Based on the high-fat diet-induced hyperlipidemia rat model, this study aimed to evaluate the lipid-lowering effect of Arisaema Cum Bile and explore its mechanisms, providing experimental evidence for its clinical application. Biochemical analysis was used to detect serum levels of alanine aminotransferase(ALT), aspartate aminotransferase(AST), high-density lipoprotein cholesterol(HDL-C), low-density lipoprotein cholesterol(LDL-C), triglycerides(TG), and total cholesterol(TC) to assess the lipid-lowering activity of Arisaema Cum Bile. Additionally, 16S rDNA sequencing and metabolomics techniques were employed to jointly elucidate the lipid-lowering mechanisms of Arisaema Cum Bile. The experimental results showed that high-dose Arisaema Cum Bile(PBA-H) significantly reduced serum ALT, AST, LDL-C, TG, and TC levels(P<0.01), and significantly increased HDL-C levels(P<0.01). The effect was similar to that of fenofibrate, with no significant difference. Furthermore, Arisaema Cum Bile significantly alleviated hepatocyte ballooning and mitigated fatty degeneration in liver tissues. As indicated by 16S rDNA sequencing results, PBA-H significantly enhanced both alpha and beta diversity of the gut microbiota in the model rats, notably increasing the relative abundance of Akkermansia and Subdoligranulum species(P<0.01). Liver metabolomics analysis revealed that PBA-H primarily regulated pathways involved in arachidonic acid metabolism, vitamin B_6 metabolism, and steroid biosynthesis. In summary, Arisaema Cum Bile significantly improved abnormal blood lipid levels and liver pathology induced by a high-fat diet, regulated hepatic metabolic disorders, and improved the abundance and structural composition of gut microbiota, thereby exerting its lipid-lowering effect. The findings of this study provide experimental evidence for the clinical application of Arisaema Cum Bile and the treatment of hyperlipidemia.
Animals ; Gastrointestinal Microbiome/drug effects* ; Rats ; Male ; Metabolomics ; Hyperlipidemias/microbiology* ; Drugs, Chinese Herbal/administration & dosage* ; Rats, Sprague-Dawley ; Hypolipidemic Agents/pharmacology* ; Liver/metabolism* ; Humans ; Alanine Transaminase/metabolism* ; Triglycerides/metabolism* ; Aspartate Aminotransferases/metabolism*

This study aims to systematically characterize the targeted effects of Quanduzhong Capsules on cartilage lesions in knee osteoarthritis by integrating spatial transcriptomics data mining and animal experiments validation, thereby elucidating the related molecular mechanisms. A knee osteoarthritis model was established using Sprague-Dawley(SD) rats, via a modified Hulth method. Hematoxylin and eosin(HE) staining was employed to detect knee osteoarthritis-associated pathological changes in knee cartilage. Candidate targets of Quanduzhong Capsules were collected from the HIT 2.0 database, followed by bioinformatics analysis of spatial transcriptomics datasets(GSE254844) from cartilage tissues in clinical knee osteoarthritis patients to identify spatially specific disease genes. Furthermore, a "formula candidate targets-spatially specific genes in cartilage lesions" interaction network was constructed to explore the effects and major mechanisms of Quanduzhong Capsules in distinct cartilage regions. Experimental validation was conducted through immunohistochemistry using animal-derived biospecimens. The results indicated that Quanduzhong Capsules effectively inhibited the degenerative changes in the cartilage of affected joints in rats, which was associated with the regulation of Quanduzhong Capsules on the thioredoxin-interacting protein(TXNIP)-NOD-like receptor family pyrin domain containing 3(NLRP3)-bone morphogenetic protein receptor type 2(BMPR2)-fibronectin 1(FN1)-matrix metallopeptidase 2(MMP2) signal axis in the articular cartilage surface and superficial zones, subsequently inhibiting cartilage matrix degradation leading to oxidative stress and inflammatory diffusion. In summary, this study clarifies the spatially specific targeted effects and protective mechanisms of Quanduzhong Capsules within pathological cartilage regions in knee osteoarthritis, providing theoretical and experimental support for the clinical application of this drug in the targeted therapy on the inflamed cartilage.
Animals ; Osteoarthritis, Knee/metabolism* ; Drugs, Chinese Herbal/administration & dosage* ; Rats, Sprague-Dawley ; Rats ; Male ; Humans ; Capsules ; Female ; Disease Models, Animal

OBJECTIVES: To report the development, validation, and findings of the Multi-dimensional Attention Rating Scale (MARS), a self-report tool crafted to evaluate six-dimension attention levels. METHODS: The MARS was developed based on Classical Test Theory (CTT). Totally 202 highly educated healthy adult participants were recruited for reliability and validity tests. Reliability was measured using Cronbach's alpha and test-retest reliability. Structural validity was explored using principal component analysis. Criterion validity was analyzed by correlating MARS scores with the Toronto Hospital Alertness Test (THAT), the Attentional Control Scale (ACS), and the Attention Network Test (ANT). RESULTS: The MARS comprises 12 items spanning six distinct dimensions of attention: focused attention, sustained attention, shifting attention, selective attention, divided attention, and response inhibition.As assessed by six experts, the content validation index (CVI) was 0.95, the Cronbach's alpha for the MARS was 0.78, and the test-retest reliability was 0.81. Four factors were identified (cumulative variance contribution rate 68.79%). The total score of MARS was correlated positively with THAT (r = 0.60, P < 0.01) and ACS (r = 0.78, P < 0.01) and negatively with ANT's reaction time for alerting (r = -0.31, P = 0.049). CONCLUSIONS The MARS can reliably and validly assess six-dimension attention levels in real-world settings and is expected to be a new tool for assessing multi-dimensional attention impairments in different mental disorders.
Humans ; Adult ; Male ; Attention/physiology* ; Female ; Middle Aged ; Reproducibility of Results ; Young Adult ; Psychometrics

