This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

ObjectiveTo observe the effect of functional pelvic floor muscle training on pelvic floor muscle function, incontinence symptoms and quality of life in female patients with stress urinary incontinence (SUI). MethodsFrom February, 2024 to July, 2025, 40 female patients with SUI were recruited from Beijing Bo'ai Hospital and advertisements. They were randomly divided into control group (n = 20) and experimental group (n = 20). The control group received conventional pelvic floor muscle contraction and relaxation training, and the experimental group received functional pelvic floor muscle contraction and relaxation training, for eight weeks. The data of pelvic floor muscle strength, pelvic floor muscle surface electromyography (sEMG), 1-hour urine pad test and Incontinence Quality of Life questionnaire (I-QOL) were collected before and after training. The compliance rate was counted after training. ResultsOne case dropped down in the control group and three cases dropped down in the experimental group. After treatment, the pelvic floor muscle strength increased in both groups (|Z| > 3.317, P < 0.01), the pre-resting average value, sustained contraction average value and durable contraction average value of sEMG improved in the control group (|t| > 2.731, P < 0.05), the mass of 1-hour urine pad significantly reduced (t > 9.215, P < 0.001) and the I-QOL score significantly increased (|t| > 13.229, P < 0.001) in both groups; compared with the control group, the pelvic floor muscle strength significantly increased (Z = -2.281, P = 0.023), the mass of 1-hour urine pad significantly reduced (t = 4.215, P < 0.001), the I-QOL score significantly increased (t = -4.501, P < 0.001), and the compliance rate significantly increased (Z = -2.798, P < 0.01) in the experimental group . ConclusionFunctional pelvic floor muscle training can significantly improve pelvic floor muscle strength, incontinence symptoms and quality of life in female patients with SUI.

Objective To gain insights into the biological characteristics of different populations of Culex tritaeniorhynchus within and around the Yellow Sea wetland from the perspective of the occurrence of resistance, we investigated the levels of resistance to deltamethrin and kdr gene mutation in the wetland and its peripheral areas. Methods Specimens were collected from Cx. tritaeniorhynchus populations at two monitoring sites in the Rare Bird National Nature Reserve and Tiaozi Ni Wetland Scenic Area, and also from two populations in Yancheng City and the Liuhe District of Nanjing, and the resistance of these mosquitoes to deltamethrin was determined using the CDC biotest bottle method. For each concentration of deltamethrin assessed, a random subset of exposed specimens was selected for amplification of the kdr gene fragment, followed by Sanger sequencing to identify and analyze resistance-associated mutations. Results The LC50 levels of deltamethrin among mosquitoes from the four populations in Luhe, Yancheng, the Rare Bird National Nature Reserve and the Tiaozi Ni Wetland Scenic Area were 2.048 5, 7.798 2, 3.473 3, and 17.695 5 mg/mL, respectively, with corresponding concentrations of deltamethrin ranging from 0.005 to 5.000,0.050 to 50.000,0.050 to 25.000 and 0.050 to 50.000 mg/mL, respectively. Furthermore, the ranges of the KT50 values were 11.76-107.43, 67.05-216.30,29.77-107.43 and 28.40-329.51 min; the 1-h knockdown rates were 34.58%-99.15%, 9.52%-43.80%, 55.09%-73.01%, and 10.09%-68.07%; and the 24-h mortality rates were 12.15%-67.52%,9.52%-79.56%,13.17%-82.21%, and 11.01%-78.99%, respectively. With respect to kdr gene mutation, we assayed a total of 63,70,59, and 57 mosquitoes for the four populations, for which we detected L1014F mutation frequencies of 14.29%, 35.00%, 20.34%, and 31.58%, respectively, with a majority of these mutations being heterozygous for resistance. In addition, five adult mosquitoes were identified has having synonymous mutations at site 1011[i. e. , AAT(asparagine)mutation to AAC(asparagine)]. Conclusions Our findings revealed the clear resistance of Cx. tritaeniorhynchus to deltamethrin in the Yancheng region of the Yellow Sea wetland, and the resistance phenotype and kdr frequency of Cx. tritaeniorhynchus in the wetland environment were comparable to those of Cx. tritaeniorhynchus in the wetland environment, thereby indicating that the resistance of different populations of Cx. tritaeniorhynchus was homogeneous under the pressure of different insecticide selection within and around the wetland. However, the underlying mechanisms need to be further studied.

