OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To screen the genetic risk factors related to severe hematology adverse effects (AEs) in patients with chronic myeloid leukemia (CML) treated with imatinib (IM), and explore the correlation of single nucleotide polymorphisms (SNPs) in IM drug metabolism and transport pathway gene polymorphism with the risk of severe hematology AEs. METHODS: 172 newly diagnosed Chinese Han patients in CML chronic phase (CML-CP) treated with IM were included and divided into severe hematology AEs group and non-severe hematology AEs group. The demographic characteristics and laboratory test results were compared between the two groups. 11 gene SNP sites in the included subjects were genotyped using SNaPshot multiplex SNPs technique. RESULTS: Compared with non-severe hematology AEs group, the severe hematology AEs group had higher white blood cell (WBC) and EOS% (both P < 0.05), but lower hemoglobin (Hb) and hematocrit (HCT) (both P < 0.01). For rs1045642 of ABCB1 gene, there were significant differences in the distribution of allele frequency and genotype frequency of this loci between severe hematology AEs group and non-severe hematology AEs group (both P < 0.05). Carriers of rs1045642 mutation allele A had an increased risk of severe hematology AEs (OR =2.09, 95% CI : 1.24-3.55, P =0.005). There was a significant difference in the distribution of NR1I2 gene rs3814055 genotype between severe hematology AEs group and non-severe hematology AEs group (P < 0.05). The additive model and recessive model of ABCB1 gene rs1045642 and the recessive model of NR1I2 gene rs3814055 were associated with the increased risk of severe hematology AEs (OR =2.14, 3.28, 5.54, all P < 0.05). CONCLUSION Peripheral blood WBC, EOS%, Hb and HCT in patients with newly diagnosed CML-CP are all related to the risk of severe hematology AEs. ABCB1 gene rs1045642 and NR1I2 gene rs3814055 related to the metabolism and transport pathway of IM are associated with severe hematology AEs after IM treatment in CML-CP patients, and they may be potential molecular markers to predict the risk of severe hematology AEs of CML patients treated by IM.
Humans ; Imatinib Mesylate ; Leukemia, Myelogenous, Chronic, BCR-ABL Positive/genetics* ; Polymorphism, Single Nucleotide ; Genotype ; ATP Binding Cassette Transporter, Subfamily B ; Gene Frequency ; Female ; Male ; Middle Aged ; Adult ; Asian People

The disturbance of the human microbiota influences the occurrence and progression of many diseases. Live therapeutic bacteria, with their genetic manipulability, anaerobic tendencies, and immunomodulatory properties, are emerging as promising therapeutic agents. However, their clinical applications face challenges in maintaining activity and achieving precise spatiotemporal release, particularly in the harsh gastrointestinal environment. This review highlights the innovative bacterial functionalized encapsulation strategies developed through advances in physicochemical and biological techniques. We comprehensively review how bacterial encapsulation strategies can be used to provide physical barriers and enhanced adhesion properties to live microorganisms, while introducing superior material properties to live bacteria. In addition, this review outlines how bacterial surface coating can facilitate targeted delivery and precise spatiotemporal release of live bacteria. Furthermore, it elucidates their potential applications for treating different diseases, along with critical perspectives on challenges in clinical translation. This review comprehensively analyzes the connection between functionalized bacterial encapsulation and innovative biomedical applications, providing a theoretical reference for the development of next-generation bacterial therapies.

Objective To evaluate tolerability,safety and pharmacokinetics of JS026 and JS026-JS016 single dose intravenous infusion in healthy adults.Methods This phase 1,randomized,double-blind,placebo-controlled,dose-escalation study totally included 48 participants:32 healthy subjects were enrolled in JS026 single intravenous infusion groups and 16 healthy subjects were enrolled in JS026-JS016 groups.JS026 was sequentially administered from low dose to high dose(30-1 000 mg),with intravenous infusion of JS026 or placebo in JS026 single-dose groups,and intravenous infusion of JS026-JS016 or placebo in the combination drug groups.Blood was collected according to the time point designed for trial.Serum concentrations of JS026 and JS016 were determined by enzyme linked immunosorbnent assay(ELISA),and pharmacokinetics parameters were calculated by WinNonlin 8.2.The power model method was used to evaluate the linear analysis of dose and drug exposure.Results 47 subjects completed trial and 1 subject lost to follow-up.After a single intravenous injection of JS026 of 30 mg,100 mg,300 mg,600 mg,and 1 000 mg,mean Cmax were(9.47±1.53),(33.20±4.95),(96.10±13.70),(177.00±22.20)and(353.00±56.70)μg·mL-1,respectively;mean AUC0-∞ were(4 225.00±607.00),(1.78 × 104±3 268.00),(5.83 × 104±1 038.00),(1.07 × 105±152.00),(1.66 × 105±327.00)μg·h·mL-1,respectively;mean t1/2 of JS026 were 563-709 h.The Cmax and AUC0-∞ of JS026 were basically similar alone or in combination with JS016.The results of Power model showed that Cmax and AUC0-∞ increased approximately linearly with the increasing dose of JS026.Treatment emergent adverse event was not increasing when dose increased and most of adverse event associated with drugs were abnormal on laboratory tests and haematuria,thus JS026 and JS016 was well tolerated in all groups.Conclusion The single intravenous infusion of JS026 can almost be thought to be a linear relationship between the doses and drug serum exposure.JS016 had no significant effect on serum concentration of JS026 and JS026 was well tolerated and safe in healthy subjects within 30-1 000 mg.

