1.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
2.The Association of Polymorphisms Drug Metabolism and Transport of Imatinib Related Gene with Severe Hematology Adverse Effects in Chronic Myeloid Leukemia Patients.
Wen-Jing ZHOU ; Nian WANG ; Li LIN ; Li-Juan WU ; Yuan-Xin YE
Journal of Experimental Hematology 2025;33(2):344-351
OBJECTIVE:
To screen the genetic risk factors related to severe hematology adverse effects (AEs) in patients with chronic myeloid leukemia (CML) treated with imatinib (IM), and explore the correlation of single nucleotide polymorphisms (SNPs) in IM drug metabolism and transport pathway gene polymorphism with the risk of severe hematology AEs.
METHODS:
172 newly diagnosed Chinese Han patients in CML chronic phase (CML-CP) treated with IM were included and divided into severe hematology AEs group and non-severe hematology AEs group. The demographic characteristics and laboratory test results were compared between the two groups. 11 gene SNP sites in the included subjects were genotyped using SNaPshot multiplex SNPs technique.
RESULTS:
Compared with non-severe hematology AEs group, the severe hematology AEs group had higher white blood cell (WBC) and EOS% (both P < 0.05), but lower hemoglobin (Hb) and hematocrit (HCT) (both P < 0.01). For rs1045642 of ABCB1 gene, there were significant differences in the distribution of allele frequency and genotype frequency of this loci between severe hematology AEs group and non-severe hematology AEs group (both P < 0.05). Carriers of rs1045642 mutation allele A had an increased risk of severe hematology AEs (OR =2.09, 95% CI : 1.24-3.55, P =0.005). There was a significant difference in the distribution of NR1I2 gene rs3814055 genotype between severe hematology AEs group and non-severe hematology AEs group (P < 0.05). The additive model and recessive model of ABCB1 gene rs1045642 and the recessive model of NR1I2 gene rs3814055 were associated with the increased risk of severe hematology AEs (OR =2.14, 3.28, 5.54, all P < 0.05).
CONCLUSION
Peripheral blood WBC, EOS%, Hb and HCT in patients with newly diagnosed CML-CP are all related to the risk of severe hematology AEs. ABCB1 gene rs1045642 and NR1I2 gene rs3814055 related to the metabolism and transport pathway of IM are associated with severe hematology AEs after IM treatment in CML-CP patients, and they may be potential molecular markers to predict the risk of severe hematology AEs of CML patients treated by IM.
Humans
;
Imatinib Mesylate
;
Leukemia, Myelogenous, Chronic, BCR-ABL Positive/genetics*
;
Polymorphism, Single Nucleotide
;
Genotype
;
ATP Binding Cassette Transporter, Subfamily B
;
Gene Frequency
;
Female
;
Male
;
Middle Aged
;
Adult
;
Asian People
3.Progress and challenges of functionalized bacterial encapsulation: A novel biotechnology for next-generation biotherapeutics.
Ying ZHANG ; Yuwei WU ; Xinyu ZHAO ; Qinghua YE ; Lulu CAO ; Ming LIU ; Bao GAO ; Qinya NIU ; Nuo CHEN ; Zixuan DUAN ; Yu DING ; Juan WANG ; Moutong CHEN ; Ying LI ; Qingping WU
Acta Pharmaceutica Sinica B 2025;15(10):5167-5191
The disturbance of the human microbiota influences the occurrence and progression of many diseases. Live therapeutic bacteria, with their genetic manipulability, anaerobic tendencies, and immunomodulatory properties, are emerging as promising therapeutic agents. However, their clinical applications face challenges in maintaining activity and achieving precise spatiotemporal release, particularly in the harsh gastrointestinal environment. This review highlights the innovative bacterial functionalized encapsulation strategies developed through advances in physicochemical and biological techniques. We comprehensively review how bacterial encapsulation strategies can be used to provide physical barriers and enhanced adhesion properties to live microorganisms, while introducing superior material properties to live bacteria. In addition, this review outlines how bacterial surface coating can facilitate targeted delivery and precise spatiotemporal release of live bacteria. Furthermore, it elucidates their potential applications for treating different diseases, along with critical perspectives on challenges in clinical translation. This review comprehensively analyzes the connection between functionalized bacterial encapsulation and innovative biomedical applications, providing a theoretical reference for the development of next-generation bacterial therapies.
