ObjectiveTo investigate the impact of portal vein tumor thrombus （PVTT） classification on rebleeding in hepatocellular carcinoma （HCC） patients with different PVTT subtypes and esophagogastric variceal bleeding （EGVB）， and to provide a reference for formulating rational treatment regimens for such patients. MethodsA retrospective study was performed for 130 patients with HCC and PVTT who were treated due to EGVB in Beijing Ditan Hospital， Capital Medical University， from July 2020 to January 2025， and according to whether endoscopic treatment was performed， the patients were divided into endoscopic treatment group with 97 patients and conservative treatment group with 33 patients. Demographic and clinical data were collected from all patients， and the two groups were compared in terms of hemostasis success rate and rebleeding rate. The independent-samples t test was used for comparison of normally distributed continuous data between groups， and the Mann-Whitney U test was used for comparison of non-normally distributed continuous data between groups； the chi-square test or the Fisher’s exact test was used for comparison of categorical data between groups. The Kaplan-Meier method was used to estimate the cumulative incidence rate of rebleeding in patients with different subtypes of PVTT. Propensity score matching （PSM） was performed for the endoscopic treatment group and the conservative treatment group to balance the baseline data of the two groups. The Cox proportional hazards model was used to perform univariate and multivariate analyses and identify independent risk factors for rebleeding. ResultsThe endoscopic treatment group had a significantly lower cumulative rebleeding rate within 6 months than the conservative treatment group （35.1% vs 57.6%， hazard ratio ［HR］=0.480， 95% confidence interval ［CI］： 0.272—0.851， P=0.019）. The PVTT Ⅲ—Ⅳ group had a significantly higher cumulative rebleeding rate within 6 months than the PVTT Ⅱ group （52.2% vs 37.5%， HR=1.744， 95%CI： 1.008 — 3.018， P=0.022）. After PSM， there was no significant difference in rebleeding rate between the endoscopic treatment group and the conservative treatment group （38.1% vs 14.3%，HR=1.500，95%CI：0.125 — 2.002， P=0.588）， while the PVTT Ⅲ—Ⅳ group had a significantly higher cumulative rebleeding rate than the PVTT Ⅱ group （58.8% vs 12.5%，HR=1.561，95%CI：1.195 — 12.499，P=0.033）. The multivariate Cox regression analysis showed that PVTT subtype （HR=1.412， 95%CI： 0.998 — 1.997， P=0.049）， platelet count （HR=1.006， 95%CI： 1.001 — 1.010， P=0.021）， C-reactive protein （HR=1.011， 95%CI： 1.001 — 1.021， P=0.026）， and ascites （HR=1.803， 95%CI： 1.059 — 3.068， P=0.030） were independent risk factors for rebleeding. ConclusionFor HCC patients with PVTT and EGVB， endoscopic treatment can successfully achieve hemostasis， while it fails to significantly reduce rebleeding rates. PVTT classification can affect the risk of rebleeding， and patients with PVTT types Ⅲ—Ⅳ have a relatively high rebleeding rate.

OBJECTIVE To clarify the current development status of clinical pharmacist training bases and the pharmacist workforce in China， and to provide evidence for standardizing base construction and promoting the high-quality development of hospital pharmacy. METHODS Questionnaires were distributed to all clinical pharmacist training bases for urgently-needed health professionals and clinical pharmacist training bases under the Chinese Hospital Association that had been approved by the end of 2023 to collect data including base profiles and pharmacist staffing conditions. Expert teams carried out field investigations to verify the collected data. Descriptive statistical analyses were conducted on the quantity， type and regional distribution of training bases， and the influencing factors of pharmacist staffing in the bases were analyzed. RESULTS Field surveys were completed covering 297 training bases across 31 provincial-level administrative regions. Among the base hospitals， 87.88% were Grade A tertiary general hospitals， and 65.32% were located in provincial capitals. The eastern region had the largest number of bases （136， accounting for 45.79%）， followed by the western region （79， 26.60%）. Great disparities existed among provinces in terms of base quantity and hospital scale. The median proportion of pharmaceutical technical personnel in base hospitals was 4.05%， and the median number of clinical pharmacists per 100 hospital beds was 0.53. Both indicators reached the highest in the eastern region （0.57， 4.43%） and the lowest in the northeastern region （0.45， 3.01%）. A total of 3 627 full-time clinical pharmacists were employed in all surveyed bases， among whom 83.68% held clinical pharmacist training certificates， 35.43% possessed senior professional titles， and 78.19% had postgraduate or higher educational background. The total annual training capacity of the surveyed bases was 4 291 trainees， with obvious differences in annual training capacity across regions and provinces. Training specialties covered 19 specialized disciplines plus one general discipline， and no province could deliver training for all 20 specialties simultaneously. Multivariate Logistic regression analysis showed that geographic region exerte d a significant impact on the proportion of pharmaceutical technical personnel （≥4%） （ P ＜0.05）， while the approval time of training bases and hospital scale had significant effects on the number of clinical pharmacists per 100 beds （≥0.6） （ P ＜0.05）. CONCLUSIONS China’s clinical pharmacist training system has basically matured and taken initial shape. The distribution of clinical pharmacist training resources is generally consistent with regional population and economic development levels. However， the allocation of pharmaceutical staff and clinical pharmacists has not yet met national standards and clinical service demands.

