1.Rapid characterization and identification of non-volatile components in Rhododendron tomentosum by UHPLC-Q-TOF-MS method.
Su-Ping XIAO ; Long-Mei LI ; Bin XIE ; Hong LIANG ; Qiong YIN ; Jian-Hui LI ; Jie DU ; Ji-Yong WANG ; Run-Huai ZHAO ; Yan-Qin XU ; Yun-Bo SUN ; Zong-Yuan LU ; Peng-Fei TU
China Journal of Chinese Materia Medica 2025;50(11):3054-3069
This study aimed to characterize and identify the non-volatile components in aqueous and ethanolic extracts of the stems and leaves of Rhododendron tomentosum by using sensitive and efficient ultra-performance liquid chromatography-quadrupole-time of flight mass spectrometry(UHPLC-Q-TOF-MS) combined with a self-built information database. By comparing with reference compounds, analyzing fragment ion information, searching relevant literature, and using a self-built information database, 118 compounds were identified from the aqueous and ethanolic extracts of R. tomentosum, including 35 flavonoid glycosides, 15 phenolic glycosides, 12 flavonoids, 7 phenolic acids, 7 phenylethanol glycosides, 6 tannins, 6 phospholipids, 5 coumarins, 5 monoterpene glycosides, 6 triterpenes, 3 fatty acids, and 11 other types of compounds. Among them, 102 compounds were reported in R. tomentosum for the first time, and 36 compounds were identified by comparing them with reference compounds. The chemical components in the ethanolic and aqueous extracts of R. tomentosum leaves and stems showed slight differences, with 84 common chemical components accounting for 71.2% of the total 118 compounds. This study systematically characterized and identified the non-volatile chemical components in the ethanolic and aqueous extracts of R. tomentosum for the first time. The findings provide a reference for active ingredient research, quality control, and product development of R. tomentosum.
Rhododendron/chemistry*
;
Chromatography, High Pressure Liquid/methods*
;
Drugs, Chinese Herbal/chemistry*
;
Mass Spectrometry/methods*
;
Plant Leaves/chemistry*
2.Research progress on prevention and treatment of hepatocellular carcinoma with traditional Chinese medicine based on gut microbiota.
Rui REN ; Xing YANG ; Ping-Ping REN ; Qian BI ; Bing-Zhao DU ; Qing-Yan ZHANG ; Xue-Han WANG ; Zhong-Qi JIANG ; Jin-Xiao LIANG ; Ming-Yi SHAO
China Journal of Chinese Materia Medica 2025;50(15):4190-4200
Hepatocellular carcinoma(HCC), the third leading cause of cancer-related death worldwide, is characterized by high mortality and recurrence rates. Common treatments include hepatectomy, liver transplantation, ablation therapy, interventional therapy, radiotherapy, systemic therapy, and traditional Chinese medicine(TCM). While exhibiting specific advantages, these approaches are associated with varying degrees of adverse effects. To alleviate patients' suffering and burdens, it is crucial to explore additional treatments and elucidate the pathogenesis of HCC, laying a foundation for the development of new TCM-based drugs. With emerging research on gut microbiota, it has been revealed that microbiota plays a vital role in the development of HCC by influencing intestinal barrier function, microbial metabolites, and immune regulation. TCM, with its multi-component, multi-target, and multi-pathway characteristics, has been increasingly recognized as a vital therapeutic treatment for HCC, particularly in patients at intermediate or advanced stages, by prolonging survival and improving quality of life. Recent global studies demonstrate that TCM exerts anti-HCC effects by modulating gut microbiota, restoring intestinal barrier function, regulating microbial composition and its metabolites, suppressing inflammation, and enhancing immune responses, thereby inhibiting the malignant phenotype of HCC. This review aims to elucidate the mechanisms by which gut microbiota contributes to the development and progression of HCC and highlight the regulatory effects of TCM, addressing the current gap in systematic understanding of the "TCM-gut microbiota-HCC" axis. The findings provide theoretical support for integrating TCM with western medicine in HCC treatment and promote the transition from basic research to precision clinical therapy through microbiota-targeted drug development and TCM-based interventions.