4.Pharmacokinetics of JS026 and JS026-JS016 for single intravenous administration in healthy volunteers
Yan TIAN ; Hui-Jing YE ; Jing-Jing WANG ; Nan-Yang LI ; Juan MA ; Xi TAN ; Fan WU ; Jie WANG ; Shu-Yan YU ; Xiao-Jie WU ; Jin-Jie HE ; Jing ZHANG ; Wen-Hong ZHANG
The Chinese Journal of Clinical Pharmacology 2024;40(15):2251-2255
Objective To evaluate tolerability,safety and pharmacokinetics of JS026 and JS026-JS016 single dose intravenous infusion in healthy adults.Methods This phase 1,randomized,double-blind,placebo-controlled,dose-escalation study totally included 48 participants:32 healthy subjects were enrolled in JS026 single intravenous infusion groups and 16 healthy subjects were enrolled in JS026-JS016 groups.JS026 was sequentially administered from low dose to high dose(30-1 000 mg),with intravenous infusion of JS026 or placebo in JS026 single-dose groups,and intravenous infusion of JS026-JS016 or placebo in the combination drug groups.Blood was collected according to the time point designed for trial.Serum concentrations of JS026 and JS016 were determined by enzyme linked immunosorbnent assay(ELISA),and pharmacokinetics parameters were calculated by WinNonlin 8.2.The power model method was used to evaluate the linear analysis of dose and drug exposure.Results 47 subjects completed trial and 1 subject lost to follow-up.After a single intravenous injection of JS026 of 30 mg,100 mg,300 mg,600 mg,and 1 000 mg,mean Cmax were(9.47±1.53),(33.20±4.95),(96.10±13.70),(177.00±22.20)and(353.00±56.70)μg·mL-1,respectively;mean AUC0-∞ were(4 225.00±607.00),(1.78 × 104±3 268.00),(5.83 × 104±1 038.00),(1.07 × 105±152.00),(1.66 × 105±327.00)μg·h·mL-1,respectively;mean t1/2 of JS026 were 563-709 h.The Cmax and AUC0-∞ of JS026 were basically similar alone or in combination with JS016.The results of Power model showed that Cmax and AUC0-∞ increased approximately linearly with the increasing dose of JS026.Treatment emergent adverse event was not increasing when dose increased and most of adverse event associated with drugs were abnormal on laboratory tests and haematuria,thus JS026 and JS016 was well tolerated in all groups.Conclusion The single intravenous infusion of JS026 can almost be thought to be a linear relationship between the doses and drug serum exposure.JS016 had no significant effect on serum concentration of JS026 and JS026 was well tolerated and safe in healthy subjects within 30-1 000 mg.
