck squamous cell carcinoma. Methods:Six patients with recurrent/metastatic head and neck squamous cell carcinoma who received tislelizumab monotherapy in our hospital from 2018 to 2020 were retrospectively analyzed. The information of sex, age, TNM stage, efficacy, and adverse reactions were collected. All patients were recruited from the RATIONALE 102 study. The primary end point was the objective response rate, and other end points included progression-free survival and overall survival. We performed tumor immune-related gene sequencing and transcriptome sequencing analysis on the tumor tissues of the patient, and used bioinformatics methods to enrich immune cells and analyze signaling pathways. All analyses were performed using R 4.1. 0 software, SPSS Statistics 24.0 software and GraphPad Prism 8. Results:As of May 31, 2020, the median follow-up time was 26.35 months. The objective response rate with tislelizumab was 50.0%, the median progression-free survival was 6.44 months, and the estimated median survival was 20.07 months. The incidence of grade 3 or higher adverse reactions was 66.7%, including hyponatremia, hypokalemia, hypercalcemia, etc. The expression of macrophage, Treg and neutrophil-related genes are higher in immune-sensitive patients, and the signaling pathways of the intestinal immune network for IgA production, graft versus host disease and autoimmune thyroid disease are significantly activated. Conclusion:Tislelizumab was found to be controllable and tolerable in patients with recurrent/metastatic head and neck squamous cell carcinoma. The response to tislelizumab is related to immune cell infiltration and activation of immune-related signaling pathways.
Humans
;
Squamous Cell Carcinoma of Head and Neck/etiology*
;
Retrospective Studies
;
Carcinoma, Squamous Cell/pathology*
;
Neoplasm Recurrence, Local/pathology*
;
Head and Neck Neoplasms
;
Antineoplastic Combined Chemotherapy Protocols

Result Analysis
Print
Save
E-mail