Functional dyspepsia (FD), characterized by persistent or recurrent dyspeptic symptoms without identifiable organic, systemic or metabolic causes, is an increasingly recognized global health issue. The objective of this guideline is to equip clinicians and nursing professionals with evidence-based strategies for the management and treatment of adult patients with FD using traditional Chinese medicine (TCM). The Guideline Development Group consulted existing TCM consensus documents on FD and convened a panel of 35 clinicians to generate initial clinical queries. To address these queries, a systematic literature search was conducted across PubMed, EMBASE, the Cochrane Library, China National Knowledge Infrastructure (CNKI), VIP Database, China Biology Medicine (SinoMed) Database, Wanfang Database, Traditional Medicine Research Data Expanded (TMRDE), and the Traditional Chinese Medical Literature Analysis and Retrieval System (TCMLARS). The evidence from the literature was critically appraised using the Grading of Recommendations Assessment, Development, and Evaluation (GRADE) approach. The strength of the recommendations was ascertained through a consensus-building process involving TCM and allopathic medicine experts, methodologists, pharmacologists, nursing specialists, and health economists, leveraging their collective expertise and empirical knowledge. The guideline comprises a total of 43 evidence-informed recommendations that span a range of clinical aspects, including the pathogenesis according to TCM, diagnostic approaches, therapeutic interventions, efficacy assessments, and prognostic considerations. Please cite this article as: Zhang SS, Zhao LQ, Hou XH, Bian ZX, Zheng JH, Tian HH, Yang GH, Hong WS, He YY, Liu L, Shen H, Li YP, Xie S, Shu J, Zeng BF, Li JX, Liu Z, Xiao ZH, Xiao JD, Zheng PY, Huang SG, Chen SL, Fei GJ. International clinical practice guideline on the use of traditional Chinese medicine for functional dyspepsia (2025). J Integr Med. 2025; 23(5):502-518.
Dyspepsia/drug therapy* ; Humans ; Medicine, Chinese Traditional/methods* ; Practice Guidelines as Topic ; Drugs, Chinese Herbal/therapeutic use*

This study investigates the pharmacokinetics and metabolic characteristics of three marine-derived piericidins as potential drug leads for kidney disease: piericidin A (PA) and its two glycosides (GPAs), glucopiericidin A (GPA) and 13-hydroxyglucopiericidin A (13-OH-GPA). The research aims to facilitate lead selection and optimization for developing a viable preclinical candidate. Rapid absorption of PA and GPAs in mice was observed, characterized by short half-lives and low bioavailability. Glycosides and hydroxyl groups significantly enhanced the absorption rate (13-OH-GPA > GPA > PA). PA and GPAs exhibited metabolic instability in liver microsomes due to Cytochrome P450 enzymes (CYPs) and uridine diphosphoglucuronosyl transferases (UGTs). Glucuronidation emerged as the primary metabolic pathway, with UGT1A7, UGT1A8, UGT1A9, and UGT1A10 demonstrating high elimination rates (30%-70%) for PA and GPAs. This rapid glucuronidation may contribute to the low bioavailability of GPAs. Despite its low bioavailability (2.69%), 13-OH-GPA showed higher kidney distribution (19.8%) compared to PA (10.0%) and GPA (7.3%), suggesting enhanced biological efficacy in kidney diseases. Modifying the C-13 hydroxyl group appears to be a promising approach to improve bioavailability. In conclusion, this study provides valuable metabolic insights for the development and optimization of marine-derived piericidins as potential drug leads for kidney disease.
Animals ; Male ; Mice ; Aquatic Organisms/chemistry* ; Biological Availability ; Cytochrome P-450 Enzyme System/metabolism* ; Glucuronosyltransferase/metabolism* ; Microsomes, Liver/metabolism* ; Molecular Structure ; Biological Products/pharmacokinetics* ; Pyridines/pharmacokinetics*

