ObjectiveTo investigate the impact of portal vein tumor thrombus （PVTT） classification on rebleeding in hepatocellular carcinoma （HCC） patients with different PVTT subtypes and esophagogastric variceal bleeding （EGVB）， and to provide a reference for formulating rational treatment regimens for such patients. MethodsA retrospective study was performed for 130 patients with HCC and PVTT who were treated due to EGVB in Beijing Ditan Hospital， Capital Medical University， from July 2020 to January 2025， and according to whether endoscopic treatment was performed， the patients were divided into endoscopic treatment group with 97 patients and conservative treatment group with 33 patients. Demographic and clinical data were collected from all patients， and the two groups were compared in terms of hemostasis success rate and rebleeding rate. The independent-samples t test was used for comparison of normally distributed continuous data between groups， and the Mann-Whitney U test was used for comparison of non-normally distributed continuous data between groups； the chi-square test or the Fisher’s exact test was used for comparison of categorical data between groups. The Kaplan-Meier method was used to estimate the cumulative incidence rate of rebleeding in patients with different subtypes of PVTT. Propensity score matching （PSM） was performed for the endoscopic treatment group and the conservative treatment group to balance the baseline data of the two groups. The Cox proportional hazards model was used to perform univariate and multivariate analyses and identify independent risk factors for rebleeding. ResultsThe endoscopic treatment group had a significantly lower cumulative rebleeding rate within 6 months than the conservative treatment group （35.1% vs 57.6%， hazard ratio ［HR］=0.480， 95% confidence interval ［CI］： 0.272—0.851， P=0.019）. The PVTT Ⅲ—Ⅳ group had a significantly higher cumulative rebleeding rate within 6 months than the PVTT Ⅱ group （52.2% vs 37.5%， HR=1.744， 95%CI： 1.008 — 3.018， P=0.022）. After PSM， there was no significant difference in rebleeding rate between the endoscopic treatment group and the conservative treatment group （38.1% vs 14.3%，HR=1.500，95%CI：0.125 — 2.002， P=0.588）， while the PVTT Ⅲ—Ⅳ group had a significantly higher cumulative rebleeding rate than the PVTT Ⅱ group （58.8% vs 12.5%，HR=1.561，95%CI：1.195 — 12.499，P=0.033）. The multivariate Cox regression analysis showed that PVTT subtype （HR=1.412， 95%CI： 0.998 — 1.997， P=0.049）， platelet count （HR=1.006， 95%CI： 1.001 — 1.010， P=0.021）， C-reactive protein （HR=1.011， 95%CI： 1.001 — 1.021， P=0.026）， and ascites （HR=1.803， 95%CI： 1.059 — 3.068， P=0.030） were independent risk factors for rebleeding. ConclusionFor HCC patients with PVTT and EGVB， endoscopic treatment can successfully achieve hemostasis， while it fails to significantly reduce rebleeding rates. PVTT classification can affect the risk of rebleeding， and patients with PVTT types Ⅲ—Ⅳ have a relatively high rebleeding rate.