OBJECTIVE: To screen the genetic risk factors related to severe hematology adverse effects (AEs) in patients with chronic myeloid leukemia (CML) treated with imatinib (IM), and explore the correlation of single nucleotide polymorphisms (SNPs) in IM drug metabolism and transport pathway gene polymorphism with the risk of severe hematology AEs. METHODS: 172 newly diagnosed Chinese Han patients in CML chronic phase (CML-CP) treated with IM were included and divided into severe hematology AEs group and non-severe hematology AEs group. The demographic characteristics and laboratory test results were compared between the two groups. 11 gene SNP sites in the included subjects were genotyped using SNaPshot multiplex SNPs technique. RESULTS: Compared with non-severe hematology AEs group, the severe hematology AEs group had higher white blood cell (WBC) and EOS% (both P < 0.05), but lower hemoglobin (Hb) and hematocrit (HCT) (both P < 0.01). For rs1045642 of ABCB1 gene, there were significant differences in the distribution of allele frequency and genotype frequency of this loci between severe hematology AEs group and non-severe hematology AEs group (both P < 0.05). Carriers of rs1045642 mutation allele A had an increased risk of severe hematology AEs (OR =2.09, 95% CI : 1.24-3.55, P =0.005). There was a significant difference in the distribution of NR1I2 gene rs3814055 genotype between severe hematology AEs group and non-severe hematology AEs group (P < 0.05). The additive model and recessive model of ABCB1 gene rs1045642 and the recessive model of NR1I2 gene rs3814055 were associated with the increased risk of severe hematology AEs (OR =2.14, 3.28, 5.54, all P < 0.05). CONCLUSION Peripheral blood WBC, EOS%, Hb and HCT in patients with newly diagnosed CML-CP are all related to the risk of severe hematology AEs. ABCB1 gene rs1045642 and NR1I2 gene rs3814055 related to the metabolism and transport pathway of IM are associated with severe hematology AEs after IM treatment in CML-CP patients, and they may be potential molecular markers to predict the risk of severe hematology AEs of CML patients treated by IM.
Humans ; Imatinib Mesylate ; Leukemia, Myelogenous, Chronic, BCR-ABL Positive/genetics* ; Polymorphism, Single Nucleotide ; Genotype ; ATP Binding Cassette Transporter, Subfamily B ; Gene Frequency ; Female ; Male ; Middle Aged ; Adult ; Asian People

Objective To compare the colonoscopy results of patients with positive fecal SDC2,ADHFE1,and PPP2R5C gene methylation tests to those with positive fecal occult blood tests,and analyze the effectiveness of colorectal cancer(CRC)screening.This study aims to provide a scientific basis for risk assessment in CRC screening.Methods From December 2023 to May 2024,9 284 combined test kits for SDC2,ADHFE1,and PPP2R5C gene methylation were distributed to high-risk individuals aged 40～80 years.Among them,841 patients(9.1％)tested positive.These patients were encouraged via telephone to undergo colonoscopy,with colonoscopy combined with pathological diagnosis as the gold standard,a total of 495 positive patients completed electronic colonoscopy.Among them,the 251 patients who tested positive for fecal SDC2,ADHFE1,and PPP2R5C gene methylation and completed electronic colonoscopy were the observation group;concurrently,244 patients who tested positive for fecal occult blood tests and underwent electronic colonoscopy were selected as the control group.Compare two groups of patients with polyp,number,shape,pathological changes and pathological types.Results There was no statistically significant difference in number and lesion location of polyps between the two groups of patients(P>0.05).The proportion of Yamada type Ⅰ in the observation group was lower than that in the control group,while the proportion of Yamada type Ⅱ was higher than that in the control group.The difference was statistically significant(P<0.05).In the observation group,1 case(0.4％)of CRC,62 cases(24.7％)of advanced adenomas,78 cases(31.1％)of non-advanced adenomas,20 cases(8.0％)of hyperplastic polyps,and 90 cases(35.9％)with no dysplastic lesions were identified.In the control group,6 cases(2.5％)of CRC,38 cases(15.6％)of advanced adenomas,53 cases(21.7％)of non-advanced adenomas,19 cases(7.8％)of hyperplastic polyps,and 128 cases(52.5％)with no dysplastic lesions were identified.The proportions of non-advanced adenomas and advanced adenomas were lower in the control group than those in the observation group,while the no dysplastic lesions rate was higher in the control group,the differences were statistically significant(P<0.05).Conclusion The detection rate of colorectal non-advanced adenomas and advanced adenomas is higher with fecal SDC2,ADHFE1,and PPP2R5C gene methylation testing compared to the fecal occult blood test.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

The disturbance of the human microbiota influences the occurrence and progression of many diseases. Live therapeutic bacteria, with their genetic manipulability, anaerobic tendencies, and immunomodulatory properties, are emerging as promising therapeutic agents. However, their clinical applications face challenges in maintaining activity and achieving precise spatiotemporal release, particularly in the harsh gastrointestinal environment. This review highlights the innovative bacterial functionalized encapsulation strategies developed through advances in physicochemical and biological techniques. We comprehensively review how bacterial encapsulation strategies can be used to provide physical barriers and enhanced adhesion properties to live microorganisms, while introducing superior material properties to live bacteria. In addition, this review outlines how bacterial surface coating can facilitate targeted delivery and precise spatiotemporal release of live bacteria. Furthermore, it elucidates their potential applications for treating different diseases, along with critical perspectives on challenges in clinical translation. This review comprehensively analyzes the connection between functionalized bacterial encapsulation and innovative biomedical applications, providing a theoretical reference for the development of next-generation bacterial therapies.

