1.Design and application effect of continuing education case library combined with case-based learning for rehabilitation therapists
Liguo QIAN ; Tongxuan WU ; Qiaoyun ZHANG ; Jian XING ; Yanyan YANG
Chinese Journal of Rehabilitation Theory and Practice 2026;32(3):249-257
ObjectiveTo investigate the demand and the application outcomes of case-based learning (CBL) combined with teaching case library in continuing education courses for rehabilitation therapists. MethodsA convergent mixed-methods research design was adopted, involving 51 rehabilitation therapists and 31 instructors who participated in the advanced training program at the Department of Rehabilitation Medicine, Peking University Third Hospital between October, 2022 and October, 2024. Self-developed questionnaires were used to collect data on the perceived needs of teachers and students regarding CBL and teaching case library. Differences between CBL + teaching case library and traditional lecturing in student evaluations, classroom participation and interaction were compared using Student Evaluation of Teaching in Medical Lectures, Classroom Participation Scale and Flanders Interaction Analysis System. Semi-structured interviews were conducted to obtain evaluations and attitudes towards this method from both instructors and students' perspectives. ResultsThe survey showed that 91.4% of participating teachers and students supported the use of CBL in the courses, and 82.7% advocated that the teaching case library should include typical cases. Significant differences were observed in teaching preference between teachers and students (χ² = 17.597, P < 0.01). Application effects demonstrated that CBL+teaching library significantly outperformed traditional teaching methods in student previewing behaviors, classroom interaction and learning outcomes (|Z| ≥ 2.646, P < 0.01). Flanders Interaction Analysis indicated that CBL+teaching library was superior to traditional teaching in terms of students' motivation to speak and autonomous learning. Qualitative Research generated four positive themes including cultivating clinical reasoning, being close to clinical practice, deepening knowledge understanding and improving teaching quality; and three negative themes including increasing teaching burden, high software and hardware requirements and posing great challenges to students were generated. ConclusionCompared with traditional teaching methods, CBL combined with teaching case library is closely linked to clinical practice, facilitating students' clinical reasoning, enhancing teaching effectiveness and satisfaction, and therefore aligning with the goals and needs of continuing education for rehabilitation therapists, which is highly recognized by both instructors and students.
2.Design and application effect of continuing education case library combined with case-based learning for rehabilitation therapists
Liguo QIAN ; Tongxuan WU ; Qiaoyun ZHANG ; Jian XING ; Yanyan YANG
Chinese Journal of Rehabilitation Theory and Practice 2026;32(3):249-257
ObjectiveTo investigate the demand and the application outcomes of case-based learning (CBL) combined with teaching case library in continuing education courses for rehabilitation therapists. MethodsA convergent mixed-methods research design was adopted, involving 51 rehabilitation therapists and 31 instructors who participated in the advanced training program at the Department of Rehabilitation Medicine, Peking University Third Hospital between October, 2022 and October, 2024. Self-developed questionnaires were used to collect data on the perceived needs of teachers and students regarding CBL and teaching case library. Differences between CBL + teaching case library and traditional lecturing in student evaluations, classroom participation and interaction were compared using Student Evaluation of Teaching in Medical Lectures, Classroom Participation Scale and Flanders Interaction Analysis System. Semi-structured interviews were conducted to obtain evaluations and attitudes towards this method from both instructors and students' perspectives. ResultsThe survey showed that 91.4% of participating teachers and students supported the use of CBL in the courses, and 82.7% advocated that the teaching case library should include typical cases. Significant differences were observed in teaching preference between teachers and students (χ² = 17.597, P < 0.01). Application effects demonstrated that CBL+teaching library significantly outperformed traditional teaching methods in student previewing behaviors, classroom interaction and learning outcomes (|Z| ≥ 2.646, P < 0.01). Flanders Interaction Analysis indicated that CBL+teaching library was superior to traditional teaching in terms of students' motivation to speak and autonomous learning. Qualitative Research generated four positive themes including cultivating clinical reasoning, being close to clinical practice, deepening knowledge understanding and improving teaching quality; and three negative themes including increasing teaching burden, high software and hardware requirements and posing great challenges to students were generated. ConclusionCompared with traditional teaching methods, CBL combined with teaching case library is closely linked to clinical practice, facilitating students' clinical reasoning, enhancing teaching effectiveness and satisfaction, and therefore aligning with the goals and needs of continuing education for rehabilitation therapists, which is highly recognized by both instructors and students.