5.Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients (version 2024)
Yao LU ; Yang LI ; Leiying ZHANG ; Hao TANG ; Huidan JING ; Yaoli WANG ; Xiangzhi JIA ; Li BA ; Maohong BIAN ; Dan CAI ; Hui CAI ; Xiaohong CAI ; Zhanshan ZHA ; Bingyu CHEN ; Daqing CHEN ; Feng CHEN ; Guoan CHEN ; Haiming CHEN ; Jing CHEN ; Min CHEN ; Qing CHEN ; Shu CHEN ; Xi CHEN ; Jinfeng CHENG ; Xiaoling CHU ; Hongwang CUI ; Xin CUI ; Zhen DA ; Ying DAI ; Surong DENG ; Weiqun DONG ; Weimin FAN ; Ke FENG ; Danhui FU ; Yongshui FU ; Qi FU ; Xuemei FU ; Jia GAN ; Xinyu GAN ; Wei GAO ; Huaizheng GONG ; Rong GUI ; Geng GUO ; Ning HAN ; Yiwen HAO ; Wubing HE ; Qiang HONG ; Ruiqin HOU ; Wei HOU ; Jie HU ; Peiyang HU ; Xi HU ; Xiaoyu HU ; Guangbin HUANG ; Jie HUANG ; Xiangyan HUANG ; Yuanshuai HUANG ; Shouyong HUN ; Xuebing JIANG ; Ping JIN ; Dong LAI ; Aiping LE ; Hongmei LI ; Bijuan LI ; Cuiying LI ; Daihong LI ; Haihong LI ; He LI ; Hui LI ; Jianping LI ; Ning LI ; Xiying LI ; Xiangmin LI ; Xiaofei LI ; Xiaojuan LI ; Zhiqiang LI ; Zhongjun LI ; Zunyan LI ; Huaqin LIANG ; Xiaohua LIANG ; Dongfa LIAO ; Qun LIAO ; Yan LIAO ; Jiajin LIN ; Chunxia LIU ; Fenghua LIU ; Peixian LIU ; Tiemei LIU ; Xiaoxin LIU ; Zhiwei LIU ; Zhongdi LIU ; Hua LU ; Jianfeng LUAN ; Jianjun LUO ; Qun LUO ; Dingfeng LYU ; Qi LYU ; Xianping LYU ; Aijun MA ; Liqiang MA ; Shuxuan MA ; Xainjun MA ; Xiaogang MA ; Xiaoli MA ; Guoqing MAO ; Shijie MU ; Shaolin NIE ; Shujuan OUYANG ; Xilin OUYANG ; Chunqiu PAN ; Jian PAN ; Xiaohua PAN ; Lei PENG ; Tao PENG ; Baohua QIAN ; Shu QIAO ; Li QIN ; Ying REN ; Zhaoqi REN ; Ruiming RONG ; Changshan SU ; Mingwei SUN ; Wenwu SUN ; Zhenwei SUN ; Haiping TANG ; Xiaofeng TANG ; Changjiu TANG ; Cuihua TAO ; Zhibin TIAN ; Juan WANG ; Baoyan WANG ; Chunyan WANG ; Gefei WANG ; Haiyan WANG ; Hongjie WANG ; Peng WANG ; Pengli WANG ; Qiushi WANG ; Xiaoning WANG ; Xinhua WANG ; Xuefeng WANG ; Yong WANG ; Yongjun WANG ; Yuanjie WANG ; Zhihua WANG ; Shaojun WEI ; Yaming WEI ; Jianbo WEN ; Jun WEN ; Jiang WU ; Jufeng WU ; Aijun XIA ; Fei XIA ; Rong XIA ; Jue XIE ; Yanchao XING ; Yan XIONG ; Feng XU ; Yongzhu XU ; Yongan XU ; Yonghe YAN ; Beizhan YAN ; Jiang YANG ; Jiangcun YANG ; Jun YANG ; Xinwen YANG ; Yongyi YANG ; Chunyan YAO ; Mingliang YE ; Changlin YIN ; Ming YIN ; Wen YIN ; Lianling YU ; Shuhong YU ; Zebo YU ; Yigang YU ; Anyong YU ; Hong YUAN ; Yi YUAN ; Chan ZHANG ; Jinjun ZHANG ; Jun ZHANG ; Kai ZHANG ; Leibing ZHANG ; Quan ZHANG ; Rongjiang ZHANG ; Sanming ZHANG ; Shengji ZHANG ; Shuo ZHANG ; Wei ZHANG ; Weidong ZHANG ; Xi ZHANG ; Xingwen ZHANG ; Guixi ZHANG ; Xiaojun ZHANG ; Guoqing ZHAO ; Jianpeng ZHAO ; Shuming ZHAO ; Beibei ZHENG ; Shangen ZHENG ; Huayou ZHOU ; Jicheng ZHOU ; Lihong ZHOU ; Mou ZHOU ; Xiaoyu ZHOU ; Xuelian ZHOU ; Yuan ZHOU ; Zheng ZHOU ; Zuhuang ZHOU ; Haiyan ZHU ; Peiyuan ZHU ; Changju ZHU ; Lili ZHU ; Zhengguo WANG ; Jianxin JIANG ; Deqing WANG ; Jiongcai LAN ; Quanli WANG ; Yang YU ; Lianyang ZHANG ; Aiqing WEN
Chinese Journal of Trauma 2024;40(10):865-881