Objective To compare the colonoscopy results of patients with positive fecal SDC2,ADHFE1,and PPP2R5C gene methylation tests to those with positive fecal occult blood tests,and analyze the effectiveness of colorectal cancer(CRC)screening.This study aims to provide a scientific basis for risk assessment in CRC screening.Methods From December 2023 to May 2024,9 284 combined test kits for SDC2,ADHFE1,and PPP2R5C gene methylation were distributed to high-risk individuals aged 40～80 years.Among them,841 patients(9.1％)tested positive.These patients were encouraged via telephone to undergo colonoscopy,with colonoscopy combined with pathological diagnosis as the gold standard,a total of 495 positive patients completed electronic colonoscopy.Among them,the 251 patients who tested positive for fecal SDC2,ADHFE1,and PPP2R5C gene methylation and completed electronic colonoscopy were the observation group;concurrently,244 patients who tested positive for fecal occult blood tests and underwent electronic colonoscopy were selected as the control group.Compare two groups of patients with polyp,number,shape,pathological changes and pathological types.Results There was no statistically significant difference in number and lesion location of polyps between the two groups of patients(P>0.05).The proportion of Yamada type Ⅰ in the observation group was lower than that in the control group,while the proportion of Yamada type Ⅱ was higher than that in the control group.The difference was statistically significant(P<0.05).In the observation group,1 case(0.4％)of CRC,62 cases(24.7％)of advanced adenomas,78 cases(31.1％)of non-advanced adenomas,20 cases(8.0％)of hyperplastic polyps,and 90 cases(35.9％)with no dysplastic lesions were identified.In the control group,6 cases(2.5％)of CRC,38 cases(15.6％)of advanced adenomas,53 cases(21.7％)of non-advanced adenomas,19 cases(7.8％)of hyperplastic polyps,and 128 cases(52.5％)with no dysplastic lesions were identified.The proportions of non-advanced adenomas and advanced adenomas were lower in the control group than those in the observation group,while the no dysplastic lesions rate was higher in the control group,the differences were statistically significant(P<0.05).Conclusion The detection rate of colorectal non-advanced adenomas and advanced adenomas is higher with fecal SDC2,ADHFE1,and PPP2R5C gene methylation testing compared to the fecal occult blood test.

Objective To observe the mid-and long-term effects of Kegel training combined with Pilates training on urinary conti-nence recovery in different body mass index(BMI)male patients with urinary incontinence after prostatectomy.Methods From May,2023 to June,2024,48 patients in Beijing Bo'ai Hospital were recruited and divided into group A(<25 kg/m2,n=15),group B(25 to 30 kg/m2,n=18)and group C(>30 kg/m2,n=15)according to their BMI.All the groups performed Kegel training combined with Pilates training for two months,and followed up at six months from baseline.They were evaluated with one hour pad test,the number of daily urinary incontinence,In-ternational Consultation on Incontinence Questionnaire-Short Form(ICIQ-SF)and modified Oxford Rating Scale before treatment,and four weeks,eight weeks and six months after treatment.Results The intra-group effect,the inter-group effect and interaction effect were significant in the results of one hour pad test and the daily number of urinary incontinence(F>2.955,P<0.05).Post Hoc test showed that they were worse in group C than in groups A and B(P<0.05),and the number of daily urinary incontinence was more in group B than in group A(P<0.05).There was significant difference in the scores of ICIQ-SF and modified Ox-ford Rating Scale among groups in different time points after treatment(Z>10.476,P<0.05)except the score of ICIQ-SF four weeks after treatment(P>0.05),and they were the worst in group C.BMI(group A=1,group B=2,group C=3)was correlated with the results of one hour pad test(r=0.79,P<0.001),the number of daily uri-nary incontinence(r=0.68,P<0.001),and the scores of ICIQ-SF(r=0.68,P<0.001)and modified Oxford Rating Scale(r=-0.47,P=0.001)six months after treatment.Conclusion Kegel training combined with Pilates training could improve the urinary control in patients with urinary in-continence after prostatectomy.The decrease of BMI can promote the recovery of urinary control,and improve the symptoms of later urinary incontinence in mid-and long-term.