OBJECTIVE: To investigate the clinical effect of minimally invasive technique in the treatment of moderate and severe gluteal muscle contracture. METHODS: A retrospective study was conducted on 85 patients (170 sides) with bilateral gluteal muscle contracture admitted from January 2016 to December 2019. All patients were treated with minimally invasive release of tendon knife. There were 32 males and 53 females, ranging in age from 15 to 37 years old, with an average age of (22.3±6.3) years old. Operation time, intraoperative blood loss, incision length, first postoperative ambulation time, complication rate, recurrence rate, and Harris hip score (HHS) were analyzed and evaluated. RESULTS: The average follow-up time was (16.2±4.6) months, ranging from 12 to 30 months. The operation time ranged from 7 to 15 min, with an average of (10.2±3.1) min. Intraoperative blood loss ranged from 2 to 20 ml, with an average of (8.4±2.2) ml. The incision length ranged from 0.6 to 2.0 cm, with an average of (0.8±0.3) cm. The time to postoperative ambulation ranged from 12 to 28 h, with an average of (20.0±3.2) h. All patients achieved primary wound healing without sciatic nerve injury or recurrence. HHS hip function scores ranged from 90 to 98, with an average score of (96.2±1.4). Complications included intraoperative tendon blade tip fracture in two cases (removed under fluoroscopic guidance) and subcutaneous hematoma in three cases-two resolved with compression and one with open evacuation.. Twenty-nine patients exhibited transient swaying gait postoperatively, of which 24 patients returned to normal after 4 weeks and 5 patients returned to normal after 6 weeks. CONCLUSION Minimally invasive tendon blade release is a safe and effective technique for treating gluteal muscle contracture, offering minimal trauma, rapid recovery, and excellent cosmetic and functional outcomes. However, it exhibits a low risk of blade tip fracture and sciatic nerve injury, warranting experienced surgical handling.
Humans ; Male ; Female ; Adult ; Minimally Invasive Surgical Procedures/methods* ; Adolescent ; Retrospective Studies ; Buttocks/surgery* ; Young Adult ; Contracture/surgery* ; Tendons/surgery* ; Muscle, Skeletal/surgery*

According to the World Health Organization (WHO) manual, sperm concentration should be measured using an improved Neubauer hemocytometer, while sperm motility should be measured by manual assessment. However, in China, thousands of laboratories do not use the improved Neubauer hemocytometer or method; instead, the Makler counting chamber is one of the most widely used chambers. To study sources of error that could impact the measurement of the apparent concentration and motility of sperm using the Makler counting chamber and to verify its accuracy for clinical application, 67 semen samples from patients attending the Department of Andrology, West China Second University Hospital, Sichuan University (Chengdu, China) between 13 September 2023 and 27 September 2023, were included. Compared with applying the cover glass immediately, delaying the application of the cover glass for 5 s, 10 s, and 30 s resulted in average increases in the sperm concentration of 30.3%, 74.1%, and 107.5%, respectively (all P < 0.0001) and in the progressive motility (PR) of 17.7%, 30.8%, and 39.6%, respectively (all P < 0.0001). However, when the semen specimens were fixed with formaldehyde, a delay in the application of the cover glass for 5 s, 10 s, and 30 s resulted in an average increase in the sperm concentration of 6.7%, 10.8%, and 14.6%, respectively, compared with immediate application of the cover glass. The accumulation of motile sperm due to delays in the application of the cover glass is a significant source of error with the Makler counting chamber and should be avoided.
Humans ; Male ; Sperm Motility/physiology* ; Sperm Count ; Semen Analysis/methods* ; Spermatozoa/physiology* ; Time Factors

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

To guide clinical blood transfusion practices for pediatric patients, the National Health Commission has issued the health standard "Guideline for pediatric transfusion" (WS/T 795-2022). Blood transfusion is one of the most commonly used supportive treatments for children with hematological diseases. This guideline provides guidance and recommendations for blood transfusions in children with aplastic anemia, thalassemia, autoimmune hemolytic anemia, glucose-6-phosphate dehydrogenase deficiency, acute leukemia, myelodysplastic syndromes, immune thrombocytopenic purpura, and thrombotic thrombocytopenic purpura. This article presents the evidence and interpretation of the blood transfusion provisions for children with hematological diseases in the "Guideline for pediatric transfusion", aiming to assist in the understanding and implementing the blood transfusion section of this guideline.
Humans ; Child ; Hematologic Diseases/therapy* ; Blood Transfusion/standards* ; Practice Guidelines as Topic

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

To guide clinical blood transfusion practices for pediatric patients, the National Health Commission has issued the health standard "Guideline for pediatric transfusion" (WS/T 795-2022). Blood transfusion for children undergoing hematopoietic stem cell transplantation is highly complex and challenging. This guideline provides recommendations on transfusion thresholds and the selection of blood components for these children. This article presents the evidence and interpretation of the transfusion provisions for children undergoing hematopoietic stem cell transplantation, with the aim of enhancing the understanding and implementation of the "Guideline for pediatric transfusion".
Humans ; Hematopoietic Stem Cell Transplantation ; Child ; Blood Transfusion/standards* ; Practice Guidelines as Topic