Patients with severe trauma require an extremely timely treatment and transfusion plays an irreplaceable role in the emergency treatment of such patients. An increasing number of evidence-based medicinal evidences and clinical practices suggest that patients with severe traumatic bleeding benefit from early transfusion of low-titer group O whole blood or hemostatic resuscitation with red blood cells, plasma and platelet of a balanced ratio. However, the current domestic mode of blood supply cannot fully meet the requirements of timely and effective blood transfusion for emergency treatment of patients with severe trauma in clinical practice. In order to solve the key problems in blood supply and blood transfusion strategies for emergency treatment of severe trauma, Branch of Clinical Transfusion Medicine of Chinese Medical Association, Group for Trauma Emergency Care and Multiple Injuries of Trauma Branch of Chinese Medical Association, Young Scholar Group of Disaster Medicine Branch of Chinese Medical Association organized domestic experts of blood transfusion medicine and trauma treatment to jointly formulate Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients ( version 2024). Based on the evidence-based medical evidence and Delphi method of expert consultation and voting, 10 recommendations were put forward from two aspects of blood support mode and transfusion strategies, aiming to provide a reference for transfusion resuscitation in the emergency treatment of severe trauma and further improve the success rate of treatment of patients with severe trauma.
6.A phase I dose-finding trial of hyperthermic intraperitoneal docetaxel combined with cisplatin in patients with advanced-stage ovarian cancer
Zhi-yao YOU ; Miao-fang WU ; Hui LI ; Yan-fang YE ; Li-juan WANG ; Zhong-qiu LIN ; Jing LI
Journal of Gynecologic Oncology 2024;35(1):e1-
Objective:
To identify the maximum tolerated dose (MTD) of docetaxel combined with a fixed dose of cisplatin (75 mg/m 2 ) delivered as hyperthermic intraperitoneal chemotherapy (HIPEC) in patients with ovarian cancer.
Methods:
In this phase I trial, a time-to-event Bayesian optimal interval design was used.Docetaxel was given at a starting dose of 60 mg/m2 and was increased in 5 mg/m2 increments until the MTD was determined or the maximum dose level of 75 mg/m2 was reached. The doselimiting toxicity (DLT) rate was set at 25%, with a total sample size of 30 patients. HIPEC was delivered immediately following debulking surgery at a target temperature of 43°C for 90 minutes.
Results:
From August 2022 to November 2022, 30 patients were enrolled. Among the patients who received a dose of docetaxel ≤65 mg/m2 , no DLT was reported. DLTs were observed in one patient who received 70 mg/m2 docetaxel (grade 3 anaemia) and in three patients who received 75 mg/m2 docetaxel (one case of grade 3 anaemia, one case of grade 3 hepatic impairment and one case of grade 4 thrombocytopenia). Patients treated with docetaxel 75 mg/m2 in combination with cisplatin 75 mg/m2 had an estimated DLT rate of 25%, which was the closest to the target DLT rate and was therefore chosen as the MTD.