OBJECTIVE To clarify the current development status of clinical pharmacist training bases and the pharmacist workforce in China， and to provide evidence for standardizing base construction and promoting the high-quality development of hospital pharmacy. METHODS Questionnaires were distributed to all clinical pharmacist training bases for urgently-needed health professionals and clinical pharmacist training bases under the Chinese Hospital Association that had been approved by the end of 2023 to collect data including base profiles and pharmacist staffing conditions. Expert teams carried out field investigations to verify the collected data. Descriptive statistical analyses were conducted on the quantity， type and regional distribution of training bases， and the influencing factors of pharmacist staffing in the bases were analyzed. RESULTS Field surveys were completed covering 297 training bases across 31 provincial-level administrative regions. Among the base hospitals， 87.88% were Grade A tertiary general hospitals， and 65.32% were located in provincial capitals. The eastern region had the largest number of bases （136， accounting for 45.79%）， followed by the western region （79， 26.60%）. Great disparities existed among provinces in terms of base quantity and hospital scale. The median proportion of pharmaceutical technical personnel in base hospitals was 4.05%， and the median number of clinical pharmacists per 100 hospital beds was 0.53. Both indicators reached the highest in the eastern region （0.57， 4.43%） and the lowest in the northeastern region （0.45， 3.01%）. A total of 3 627 full-time clinical pharmacists were employed in all surveyed bases， among whom 83.68% held clinical pharmacist training certificates， 35.43% possessed senior professional titles， and 78.19% had postgraduate or higher educational background. The total annual training capacity of the surveyed bases was 4 291 trainees， with obvious differences in annual training capacity across regions and provinces. Training specialties covered 19 specialized disciplines plus one general discipline， and no province could deliver training for all 20 specialties simultaneously. Multivariate Logistic regression analysis showed that geographic region exerte d a significant impact on the proportion of pharmaceutical technical personnel （≥4%） （ P ＜0.05）， while the approval time of training bases and hospital scale had significant effects on the number of clinical pharmacists per 100 beds （≥0.6） （ P ＜0.05）. CONCLUSIONS China’s clinical pharmacist training system has basically matured and taken initial shape. The distribution of clinical pharmacist training resources is generally consistent with regional population and economic development levels. However， the allocation of pharmaceutical staff and clinical pharmacists has not yet met national standards and clinical service demands.

OBJECTIVE To investigate the current status of quality management in clinical pharmacist training bases in China， and to provide references for the standardized development and improvement of these bases. METHODS A combined approach of questionnaire survey and on-site investigation was adopted， targeting the healthcare highly sought-after talent （clinical pharmacist） training bases in 31 provinces of China as well as the clinical pharmacist training bases affiliated with the Chinese Hospital Association. A training quality management evaluation index system consisting of 25 tertiary indicators was established. Investigations were conducted from two dimensions： structural quality of training and quality management of training processes. Data were statistically analyzed using descriptive statistical methods. RESULTS On-site investigations were completed for 297 clinical pharmacist training bases across the 31 provinces， among which 284 were affiliated with the Chinese Hospital Association and 271 were healthcare highly sought-after talent （clinical pharmacist） training bases. In terms of structural quality， the core indicator compliance rate for hospital-level training systems exceeded 80%， the rate of special fund utilization for designated purposes reached 80.13%， and the overall compliance rate for software and hardware facilities surpassed 88%. A total of 1 348 preceptors were employed across the training bases， among whom those with senior professional titles and full-time specialist clinical pharmacists as lead preceptors accounted for 62.91% and 94.36%， respectively. Regarding process quality， the compliance rate for “establishment of clinical practice teaching groups in accordance with regulations during clinical department rotations” was 85.19%， and 79.80% and 76.09% of the bases were found to implement strict confidentiality in theoretical examinations and meet the required scale of assessment cases， respectively. However， formal documents of corresponding training management regulations were formulated in only 57.91% of the bases， and the completeness and standardization rate of training manual completion was merely 47.47%. In addition， considerable disparities in quality management levels were observed among provinces， with issues in training process quality being particularly prominent. CONCLUSIONS The management system， hardware facilities， and preceptor staffing of clinical pharmacist training bases in China are relatively well-established， yet notable variations in quality management exist among training bases across different provinces.