3.Design and application effect of continuing education case library combined with case-based learning for rehabilitation therapists
Liguo QIAN ; Tongxuan WU ; Qiaoyun ZHANG ; Jian XING ; Yanyan YANG
Chinese Journal of Rehabilitation Theory and Practice 2026;32(3):249-257
ObjectiveTo investigate the demand and the application outcomes of case-based learning (CBL) combined with teaching case library in continuing education courses for rehabilitation therapists. MethodsA convergent mixed-methods research design was adopted, involving 51 rehabilitation therapists and 31 instructors who participated in the advanced training program at the Department of Rehabilitation Medicine, Peking University Third Hospital between October, 2022 and October, 2024. Self-developed questionnaires were used to collect data on the perceived needs of teachers and students regarding CBL and teaching case library. Differences between CBL + teaching case library and traditional lecturing in student evaluations, classroom participation and interaction were compared using Student Evaluation of Teaching in Medical Lectures, Classroom Participation Scale and Flanders Interaction Analysis System. Semi-structured interviews were conducted to obtain evaluations and attitudes towards this method from both instructors and students' perspectives. ResultsThe survey showed that 91.4% of participating teachers and students supported the use of CBL in the courses, and 82.7% advocated that the teaching case library should include typical cases. Significant differences were observed in teaching preference between teachers and students (χ² = 17.597, P < 0.01). Application effects demonstrated that CBL+teaching library significantly outperformed traditional teaching methods in student previewing behaviors, classroom interaction and learning outcomes (|Z| ≥ 2.646, P < 0.01). Flanders Interaction Analysis indicated that CBL+teaching library was superior to traditional teaching in terms of students' motivation to speak and autonomous learning. Qualitative Research generated four positive themes including cultivating clinical reasoning, being close to clinical practice, deepening knowledge understanding and improving teaching quality; and three negative themes including increasing teaching burden, high software and hardware requirements and posing great challenges to students were generated. ConclusionCompared with traditional teaching methods, CBL combined with teaching case library is closely linked to clinical practice, facilitating students' clinical reasoning, enhancing teaching effectiveness and satisfaction, and therefore aligning with the goals and needs of continuing education for rehabilitation therapists, which is highly recognized by both instructors and students.
4.Analysis of clinical characteristics and etiologies of hospitalized patients with spike-and-wave activation in sleep
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Applied Clinical Pediatrics 2025;40(6):426-433
Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.
5.Research progress in retinal structural alterations in patients with mental disorders
Sijia WANG ; Yanyan WEI ; Zhenying QIAN ; Qingwei LI ; Jijun WANG
Journal of Shanghai Jiaotong University(Medical Science) 2025;45(2):247-252
Mental disorders frequently co-occur with other physical illnesses,becoming one of the leading causes of disability worldwide.Early diagnosis and intervention are crucial for the effective management of these disorders.Currently,biomarker studies on mental disorders predominantly concentrate on genes,blood indicators,and imaging features of the brain.There is a growing interest in objective phenotypic markers as a research focus.It is established that the retina is part of the central nervous system(CNS),which extends from the mesencephalon and develops concurrently with the brain during the embryonic period.Given the overlapping pathophysiological mechanisms between neurodegenerative diseases and mental disorders,studying the structural and functional changes in the inner layers of the retina has emerged as a new direction in mental health research.The advent of optical coherence tomography(OCT)has enabled microscopic imaging of retinal structures.OCT is capable of objectively quantifying the retinal sub-layers and offers the advantages of being non-invasive,non-contact,and high-resolution.The use of OCT to explore structural changes in the retina among individuals with schizophrenia,bipolar disorder,major depression and other psychiatric disorders has been well documented;however,there is a paucity of reviews on this topic.This review summarizes current research on retinal structural alterations in patients with mental disorders,and the results demonstrate reduced thickness in certain sub-layers of the retina structure in patients with several mental disorders,which supports that the retina structure has the potential to be a biomarker for mental disorders and offers a novel avenue for research in the diagnosis and treatment.