Conclusion
Docetaxel, in combination with a fixed dose of cisplatin (75 mg/m2), can be used safely at intraperitoneal doses of 75 mg/m2 in ovarian cancer patients who received HIPEC (43°C, 90 minutes) following debulking surgery.
7.A phase I dose-finding trial of hyperthermic intraperitoneal docetaxel combined with cisplatin in patients with advanced-stage ovarian cancer
Zhi-yao YOU ; Miao-fang WU ; Hui LI ; Yan-fang YE ; Li-juan WANG ; Zhong-qiu LIN ; Jing LI
Journal of Gynecologic Oncology 2024;35(1):e1-
Objective:
To identify the maximum tolerated dose (MTD) of docetaxel combined with a fixed dose of cisplatin (75 mg/m 2 ) delivered as hyperthermic intraperitoneal chemotherapy (HIPEC) in patients with ovarian cancer.
Methods:
In this phase I trial, a time-to-event Bayesian optimal interval design was used.Docetaxel was given at a starting dose of 60 mg/m2 and was increased in 5 mg/m2 increments until the MTD was determined or the maximum dose level of 75 mg/m2 was reached. The doselimiting toxicity (DLT) rate was set at 25%, with a total sample size of 30 patients. HIPEC was delivered immediately following debulking surgery at a target temperature of 43°C for 90 minutes.
Results:
From August 2022 to November 2022, 30 patients were enrolled. Among the patients who received a dose of docetaxel ≤65 mg/m2 , no DLT was reported. DLTs were observed in one patient who received 70 mg/m2 docetaxel (grade 3 anaemia) and in three patients who received 75 mg/m2 docetaxel (one case of grade 3 anaemia, one case of grade 3 hepatic impairment and one case of grade 4 thrombocytopenia). Patients treated with docetaxel 75 mg/m2 in combination with cisplatin 75 mg/m2 had an estimated DLT rate of 25%, which was the closest to the target DLT rate and was therefore chosen as the MTD.
Conclusion
Docetaxel, in combination with a fixed dose of cisplatin (75 mg/m2), can be used safely at intraperitoneal doses of 75 mg/m2 in ovarian cancer patients who received HIPEC (43°C, 90 minutes) following debulking surgery.
8.A phase I dose-finding trial of hyperthermic intraperitoneal docetaxel combined with cisplatin in patients with advanced-stage ovarian cancer
Zhi-yao YOU ; Miao-fang WU ; Hui LI ; Yan-fang YE ; Li-juan WANG ; Zhong-qiu LIN ; Jing LI
Journal of Gynecologic Oncology 2024;35(1):e1-
Objective:
To identify the maximum tolerated dose (MTD) of docetaxel combined with a fixed dose of cisplatin (75 mg/m 2 ) delivered as hyperthermic intraperitoneal chemotherapy (HIPEC) in patients with ovarian cancer.
Methods:
In this phase I trial, a time-to-event Bayesian optimal interval design was used.Docetaxel was given at a starting dose of 60 mg/m2 and was increased in 5 mg/m2 increments until the MTD was determined or the maximum dose level of 75 mg/m2 was reached. The doselimiting toxicity (DLT) rate was set at 25%, with a total sample size of 30 patients. HIPEC was delivered immediately following debulking surgery at a target temperature of 43°C for 90 minutes.
Results:
From August 2022 to November 2022, 30 patients were enrolled. Among the patients who received a dose of docetaxel ≤65 mg/m2 , no DLT was reported. DLTs were observed in one patient who received 70 mg/m2 docetaxel (grade 3 anaemia) and in three patients who received 75 mg/m2 docetaxel (one case of grade 3 anaemia, one case of grade 3 hepatic impairment and one case of grade 4 thrombocytopenia). Patients treated with docetaxel 75 mg/m2 in combination with cisplatin 75 mg/m2 had an estimated DLT rate of 25%, which was the closest to the target DLT rate and was therefore chosen as the MTD.