Periodontitis is a common oral disease characterized by progressive alveolar bone resorption and inflammation of the periodontal tissues. Dimethyl fumarate (DMF) has been used in the treatment of various immune-inflammatory diseases due to its excellent anti-inflammatory and antioxidant functions. Here, we investigated for the first time the therapeutic effect of DMF on periodontitis. In vivo studies showed that DMF significantly inhibited periodontal destruction, enhanced mitophagy, and decreased the M1/M2 macrophage ratio. In vitro studies showed that DMF inhibited macrophage polarization toward M1 macrophages and promoted polarization toward M2 macrophages, with improved mitochondrial function, inhibited oxidative stress, and increased mitophagy in RAW 264.7 cells. Furthermore, DMF increased intracellular mitochondrial Tu translation elongation factor (TUFM) levels to maintain mitochondrial homeostasis, promoted mitophagy, and modulated macrophage polarization, whereas TUFM knockdown decreased the protective effect of DMF. Finally, mechanistic studies showed that DMF increased intracellular TUFM levels by protecting TUFM from degradation via the ubiquitin-proteasomal degradation pathway. Our results demonstrate for the first time that DMF protects mitochondrial function and inhibits oxidative stress through TUFM-mediated mitophagy in macrophages, resulting in a shift in the balance of macrophage polarization, thereby attenuating periodontitis. Importantly, this study provides new insights into the prevention of periodontitis.
Dimethyl Fumarate/pharmacology* ; Mitophagy/drug effects* ; Animals ; Mice ; Macrophages/metabolism* ; Periodontitis/prevention & control* ; RAW 264.7 Cells ; Oxidative Stress/drug effects* ; Peptide Elongation Factor Tu/metabolism* ; Mice, Inbred C57BL ; Male ; Mitochondria/drug effects*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

BACKGROUND: The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment. OBJECTIVE: This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects. SEARCH STRATEGY: PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022. INCLUSION CRITERIA: RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment. DATA EXTRACTION AND ANALYSIS: The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES. RESULTS: This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs. CONCLUSION The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods* ; Humans ; Randomized Controlled Trials as Topic ; Placebo Effect ; Placebos ; Treatment Outcome

Objective To explore the feasibility and safety of ultrasound-guided percutaneous microwave ablation for unresectable pancreatic cancer.Methods Totally 84 patients who underwent ultrasound-guided percutaneous microwave ablation for unresectable pancreatic cancer were enrolled,and the technical success rate,complete ablation rate,complication rate,pain relief rate and survival time,etc.were observed.Results The median age of 84 cases was 61.5 years.Totally 86 tumors,including 44.19％(38/86)at the head/neck and 55.81％(48/86)at the body/tail of pancreas were detected,and a total of 85 ablation sessions were performed with the median ablation energy applied per tumor of 9.90(1.08,21.60)kJ and the complete ablation rate of 42.86％(36/84).The technical success rate was 100％(85/85).Thirty-nine complication events occurred in 25 cases,no ablation-related death.Among 34 patients underwent ablation mainly for pain symptoms,the pain score decreased from(6.22±1.12)points before treatment to(1.94±1.64)points after treatment(P＜0.001).During 6.8(3.3,12.9)months' follow-up,the mean survival time was(8.5±6.7)months,and all 47 patients died due to tumor progression.Conclusion Ultrasound-guided percutaneous microwave ablation was safe and feasible for unresectable pancreatic cancer.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Paraplegia caused by spinal cord injury is a serious neurological complication, for which surgery is currently the main treatment method. Due to different surgical approaches, patients are usually expected to maintain a passive prone position for a long time or switch between the supine and prone positions. Affected by multiple factors such as neurogenic sensory disorders, pathological changes in muscle tone and operative duration, the risk of intraoperative acquired pressure injury (IAPI) is significantly increased. Current clinical prevention strategies for IAPI in these patients predominantly focus on localized pressure relief during positioning, lacking systematic, standardized comprehensive prevention protocols or evidence-based guidelines. To address it, Department of Nursing, Orthopedics Branch, China International Exchange and Promotive Association for Medical and Health Care, Spinal Trauma Professional Committee, Orthopedics Branch, Chinese Medical Doctor Association, Nursing Group of Spine and Spinal Cord Professional Committee of Chinese Association of Rehabilitation Medicine organized experts in relevant fields to formulate Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury ( version 2025), based on evidence-based medical evidence and latest research results and clinical practice at home and abroad. Eleven recommendations were put forward from the aspects of preoperative risk assessment, intraoperative prevention strategies, postoperative handover and monitoring, and supportive mechanisms for IAPI prevention, aiming to standardize the prevention measures and management strategies of IAPI in paraplegic patients with spinal cord injury and accelerate the recovery of patients and improve the therapeutic effect.