OBJECTIVE To clarify the current development status of clinical pharmacist training bases and the pharmacist workforce in China， and to provide evidence for standardizing base construction and promoting the high-quality development of hospital pharmacy. METHODS Questionnaires were distributed to all clinical pharmacist training bases for urgently-needed health professionals and clinical pharmacist training bases under the Chinese Hospital Association that had been approved by the end of 2023 to collect data including base profiles and pharmacist staffing conditions. Expert teams carried out field investigations to verify the collected data. Descriptive statistical analyses were conducted on the quantity， type and regional distribution of training bases， and the influencing factors of pharmacist staffing in the bases were analyzed. RESULTS Field surveys were completed covering 297 training bases across 31 provincial-level administrative regions. Among the base hospitals， 87.88% were Grade A tertiary general hospitals， and 65.32% were located in provincial capitals. The eastern region had the largest number of bases （136， accounting for 45.79%）， followed by the western region （79， 26.60%）. Great disparities existed among provinces in terms of base quantity and hospital scale. The median proportion of pharmaceutical technical personnel in base hospitals was 4.05%， and the median number of clinical pharmacists per 100 hospital beds was 0.53. Both indicators reached the highest in the eastern region （0.57， 4.43%） and the lowest in the northeastern region （0.45， 3.01%）. A total of 3 627 full-time clinical pharmacists were employed in all surveyed bases， among whom 83.68% held clinical pharmacist training certificates， 35.43% possessed senior professional titles， and 78.19% had postgraduate or higher educational background. The total annual training capacity of the surveyed bases was 4 291 trainees， with obvious differences in annual training capacity across regions and provinces. Training specialties covered 19 specialized disciplines plus one general discipline， and no province could deliver training for all 20 specialties simultaneously. Multivariate Logistic regression analysis showed that geographic region exerte d a significant impact on the proportion of pharmaceutical technical personnel （≥4%） （ P ＜0.05）， while the approval time of training bases and hospital scale had significant effects on the number of clinical pharmacists per 100 beds （≥0.6） （ P ＜0.05）. CONCLUSIONS China’s clinical pharmacist training system has basically matured and taken initial shape. The distribution of clinical pharmacist training resources is generally consistent with regional population and economic development levels. However， the allocation of pharmaceutical staff and clinical pharmacists has not yet met national standards and clinical service demands.

OBJECTIVE To clarify the current development status of clinical pharmacist training bases and the pharmacist workforce in China， and to provide evidence for standardizing base construction and promoting the high-quality development of hospital pharmacy. METHODS Questionnaires were distributed to all clinical pharmacist training bases for urgently-needed health professionals and clinical pharmacist training bases under the Chinese Hospital Association that had been approved by the end of 2023 to collect data including base profiles and pharmacist staffing conditions. Expert teams carried out field investigations to verify the collected data. Descriptive statistical analyses were conducted on the quantity， type and regional distribution of training bases， and the influencing factors of pharmacist staffing in the bases were analyzed. RESULTS Field surveys were completed covering 297 training bases across 31 provincial-level administrative regions. Among the base hospitals， 87.88% were Grade A tertiary general hospitals， and 65.32% were located in provincial capitals. The eastern region had the largest number of bases （136， accounting for 45.79%）， followed by the western region （79， 26.60%）. Great disparities existed among provinces in terms of base quantity and hospital scale. The median proportion of pharmaceutical technical personnel in base hospitals was 4.05%， and the median number of clinical pharmacists per 100 hospital beds was 0.53. Both indicators reached the highest in the eastern region （0.57， 4.43%） and the lowest in the northeastern region （0.45， 3.01%）. A total of 3 627 full-time clinical pharmacists were employed in all surveyed bases， among whom 83.68% held clinical pharmacist training certificates， 35.43% possessed senior professional titles， and 78.19% had postgraduate or higher educational background. The total annual training capacity of the surveyed bases was 4 291 trainees， with obvious differences in annual training capacity across regions and provinces. Training specialties covered 19 specialized disciplines plus one general discipline， and no province could deliver training for all 20 specialties simultaneously. Multivariate Logistic regression analysis showed that geographic region exerte d a significant impact on the proportion of pharmaceutical technical personnel （≥4%） （ P ＜0.05）， while the approval time of training bases and hospital scale had significant effects on the number of clinical pharmacists per 100 beds （≥0.6） （ P ＜0.05）. CONCLUSIONS China’s clinical pharmacist training system has basically matured and taken initial shape. The distribution of clinical pharmacist training resources is generally consistent with regional population and economic development levels. However， the allocation of pharmaceutical staff and clinical pharmacists has not yet met national standards and clinical service demands.