Conclusion
Docetaxel, in combination with a fixed dose of cisplatin (75 mg/m2), can be used safely at intraperitoneal doses of 75 mg/m2 in ovarian cancer patients who received HIPEC (43°C, 90 minutes) following debulking surgery.
9.Leukocyte Telomere Length and Lacunar Stroke: A Mendelian Randomization Study.
Mei Juan DANG ; Tao LI ; Li Li ZHAO ; Ye LI ; Xiao Ya WANG ; Yu Lun WU ; Jia Liang LU ; Zi Wei LU ; Yang YANG ; Yu Xuan FENG ; He Ying WANG ; Ya Ting JIAN ; Song Hua FAN ; Yu JIANG ; Gui Lian ZHANG
Biomedical and Environmental Sciences 2023;36(4):367-370
10.Association of greenness exposure with waist circumference and central obesity in Chinese adults aged 65 years and over.
Li Hong YE ; Jin Hui ZHOU ; Yan Lin TIAN ; Si Xin LIU ; Jun Xin LIU ; Jia Ming YE ; Jia CUI ; Chen CHEN ; Jun WANG ; Bing WU ; Yi Qi QIU ; Yuan WEI ; Yi Dan QIU ; Xu Lin ZHENG ; Li QI ; Yue Bin LV ; Juan ZHANG
Chinese Journal of Preventive Medicine 2023;57():86-92
Objective: To examine the association of greenness exposure with waist circumference (WC) and central obesity in older adults in China. Methods: Based on the cross-sectional data from the Chinese Longitudinal Healthy Longevity Survey in 2017-2018, 14 056 participants aged 65 years and over were included. Demographic characteristics, lifestyle, WC, and other information were collected through a questionnaire and physical examination. Based on the satellite monitoring data of moderate-resolution imaging spectroradiometer (MODIS) provided by NASA, the annual mean of normalized difference vegetation index (NDVI) within a radius of 1 000 meters was obtained as the measurement value of greenness exposure. Multivariate linear regression model, multivariate logistic regression model, and restricted cubic splines (RCS) model were used to analyze the association and dose-response relationship between greenness exposure and WC and central obesity in older adults in China. Results: A total of 14 056 participants were enrolled with a median age of 84.0 years [IQR: 75.0-94.0 years]. About 45.0% (6 330) of them were male and 48.6% (5 853) were illiterate. There were 10 964 (78.0%) participants from rural. The mean of WC was (84.4±10.8) cm. Central obesity accounted for 60.2% (8 465), and the NDVI range was (-0.06, 0.78). After adjusting for confounding factors, the multivariate linear regression model showed that the change value of WC in the urban group [β (95%CI):-0.49 (-0.93, -0.06)] was smaller than that in the rural [-0.78 (-0.98, -0.58)] for every 0.1 unit increase in NDVI (Pinteraction=0.022). Compared with the Q1 group in NDVI, WC of Q2 and Q3 groups in rural decreased, and the β (95%CI) values were-1.74 (-2.5, -0.98) and-2.78 (-3.55, -2.00), respectively. The multivariate logistic regression model showed that after adjusting for confounding factors, the risk of central obesity decreased for urban and rural older adults with an increase of 0.1 unit in NDVI, and the OR (95%CI) values were 0.87 (0.80, 0.95) and 0.86 (0.82, 0.89), respectively (Pinteraction=0.284). Compared with the Q1 group in NDVI, the risk of central obesity in the Q2 and Q3 groups in rural was lower, and the OR (95%CI) values were 0.68 (0.58, 0.80) and 0.57 (0.49, 0.68), respectively. The results of the multivariate regression model with RCS showed that there was a non-linear association of NDVI with WC (Pnonlinear=0.006) and central obesity (Pnonlinear=0.025). Conclusion: Greenness exposure is negatively associated with WC and central obesity in older adults in China.

Result Analysis
Print
Save
E-mail