Sarin(GB)is a typical representative of nerve agents with high toxicity,and very low amount can cause death.GB can cause water and atmospheric environment poisoning,so the detection of GB in water and air is of great significance.In this work,a colorimetric sensor array(CSA)based on GB inhibition of cholinesterase activity was constructed to detect GB with high selectivity.A 4×4 colorimetric array was constructed using acetylcholinesterase(AChE),butyryl cholinesterase(BuChE)and the corresponding substrate acetylthiocholine iodide(S-ACh),butyryl thiocholine iodide(S-BCh),acetylcholine chloride(ACh),butyryl choline chloride(BCh)and 2,6-dichloroindophenol ethyl ester(DCIE).The linear curve of the sensor was Y=131.3×lgC+271.6(R2=0.997),where Y was the array response Euclidean distance,C was the concentration of GB(mg/L),the linear range was 0.03?0.32 mg/L,and the detection limit was 27.6 μg/L.The method could effectively distinguish chemical warfare agents(CWA)such as VX,Soman(GD),mustard gas(HD),Louie reagent(L),and had high anti-interference ability,sensitivity and good repeatability.It was successfully applied to the detection of GB in simulated water and simulated air samples,and the sample recovery rate was 97.2% ?100.9%.This method would be potentially applied to the field rapid detection of nerve agents.

A pyrene-phenol-based fluorescent probe PyP which showed typical intramolecular charge transfer(ICT)and monomer-excimer activities was synthesized by using pyrene carboxaldehyde hydrazone and 4-tert-butyl-2,6-diformylphenol as the raw materials.The effects of solvents on PyP were studied,and the results showed that the color of protic polar solvents(Ethanol,N,N-dimethylformamide,methanol and H2O)were successfully identified.Based on the solvent polarity-regulated PyP monomer-excimer switching,the rapid and highly sensitive ratiometric probe,"Turn-off"and"Turn-on"multimodal probes were established for detection of trace water content in organic solvents(Dimethyl sulfoxide,N,N-dimethylformamide,ethanol and methanol),with detection limits(3σ/k)of 0.0021％,0.046％,0.062％and 0.024％.The method was successfully used to detect water content in dimethyl sulfoxide,N,N-dimethy lformamide,ethanol and methanol commercial organic solvents,with recoveries ranging from 97.2％to 108.0％.The developed method showed good accuracy and stability,and had good application prospect.

The objective assessment of hearing loss is one of the critical components in forensic clini-cal research.Auditory brainstem response(ABR)is an important method for objectively assessing hearing levels.It is divided into various types based on different stimulus signals,each with its own characteris-tics and applications.Among them,narrow-band Chirp ABR,due to its frequency specificity,fulfills the basic requirements for objective assessment of forensic audiology,promising to be an important method of objective hearing assessment in forensic medicine.This article reviews the development history,charac-teristics and clinical applications of Chirp ABR,and envisions its application prospects in forensic audi-tory identification.

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

This study aimed to characterize and identify the non-volatile components in aqueous and ethanolic extracts of the stems and leaves of Rhododendron tomentosum by using sensitive and efficient ultra-performance liquid chromatography-quadrupole-time of flight mass spectrometry(UHPLC-Q-TOF-MS) combined with a self-built information database. By comparing with reference compounds, analyzing fragment ion information, searching relevant literature, and using a self-built information database, 118 compounds were identified from the aqueous and ethanolic extracts of R. tomentosum, including 35 flavonoid glycosides, 15 phenolic glycosides, 12 flavonoids, 7 phenolic acids, 7 phenylethanol glycosides, 6 tannins, 6 phospholipids, 5 coumarins, 5 monoterpene glycosides, 6 triterpenes, 3 fatty acids, and 11 other types of compounds. Among them, 102 compounds were reported in R. tomentosum for the first time, and 36 compounds were identified by comparing them with reference compounds. The chemical components in the ethanolic and aqueous extracts of R. tomentosum leaves and stems showed slight differences, with 84 common chemical components accounting for 71.2% of the total 118 compounds. This study systematically characterized and identified the non-volatile chemical components in the ethanolic and aqueous extracts of R. tomentosum for the first time. The findings provide a reference for active ingredient research, quality control, and product development of R. tomentosum.
Rhododendron/chemistry* ; Chromatography, High Pressure Liquid/methods* ; Drugs, Chinese Herbal/chemistry* ; Mass Spectrometry/methods* ; Plant Leaves/chemistry*