OBJECTIVE To investigate the current status of quality management in clinical pharmacist training bases in China， and to provide references for the standardized development and improvement of these bases. METHODS A combined approach of questionnaire survey and on-site investigation was adopted， targeting the healthcare highly sought-after talent （clinical pharmacist） training bases in 31 provinces of China as well as the clinical pharmacist training bases affiliated with the Chinese Hospital Association. A training quality management evaluation index system consisting of 25 tertiary indicators was established. Investigations were conducted from two dimensions： structural quality of training and quality management of training processes. Data were statistically analyzed using descriptive statistical methods. RESULTS On-site investigations were completed for 297 clinical pharmacist training bases across the 31 provinces， among which 284 were affiliated with the Chinese Hospital Association and 271 were healthcare highly sought-after talent （clinical pharmacist） training bases. In terms of structural quality， the core indicator compliance rate for hospital-level training systems exceeded 80%， the rate of special fund utilization for designated purposes reached 80.13%， and the overall compliance rate for software and hardware facilities surpassed 88%. A total of 1 348 preceptors were employed across the training bases， among whom those with senior professional titles and full-time specialist clinical pharmacists as lead preceptors accounted for 62.91% and 94.36%， respectively. Regarding process quality， the compliance rate for “establishment of clinical practice teaching groups in accordance with regulations during clinical department rotations” was 85.19%， and 79.80% and 76.09% of the bases were found to implement strict confidentiality in theoretical examinations and meet the required scale of assessment cases， respectively. However， formal documents of corresponding training management regulations were formulated in only 57.91% of the bases， and the completeness and standardization rate of training manual completion was merely 47.47%. In addition， considerable disparities in quality management levels were observed among provinces， with issues in training process quality being particularly prominent. CONCLUSIONS The management system， hardware facilities， and preceptor staffing of clinical pharmacist training bases in China are relatively well-established， yet notable variations in quality management exist among training bases across different provinces.

Objective To develop the application technology of finger length ratios in the selection of Muay Thai athletes,and to provide practical guidance for improving the competitive level of Muay Thai.Methods By using the method of snowball sampling and simple random sampling,413 subjects were selected in Bangkok,Thailand,including 84 male Muay Thai professional players,62 female Muay Thai professional players,137 ordinary male college students and 130 female college students.The finger length of the subjects was measured and their finger length ratios was calculated.SPSS 20.0 statistical software was used for discriminant analysis.Results The 2D∶3D,2D∶4D,2D∶5D,3D∶4D and 3D∶5D of male Muay Thai professional players were significantly lower than that in the general male Thai population,and the 2D∶4D,3D∶4D and 3D∶5D of female Muay Thai players were significantly lower than that in the general female Thai population,and the above differences were statistically significant(P＜0.05).Discriminant functions developed using both the full model and stepwise method were statistically significant,demonstrating high accuracy and stability.The correct discrimination rates were higher in the male population than that in the female population.When distinguishing between Muay Thai professional fighters and the general Thai population,the optimal 2D∶4D threshold for males is 0.951,and for females,it was 0.960.Conclusion The discriminant model of Muay Thai professional players and ordinary people based on the ratios of finger length can provide important reference for the selection of Muay Thai athletes.