6.Exploring the Antidepressant Mechanisms of Citron and Bergamot Based on Network Pharmacology and BDNF/TrkB/CREB Signaling Pathways
Meiqing SONG ; Qian YANG ; Qiming ZHONG ; Yanyan NIU ; Liguo TONG ; Jianyue XING ; Mali FENG ; Lili JIA
World Science and Technology-Modernization of Traditional Chinese Medicine 2025;27(4):1136-1149
Objective Using network pharmacology research methods and animal pharmacology experiments,explore the mechanism of antidepressant effects of traditional Chinese medicine Citron and Bergamot.Methods Using the Traditional Chinese Medicine System Pharmacology Database and Analysis Platform(TCMSP),ETCM,Symmap,Swiss Target Prediction,and Uniprot data platforms,screen the active ingredients and corresponding gene targets of Citron and Bergamot.Obtain depression gene targets using OMIM,TTD,and Cenecards data platforms.Using Venny 2.1 online software,draw Venn diagrams of the intersection of active ingredients and gene targets.Draw network diagrams between drugs,active ingredients,targets,and diseases using Cytoscape 3.7.2 software.Construct a protein-protein interaction(PPI)network diagram using the STRING data platform for intersecting genes.Using the Metascape data platform,perform gene ontology(GO)function and Kyoto Encyclopedia of Genesand and Genomes(KEGG)pathway enrichment analysis.A rat depression model was established using chronic unpredictable mild stress(CUMS)combined with solitary care,and animal experiments were conducted to verify the BDNF/TrkB/CREB signaling pathway obtained from network pharmacology research.Results The research results of network pharmacology methods show that there are 57 antidepressant active ingredients in Citron,65 antidepressant active ingredients in Bergamot,and important active ingredients include Acetic acid,3,4,7-trimethoxycoumarin and Citric acid,etc.Through the data platform,2717 depression targets and 430 intersection targets were identified.Through PPI network analysis,key gene targets for antidepressant effects in Citron and Bergamot were identified,including TP53,Protein kinase B1,CREB-binding protein,Brain derived neurotrophic factor,etc.Through KEGG analysis,it was found that important signaling pathways include pathways in cancer,PI3K-Akt signaling pathway,Neurotrophin signaling pathway,etc.By observing the neurotrophic factor BDNF/TrkB/CREB signaling pathway in depressed rats,the results showed that the medium dose groups of Citron and Bergamot could significantly increase serum BDNF content(P<0.05),and each treatment group could improve the damage of hippocampal neurons in rats.The high and medium dose groups of Citron and Bergamot significantly increased the expression of BDNF protein in the hippocampal CA1 region(P<0.05,P<0.01).Except for the low-dose group,which showed no difference in TrkB mRNA gene expression,all other treatment groups significantly increased the mRNA gene expression levels of hippocampal BDNF,TrkB and CREB(P<0.01).The medium dose group of Citron and Bergamot increased the expression of BDNF protein in the hippocampus(P<0.01),while the medium and low dose groups significantly increased the relative expression of TrkB protein in the hippocampus(P<0.05).The medium dose group showed an increasing trend in the relative expression of CREB protein.Conclusion Traditional Chinese medicine Citron and Bergamot have therapeutic effects on depression models in rats,and the mechanism of action may be related to the BDNF/TrkB/CREB signaling pathway.
