Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Objective To explore the spatiotemporal expression patterns of Patched 1(Ptch1)and insulin enhancer binding protein-1(Isl 1)in mouse embryonic foregut and their relationship with the early development of trachea-main bronchus.Methods The foregut of 60 mouse embryos at E9.5-12.5 was separated for the detection of Isl1 and sonic hedgehog(Shh)protein by Western blotting.Serial paraffin sections of 6 mouse embryos at E9.5-14.5 were taken for immunohistochemical staining and immunofluorescence double staining with Isl1,Ptch1,forkhead box protein A2(Foxa2),type Ⅱ collagen α1 chain(Col2a1)and α-smooth muscle actin(α-SMA),as well as HE staining and Masson staining.Results The expression trend of Isl1 and Shh in foregut endoderm at E9.5-12.5 was similar,and the peak of Shh expression was later than Isl1.The foregut developed into the trachea at E9.5-12.5,Ptch1 was expressed in the thickening and protrusion of the respiratory endoderm,the laryngal-tracheal groove and the solid cell cord,accompanied by the increase and aggregation of Isl1-positive mesenchymal cells,forming a characteristic pyramidal structure centered on the respiratory endoderm and the solid cell cord;The main bronchus appeared at E12.5-13.5,Ptch1 was only expressed in its lateral wall,accompanied by the accumulation of Isl1-positive mesenchymal cells;The trachea-main bronchial epithelium lost Ptch1 expression and the surrounding Isl 1-positive mesenchymal cells also decreased rapidly at E13.5-14.5.Co12a1-positive chondrocytes first appeared in the Isl1-positive mesenchymal area adjacent to the Ptch1-positive epithelium at E12.5;Col2a1-positive cartilage was nested within the Isl1-positive mesenchymic area in a"C"shape and expanded in a proximal-distal pattern at E12.5-13.5;Col2a1-positive cartilage extended to the dorsal trachea beyond the Isl1-positive mesenchyma and encircles α-SMA positive smooth muscle in a circular manner at E14.5.Conclusion The expression of Ptch1 in the foregut endoderm is involved in the development and morphogenesis of the trachea-main bronchus epithelium,and is closely related to the proliferation and aggregation of Isl1-positive mesenchyme in the trachea-main bronchial wall,Subsequently,they jointly determine the time,location and extent of airway cartilage.

Objective To develop the application technology of finger length ratios in the selection of Muay Thai athletes,and to provide practical guidance for improving the competitive level of Muay Thai.Methods By using the method of snowball sampling and simple random sampling,413 subjects were selected in Bangkok,Thailand,including 84 male Muay Thai professional players,62 female Muay Thai professional players,137 ordinary male college students and 130 female college students.The finger length of the subjects was measured and their finger length ratios was calculated.SPSS 20.0 statistical software was used for discriminant analysis.Results The 2D∶3D,2D∶4D,2D∶5D,3D∶4D and 3D∶5D of male Muay Thai professional players were significantly lower than that in the general male Thai population,and the 2D∶4D,3D∶4D and 3D∶5D of female Muay Thai players were significantly lower than that in the general female Thai population,and the above differences were statistically significant(P＜0.05).Discriminant functions developed using both the full model and stepwise method were statistically significant,demonstrating high accuracy and stability.The correct discrimination rates were higher in the male population than that in the female population.When distinguishing between Muay Thai professional fighters and the general Thai population,the optimal 2D∶4D threshold for males is 0.951,and for females,it was 0.960.Conclusion The discriminant model of Muay Thai professional players and ordinary people based on the ratios of finger length can provide important reference for the selection of Muay Thai athletes.