Objective To explore the feasibility and safety of ultrasound-guided percutaneous microwave ablation for unresectable pancreatic cancer.Methods Totally 84 patients who underwent ultrasound-guided percutaneous microwave ablation for unresectable pancreatic cancer were enrolled,and the technical success rate,complete ablation rate,complication rate,pain relief rate and survival time,etc.were observed.Results The median age of 84 cases was 61.5 years.Totally 86 tumors,including 44.19％(38/86)at the head/neck and 55.81％(48/86)at the body/tail of pancreas were detected,and a total of 85 ablation sessions were performed with the median ablation energy applied per tumor of 9.90(1.08,21.60)kJ and the complete ablation rate of 42.86％(36/84).The technical success rate was 100％(85/85).Thirty-nine complication events occurred in 25 cases,no ablation-related death.Among 34 patients underwent ablation mainly for pain symptoms,the pain score decreased from(6.22±1.12)points before treatment to(1.94±1.64)points after treatment(P＜0.001).During 6.8(3.3,12.9)months' follow-up,the mean survival time was(8.5±6.7)months,and all 47 patients died due to tumor progression.Conclusion Ultrasound-guided percutaneous microwave ablation was safe and feasible for unresectable pancreatic cancer.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Aim To explore the mechanism of baicalin combined with heat stimulation in treating acute lym-phoblastic leukemia(ALL)based on network pharma-cology and in vitro experiments.Methods The CCK-8 assay was used to screen the suitable conditions for heat stimulation to interfere ALL cell lines Jurkat,CCRF-CEM,Hut-78 and a normal lymphocyte HMy2.CIR,and the effects of baicalin combined with heat stimulation on the proliferation of three ALL cell lines and a normal lymphocyte were tested.The key targets of baicalin combined with fever stimulation for the treatment of ALL were obtained based on network phar-macological analysis,and the potential mechanisms were predicted by gene ontology(GO)annotation and kyoto encyclopedia of genes and genomes(KEGG)en-richment.The expression levels of TNF-α,AKT1,TYMS and CASP3 mRNA in ALL cell lines Jurkat and CCRF-CEM were examined by RT-qPCR with baicalin alone and baicalin combined with heat stimulation.Results The optimal conditions for heat stimulation to intervene ALL cells were 41 ℃ for 24 h,and heat stimulation combined with baicalin synergistically inhibited the growth of ALL cell lines and effectively reduced the cy-totoxicity of baicalin.Based on the network pharmaco-logical analysis,55 intersecting targets of baicalin with ALL diseases and 77 intersecting targets of baicalin with fever were obtained.The results of GO annotation and KEGG enrichment suggested that baicalin com-bined with fever stimulation to intervene ALL might be associated with influencing intracellular reactive oxygen species metabolism,DNA transcription and apoptotic processes involved in cysteine enzymes.Apoptosis,TNF and IL-17 signaling pathways were the key pathways for baicalin combined with heat stimulation in treating ALL.Under heat stimulation at 41 ℃ using SDHA gene as housekeeping gene,in vitro experiments showed that baicalin significantly up-regulated the expression of TNF-α and CASP3,and down-regulated the expression of TYMS in ALL cells.Conclusions Based on net-work pharmacologic analyses and in vitro experiments,baicalin combined with heat stimulation can regulate TNF-α and CASP3 gene levels in ALL cells and de-stroy cellular structure to promote cell apoptosis,thus synergistically treating ALL.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Paraplegia caused by spinal cord injury is a serious neurological complication, for which surgery is currently the main treatment method. Due to different surgical approaches, patients are usually expected to maintain a passive prone position for a long time or switch between the supine and prone positions. Affected by multiple factors such as neurogenic sensory disorders, pathological changes in muscle tone and operative duration, the risk of intraoperative acquired pressure injury (IAPI) is significantly increased. Current clinical prevention strategies for IAPI in these patients predominantly focus on localized pressure relief during positioning, lacking systematic, standardized comprehensive prevention protocols or evidence-based guidelines. To address it, Department of Nursing, Orthopedics Branch, China International Exchange and Promotive Association for Medical and Health Care, Spinal Trauma Professional Committee, Orthopedics Branch, Chinese Medical Doctor Association, Nursing Group of Spine and Spinal Cord Professional Committee of Chinese Association of Rehabilitation Medicine organized experts in relevant fields to formulate Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury ( version 2025), based on evidence-based medical evidence and latest research results and clinical practice at home and abroad. Eleven recommendations were put forward from the aspects of preoperative risk assessment, intraoperative prevention strategies, postoperative handover and monitoring, and supportive mechanisms for IAPI prevention, aiming to standardize the prevention measures and management strategies of IAPI in paraplegic patients with spinal cord injury and accelerate the recovery of patients and improve the therapeutic effect.