7.Two cases of developmental and epileptic encephalopathy related to the EEF1A2 gene and a literature review
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Neurology 2025;58(4):404-413
Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.
8.Long-term Impact of Newly Diagnosed Diabetes on the Incidence and Risk of Severe Microvascular Complications
Qier AN ; Jinping WANG ; Xinxing FENG ; Xin QIAN ; Shuhan ZHOU ; Siyao HE ; Hui LI ; Guangwei LI ; Yanyan CHEN
Chinese Circulation Journal 2025;40(6):571-576
Objectives:There is a lack of long-term follow-up study results on severe microvascular complications in a larger Chinese population with diabetes.This study aims to explore long-term impact of newly diagnosed diabetes(NDD)on the incidence and risk of severe microvascular complications.Methods:A total of 598 NDD and 493 normal glucose tolerance(NGT)subjects were included in this study in 1986.By questionnaire and systematic case review,the occurrence of severe microvascular complications,including severe diabetic retinopathy,severe diabetic nephropathy,and severe diabetic neuropathy,was followed up and collected over a period of 34 years.Results:The cumulative incidence of severe microvascular complications in the NDD population was 65.03%(95%CI:58.90%-70.48%)over 34 years,significantly higher than that in the NGT population(16.8%,95%CI:12.64%-20.11%).After adjusting for related risk factors,the risk of severe microvascular complications in the NDD population was 7.08 times than that of the NGT population(HR=7.08,95%CI:5.09-9.84,P<0.0001).Stratified analysis by sex showed that the cumulative incidence and risk of severe microvascular complications were slightly higher in male NDD population(68.02%,95%CI:57.27%-76.61%;HR=9.45,95%CI:5.78-15.47,P<0.0001)than in female NDD population(63.37%,95%CI:55.69%-70.09%;HR=5.86,95%CI:3.75-9.16,P<0.0001);however,the cumulative incidence increased more rapidly in women during the follow-up period of 10-25 years.Conclusions:The incidence and risk of severe microvascular complications in diabetes were significantly higher than those in the NGT population;and the incidence of severe vascular complications increased rapidly after the duration of diabetes exceeded 10 years,indicating that strict control of blood glucose in the early stage of diabetes is of vital importance.
9.Exploration on the Medication Law of Wang Xuefeng in the Treatment of Transient Tic Disorder in Children Based on Data Mining
Qian LIU ; Yanyan NI ; Wentao XU ; Xuefeng WANG
Chinese Journal of Information on Traditional Chinese Medicine 2025;32(9):54-60
Objective To investigate the medication law of Professor Wang Xuefeng in the treatment of transient tic disorders in children using data mining techniques;To clarify clinical thoughts and academic experience in the treatment of this disease.Methods The outpatient medical records of Professor Wang Xuefeng treated children with transient tic disorder in Affiliated Hospital of Liaoning University of Traditional Chinese Medicine from September 2021 to September 2024 were collected,and the prescriptions for patients'first visit were input after screening and sorting.Excel 2019 was used to establish the database.SPSS Modeler 18.0 was used to analyze the association rules of high-frequency drugs.SPSS Statistics 27.0 was used for clustering analysis.Gephi 0.10.1 was used for complex network analysis,and medication law was summarized.Results A total of 223 TCM prescriptions meeting the standard were included,involving 116 kinds of Chinese materia medica,with a total frequency of 3 668,and 30 high-frequency drugs were screened.The properties were mainly cold,neutral,and warm and the tastes were mainly pungent,bitter and sweet.The meridians were mainly liver,lung and heart meridians.The efficacy was mainly for suppressing hyperactive liver for calming endogenous wind,relieving surface and clearing heat;the results of association rules analysis showed that the drug combination with the highest correlation was Paeoniae Radix alba-Glycyrrhizae Radix et Rhizoma Praeparata cum Melle-Acori Tatarinowii Rhizoma;the high-frequency drugs were grouped into 9 categories by clustering analysis;a core drug combination consisting of 10 kinds of highly correlated Chinese materia medica was obtained by complex network analysis.Conclusion Professor Wang Xuefeng believes that transient tic disorders is mainly in the lung and liver,the etiology is due to the wind and phlegm,the pathogenesis is the external pathogens invading the lung,the pathogenic qi is reluctant to leave,the five viscera are disharmonious,the producing phlegm and turbid,the internal and external connection,the wind phlegm consolidation,the flowing meridians,thus causing twitching.It is necessary to take into account the whole process of disease development,with clear medication,fewer tastes,refined prescription and special efficacy.