Patients with severe trauma require an extremely timely treatment and transfusion plays an irreplaceable role in the emergency treatment of such patients. An increasing number of evidence-based medicinal evidences and clinical practices suggest that patients with severe traumatic bleeding benefit from early transfusion of low-titer group O whole blood or hemostatic resuscitation with red blood cells, plasma and platelet of a balanced ratio. However, the current domestic mode of blood supply cannot fully meet the requirements of timely and effective blood transfusion for emergency treatment of patients with severe trauma in clinical practice. In order to solve the key problems in blood supply and blood transfusion strategies for emergency treatment of severe trauma, Branch of Clinical Transfusion Medicine of Chinese Medical Association, Group for Trauma Emergency Care and Multiple Injuries of Trauma Branch of Chinese Medical Association, Young Scholar Group of Disaster Medicine Branch of Chinese Medical Association organized domestic experts of blood transfusion medicine and trauma treatment to jointly formulate Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients ( version 2024). Based on the evidence-based medical evidence and Delphi method of expert consultation and voting, 10 recommendations were put forward from two aspects of blood support mode and transfusion strategies, aiming to provide a reference for transfusion resuscitation in the emergency treatment of severe trauma and further improve the success rate of treatment of patients with severe trauma.

Objective: To identify the maximum tolerated dose (MTD) of docetaxel combined with a fixed dose of cisplatin (75 mg/m 2 ) delivered as hyperthermic intraperitoneal chemotherapy (HIPEC) in patients with ovarian cancer. Methods: In this phase I trial, a time-to-event Bayesian optimal interval design was used.Docetaxel was given at a starting dose of 60 mg/m2 and was increased in 5 mg/m2 increments until the MTD was determined or the maximum dose level of 75 mg/m2 was reached. The doselimiting toxicity (DLT) rate was set at 25%, with a total sample size of 30 patients. HIPEC was delivered immediately following debulking surgery at a target temperature of 43°C for 90 minutes. Results: From August 2022 to November 2022, 30 patients were enrolled. Among the patients who received a dose of docetaxel ≤65 mg/m2 , no DLT was reported. DLTs were observed in one patient who received 70 mg/m2 docetaxel (grade 3 anaemia) and in three patients who received 75 mg/m2 docetaxel (one case of grade 3 anaemia, one case of grade 3 hepatic impairment and one case of grade 4 thrombocytopenia). Patients treated with docetaxel 75 mg/m2 in combination with cisplatin 75 mg/m2 had an estimated DLT rate of 25%, which was the closest to the target DLT rate and was therefore chosen as the MTD. Conclusion Docetaxel, in combination with a fixed dose of cisplatin (75 mg/m2), can be used safely at intraperitoneal doses of 75 mg/m2 in ovarian cancer patients who received HIPEC (43°C, 90 minutes) following debulking surgery.

Objective: To identify the maximum tolerated dose (MTD) of docetaxel combined with a fixed dose of cisplatin (75 mg/m 2 ) delivered as hyperthermic intraperitoneal chemotherapy (HIPEC) in patients with ovarian cancer. Methods: In this phase I trial, a time-to-event Bayesian optimal interval design was used.Docetaxel was given at a starting dose of 60 mg/m2 and was increased in 5 mg/m2 increments until the MTD was determined or the maximum dose level of 75 mg/m2 was reached. The doselimiting toxicity (DLT) rate was set at 25%, with a total sample size of 30 patients. HIPEC was delivered immediately following debulking surgery at a target temperature of 43°C for 90 minutes. Results: From August 2022 to November 2022, 30 patients were enrolled. Among the patients who received a dose of docetaxel ≤65 mg/m2 , no DLT was reported. DLTs were observed in one patient who received 70 mg/m2 docetaxel (grade 3 anaemia) and in three patients who received 75 mg/m2 docetaxel (one case of grade 3 anaemia, one case of grade 3 hepatic impairment and one case of grade 4 thrombocytopenia). Patients treated with docetaxel 75 mg/m2 in combination with cisplatin 75 mg/m2 had an estimated DLT rate of 25%, which was the closest to the target DLT rate and was therefore chosen as the MTD. Conclusion Docetaxel, in combination with a fixed dose of cisplatin (75 mg/m2), can be used safely at intraperitoneal doses of 75 mg/m2 in ovarian cancer patients who received HIPEC (43°C, 90 minutes) following debulking surgery.