Facing of mounting resource constraints and rising demands for personalization in medical education,regional anatomy teaching urgently requires transformation.In this paper,we focus on the regional anatomy of the thoracic wall,in order to explore a novel AI-driven teaching paradigm.Anchored in the core principle of"virtual-real integration with cadaveric dissection as the cornerstone,"the paradigm redefines educational objective and constructs an intelligent,closed-loop teaching model integrating students,computers,and instructors.Leveraging the robust support of digital intelligence(e.g.,DeepSeek),this paradigm incorporates interactive method including group collaboration,branching instruction,and gamified assessments.It achieves a comprehensive intelligent transformation of the entire teaching process-from goal setting and plan customization to activity implementation,task completion,outcome exchange,multidimensional evaluation,and reflective iteration.This new paradigm centers on medical students and leverages digital intelligence to activate deep personalized learning potential.It seamlessly integrates fundamental anatomical knowledge with clinical scenarios(e.g.,key anatomy in breast cancer surgery,flap design in breast reconstruction),and significantly enhances clinical decision-making abilities,scientific research and innovative thinking,as well as medical humanistic literacy,paving a new path for intelligent medical education.

This study aimed to characterize and identify the non-volatile components in aqueous and ethanolic extracts of the stems and leaves of Rhododendron tomentosum by using sensitive and efficient ultra-performance liquid chromatography-quadrupole-time of flight mass spectrometry(UHPLC-Q-TOF-MS) combined with a self-built information database. By comparing with reference compounds, analyzing fragment ion information, searching relevant literature, and using a self-built information database, 118 compounds were identified from the aqueous and ethanolic extracts of R. tomentosum, including 35 flavonoid glycosides, 15 phenolic glycosides, 12 flavonoids, 7 phenolic acids, 7 phenylethanol glycosides, 6 tannins, 6 phospholipids, 5 coumarins, 5 monoterpene glycosides, 6 triterpenes, 3 fatty acids, and 11 other types of compounds. Among them, 102 compounds were reported in R. tomentosum for the first time, and 36 compounds were identified by comparing them with reference compounds. The chemical components in the ethanolic and aqueous extracts of R. tomentosum leaves and stems showed slight differences, with 84 common chemical components accounting for 71.2% of the total 118 compounds. This study systematically characterized and identified the non-volatile chemical components in the ethanolic and aqueous extracts of R. tomentosum for the first time. The findings provide a reference for active ingredient research, quality control, and product development of R. tomentosum.
Rhododendron/chemistry* ; Chromatography, High Pressure Liquid/methods* ; Drugs, Chinese Herbal/chemistry* ; Mass Spectrometry/methods* ; Plant Leaves/chemistry*

Hepatocellular carcinoma(HCC), the third leading cause of cancer-related death worldwide, is characterized by high mortality and recurrence rates. Common treatments include hepatectomy, liver transplantation, ablation therapy, interventional therapy, radiotherapy, systemic therapy, and traditional Chinese medicine(TCM). While exhibiting specific advantages, these approaches are associated with varying degrees of adverse effects. To alleviate patients' suffering and burdens, it is crucial to explore additional treatments and elucidate the pathogenesis of HCC, laying a foundation for the development of new TCM-based drugs. With emerging research on gut microbiota, it has been revealed that microbiota plays a vital role in the development of HCC by influencing intestinal barrier function, microbial metabolites, and immune regulation. TCM, with its multi-component, multi-target, and multi-pathway characteristics, has been increasingly recognized as a vital therapeutic treatment for HCC, particularly in patients at intermediate or advanced stages, by prolonging survival and improving quality of life. Recent global studies demonstrate that TCM exerts anti-HCC effects by modulating gut microbiota, restoring intestinal barrier function, regulating microbial composition and its metabolites, suppressing inflammation, and enhancing immune responses, thereby inhibiting the malignant phenotype of HCC. This review aims to elucidate the mechanisms by which gut microbiota contributes to the development and progression of HCC and highlight the regulatory effects of TCM, addressing the current gap in systematic understanding of the "TCM-gut microbiota-HCC" axis. The findings provide theoretical support for integrating TCM with western medicine in HCC treatment and promote the transition from basic research to precision clinical therapy through microbiota-targeted drug development and TCM-based interventions.
Humans ; Gastrointestinal Microbiome/drug effects* ; Carcinoma, Hepatocellular/microbiology* ; Liver Neoplasms/microbiology* ; Drugs, Chinese Herbal/administration & dosage* ; Animals ; Medicine, Chinese Traditional