10.Analysis of the association between age of onset with clinical features and long-term prognosis in patients with antineutrophil cytoplasmic antibody associated vasculitis
Xiujuan ZOU ; Qian ZHANG ; Yanyan WANG ; Rui LIU
Chinese Journal of Rheumatology 2025;29(11):923-929
Objective:To analyze the clinical features and long-term prognosis of ANCA-associated vasculitis (AAV) patients with different onset ages.Methods:A total of 243 patients diagnosed with AAV at the First Affiliated Hospital to Nanjing Medical University from May 2009 to January 2025 were retrospectively analyzed. The patients were divided into the elderly group (age≥60 years old) and middle-aged and young patient group (age<60 years old) according to the age of onset. The baseline clinical characteristics and long-term prognosis of the two groups were compared, and the risk factors for progression to end-stage renal disease (ESRD) in elderly AVV patients were analyzed. The clinical characteristics and long-term prognosis of the two groups of patients were compared. The measurement data were analyzed by t-test or rank sum test, and the count data were analyzed by chi-square test. The risk factors for the progression of ESRD in elderly patients with AAV were analyzed by binary multivariate logistic regression. Results:A total of 243 AAV patients were included, among which 174 cases were microscopic polyangiitis (MPA) and 69 cases were granulomatosis with polyangiitis (GPA). In 157 elderly patients, with 72 cases female, 84.1%(132 cases) had MPA. Compared with young and middle-aged patients, renal involvement is more common in elderly patients with AAV [(eldrly group 133 cases, 84.7%) vs. middle-aged and young patient group: 61 cases(70.9%), χ2=6.557, P=0.010]. The proportion of patients with hypertension, thrombosis, stroke, coronary heart disease, and COPD was higher compared to non-elder patients ( P<0.05). Elderly patients with AAV have higher levels of IgA and serum creatinine. Kaplan-Meier survival analysis showed that compared with young and middle-aged patients, elderly AAV patients had a higher all-cause mortality rate within 1 year after disease onset and a higher risk of progressing to ESRD within 1 year ( P<0.05), while the levels of IgM, C3, C4, albumin, and hemoglobin were lower ( P<0.05). 86 patients were middle-aged and young patients, with 54 cases were female and 51.2%(44 cases) had GPA. Ear, nose, and throat involvement was more common than elder patients[elderly group: 26 cases(16.2%) vs. middle-aged and young patient group: 31 cases(36.0%), χ2=10.864, P=0.001]. The median follow-up duration was 18 (7, 60) months. Kaplan-Meier survival analysis showed that compared with middle-aged and young patients, elderly AVV patients had a higher all-cause mortality rate within 1 year after disease onset and a higher risk of progression to ESRD within 1 year ( P<0.05). Multivariate logistic regression analysis revealed that baseline serum creatinine level [ OR(95% CI)=1.008(1.003, 1.012), P<0.001] was an independent risk factor for progression to ESRD in elderly patients. Conclusion:Elderly patients with AAV have more severe organ damage, higher all-cause mortality within one year, and a higher risk of progression to ESRD within one year after disease onset close monitoring of high-risk elderly patients should be strengthened.

Result Analysis
Print
Save
E-mail