Objective: To identify the maximum tolerated dose (MTD) of docetaxel combined with a fixed dose of cisplatin (75 mg/m 2 ) delivered as hyperthermic intraperitoneal chemotherapy (HIPEC) in patients with ovarian cancer. Methods: In this phase I trial, a time-to-event Bayesian optimal interval design was used.Docetaxel was given at a starting dose of 60 mg/m2 and was increased in 5 mg/m2 increments until the MTD was determined or the maximum dose level of 75 mg/m2 was reached. The doselimiting toxicity (DLT) rate was set at 25%, with a total sample size of 30 patients. HIPEC was delivered immediately following debulking surgery at a target temperature of 43°C for 90 minutes. Results: From August 2022 to November 2022, 30 patients were enrolled. Among the patients who received a dose of docetaxel ≤65 mg/m2 , no DLT was reported. DLTs were observed in one patient who received 70 mg/m2 docetaxel (grade 3 anaemia) and in three patients who received 75 mg/m2 docetaxel (one case of grade 3 anaemia, one case of grade 3 hepatic impairment and one case of grade 4 thrombocytopenia). Patients treated with docetaxel 75 mg/m2 in combination with cisplatin 75 mg/m2 had an estimated DLT rate of 25%, which was the closest to the target DLT rate and was therefore chosen as the MTD. Conclusion Docetaxel, in combination with a fixed dose of cisplatin (75 mg/m2), can be used safely at intraperitoneal doses of 75 mg/m2 in ovarian cancer patients who received HIPEC (43°C, 90 minutes) following debulking surgery.

Krüppel-like transcription factor 2 (KLF2) plays a key regulatory role in endothelial inflammation, thrombosis, angiogenesis and macrophage inflammation and polarization, and up-regulation of KLF2 expression has the potential to prevent and treatment atherosclerosis. In this study, trichostatin C (TSC) was obtained from the secondary metabolites of rice fermentation of Streptomyces sp. CPCC 203909 as a KLF2 up-regulator by using a high throughput screening model based on a KLF2 promoter luciferase reporter assay. TSC significantly inhibited the adhesion of tumor necrosis factor-α (TNFα) induced monocytes (THP-1) to human umbilical vein endothelial cells (HUVECs). Western blot results showed that TSC decreased TNFα induced the protein expression increase of vascular cell adhesion molecule-1 (VCAM-1), and thereby inhibited endothelial inflammation. The results of histone deacetylase (HDAC) overexpression and molecular docking experiments showed that TSC upregulated the expression of KLF2 by inhibiting subtypes of HDAC 4/5/7. In conclusion, this study suggests that TSC up-regulates the expression of KLF2 through inhibiting HDAC 4/5/7 and thus inhibits TNFα induced endothelial inflammation, and it has the potential to prevent and treat atherosclerosis.

Objective:To analyze the distribution characteristics of special types of diabetes in China, in order to provide a theoretical basis for the diagnosis and treatment of special types of diabetes.Methods:Pubmed, CNKI, and WanFang Data were searched for the case reports and clinical studies of special types of diabetes in China from 2011 to 2021. After independent literature screening by 2 researchers according to the inclusion and exclusion criteria, diseases and the number of corresponding cases included were extracted for statistics. The etiological composition and disease characteristics of three subtypes of special type diabetes were analyzed.Results:A total of 613 articles(7 377 patients)were included and roughly divided into eight subtypes of special type diabetes according to etiological classification for disease composition analysis. The results by ratio in descending order were as follows: mono-genetic gene defects in islet β-cell function, pancreatogenic diabetes, diabetes induced by drugs or chemicals, endocrine disease, mono-genetic gene defects in insulin action, other genetic syndromes associated with diabetes, infection, and uncommon immune-mediated diabetes. The disease composition of the three subtypes of special types of diabetes that we focused on were mono-genetic gene defects in islet β-cell function(50.21%), pancreatogenic diabetes(35.65%), and mono-genetic gene defects in insulin action(1.56%). The composition analysis of the special types of diabetes in each subtype showed that neonatal diabetes mellitus(NDM, n=1 749, 23.71%)and maturity onset diabetes in young(MODY, n=1 554, 21.07%)accounted for the largest proportions. According to the composition analysis of each subtype of MODY patients, the top three subtypes were MODY2(50.89%), MODY3(16.03%), and MODYX(8.91%). In addition, taking MODY as an example, patients with de novo mutations(DNMs)and(or)new mutation sites were summarized and analyzed. The results revealed 31 MODY patients with DNMs(1.99%) and 339 MODY patients with new mutation sites(21.81%). Conclusions:According to the literature analysis, NDM and MODY represent the largest proportion of patients with special type diabetes in China. MODY2 patients make up the largest proportion of MODY patients. In addition, diabetic patients carrying DNMs and(or)new mutation sites should be taken seriously.