Hepatocellular carcinoma(HCC), the third leading cause of cancer-related death worldwide, is characterized by high mortality and recurrence rates. Common treatments include hepatectomy, liver transplantation, ablation therapy, interventional therapy, radiotherapy, systemic therapy, and traditional Chinese medicine(TCM). While exhibiting specific advantages, these approaches are associated with varying degrees of adverse effects. To alleviate patients' suffering and burdens, it is crucial to explore additional treatments and elucidate the pathogenesis of HCC, laying a foundation for the development of new TCM-based drugs. With emerging research on gut microbiota, it has been revealed that microbiota plays a vital role in the development of HCC by influencing intestinal barrier function, microbial metabolites, and immune regulation. TCM, with its multi-component, multi-target, and multi-pathway characteristics, has been increasingly recognized as a vital therapeutic treatment for HCC, particularly in patients at intermediate or advanced stages, by prolonging survival and improving quality of life. Recent global studies demonstrate that TCM exerts anti-HCC effects by modulating gut microbiota, restoring intestinal barrier function, regulating microbial composition and its metabolites, suppressing inflammation, and enhancing immune responses, thereby inhibiting the malignant phenotype of HCC. This review aims to elucidate the mechanisms by which gut microbiota contributes to the development and progression of HCC and highlight the regulatory effects of TCM, addressing the current gap in systematic understanding of the "TCM-gut microbiota-HCC" axis. The findings provide theoretical support for integrating TCM with western medicine in HCC treatment and promote the transition from basic research to precision clinical therapy through microbiota-targeted drug development and TCM-based interventions.
Humans ; Gastrointestinal Microbiome/drug effects* ; Carcinoma, Hepatocellular/microbiology* ; Liver Neoplasms/microbiology* ; Drugs, Chinese Herbal/administration & dosage* ; Animals ; Medicine, Chinese Traditional

Based on serum metabolomics and gut microbiota technology, this study explores the effects and mechanisms of the water extract of Ziziphi Spinosae Semen(SZRW) and the petroleum ether extract of Ziziphi Spinosae Semen(SZRO) in improving depressive-like behaviors induced by sleep deprivation. A modified multi-platform water environment method was employed to establish a rat model of sleep deprivation. Depressive-like behaviors in rats were assessed through the sucrose preference test and forced swim test. The expression of barrier proteins, such as Occludin, in the colon was determined by immunofluorescence. UPLC-Q-Orbitrap MS was utilized to analyze the serum metabolic profiles of sleep-deprived rats, screen for differential metabolites, and analyze metabolic pathways. The diversity of the gut microbiota was detected using 16S rRNA gene sequencing. Spearman correlation coefficient analysis was conducted to assess the correlation between differential metabolites and gut microbiota. The results indicated that SZRO significantly increased the sucrose preference index and decreased the immobility time in the forced swim test in rats. A total of 34 differential metabolites were identified through serum metabolomics. SZRW and SZRO shared five metabolic pathways, including phenylalanine metabolism. SZRW uniquely featured taurine and hypotaurine metabolism, while SZRO uniquely featured linoleic acid metabolism and tyrosine metabolism. Correlation analysis revealed that SZRW could upregulate the abundance of Bilophila, promoting the production of indole-3-propionic acid and subsequently upregulating the expression levels of intestinal tight junction proteins such as ZO-1, Occludin, and Claudin-1. SZRO could indirectly influence metabolic pathways such as arginine metabolism and linoleic acid metabolism by upregulating the abundance of gut microbiota such as Coprococcus and Eubacterium species. Both SZRW and SZRO can regulate endogenous metabolism, including amino acids, energy, and lipids, alter the gut microbiota microecology, and improve depressive-like behaviors. SZRO demonstrated superior effects in regulating metabolic pathways and gut microbiota structure compared to SZRW. The findings of this study provide a scientific basis for elucidating the pharmacodynamic material basis of Ziziphi Spinosae Semen.
Animals ; Rats ; Gastrointestinal Microbiome/drug effects* ; Male ; Metabolomics ; Drugs, Chinese Herbal/administration & dosage* ; Depression/blood* ; Rats, Sprague-Dawley ; Sleep Deprivation/complications* ; Ziziphus/chemistry* ; Antidepressive Agents/administration & dosage* ; Behavior, Animal/drug effects* ; Humans