Humans
;
Gastrointestinal Microbiome/drug effects*
;
Carcinoma, Hepatocellular/microbiology*
;
Liver Neoplasms/microbiology*
;
Drugs, Chinese Herbal/administration & dosage*
;
Animals
;
Medicine, Chinese Traditional
3.Antidepressant effects of Ziziphi Spinosae Semen extract on depressive-like behaviors in sleep deprivation rats based on integrated serum metabolomics and gut microbiota.
Liang-Lei SONG ; Ya-Yu SUN ; Ze-Jia NIU ; Jia-Ying LIU ; Xiang-Ping PEI ; Yan YAN ; Chen-Hui DU
China Journal of Chinese Materia Medica 2025;50(16):4510-4524
Based on serum metabolomics and gut microbiota technology, this study explores the effects and mechanisms of the water extract of Ziziphi Spinosae Semen(SZRW) and the petroleum ether extract of Ziziphi Spinosae Semen(SZRO) in improving depressive-like behaviors induced by sleep deprivation. A modified multi-platform water environment method was employed to establish a rat model of sleep deprivation. Depressive-like behaviors in rats were assessed through the sucrose preference test and forced swim test. The expression of barrier proteins, such as Occludin, in the colon was determined by immunofluorescence. UPLC-Q-Orbitrap MS was utilized to analyze the serum metabolic profiles of sleep-deprived rats, screen for differential metabolites, and analyze metabolic pathways. The diversity of the gut microbiota was detected using 16S rRNA gene sequencing. Spearman correlation coefficient analysis was conducted to assess the correlation between differential metabolites and gut microbiota. The results indicated that SZRO significantly increased the sucrose preference index and decreased the immobility time in the forced swim test in rats. A total of 34 differential metabolites were identified through serum metabolomics. SZRW and SZRO shared five metabolic pathways, including phenylalanine metabolism. SZRW uniquely featured taurine and hypotaurine metabolism, while SZRO uniquely featured linoleic acid metabolism and tyrosine metabolism. Correlation analysis revealed that SZRW could upregulate the abundance of Bilophila, promoting the production of indole-3-propionic acid and subsequently upregulating the expression levels of intestinal tight junction proteins such as ZO-1, Occludin, and Claudin-1. SZRO could indirectly influence metabolic pathways such as arginine metabolism and linoleic acid metabolism by upregulating the abundance of gut microbiota such as Coprococcus and Eubacterium species. Both SZRW and SZRO can regulate endogenous metabolism, including amino acids, energy, and lipids, alter the gut microbiota microecology, and improve depressive-like behaviors. SZRO demonstrated superior effects in regulating metabolic pathways and gut microbiota structure compared to SZRW. The findings of this study provide a scientific basis for elucidating the pharmacodynamic material basis of Ziziphi Spinosae Semen.
Animals
;
Rats
;
Gastrointestinal Microbiome/drug effects*
;
Male
;
Metabolomics
;
Drugs, Chinese Herbal/administration & dosage*
;
Depression/blood*
;
Rats, Sprague-Dawley
;
Sleep Deprivation/complications*
;
Ziziphus/chemistry*
;
Antidepressive Agents/administration & dosage*
;
Behavior, Animal/drug effects*
;
Humans
4.An assessment model for efficacy of autologous CD19 chimeric antigen receptor T-cell therapy and relapse or refractory diffuse large B-cell lymphoma risk.
Bin XUE ; Yifan LIU ; Min ZHANG ; Gangfeng XIAO ; Xiu LUO ; Lili ZHOU ; Shiguang YE ; Yan LU ; Wenbin QIAN ; Li WANG ; Ping LI ; Aibin LIANG
Chinese Medical Journal 2025;138(1):108-110
5.Correlation of IGF2 levels with sperm quality, inflammation, and DNA damage in infertile patients.
Jing-Gen WU ; Cai-Ping ZHOU ; Wei-Wei GUI ; Zhong-Yan LIANG ; Feng-Bin ZHANG ; Ying-Ge FU ; Rui LI ; Fang WU ; Xi-Hua LIN
Asian Journal of Andrology 2025;27(2):204-210
Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans
;
Male
;
Insulin-Like Growth Factor II/metabolism*
;
Infertility, Male/genetics*
;
DNA Damage
;
Adult
;
Inflammation/metabolism*
;
Spermatozoa/metabolism*
;
Semen Analysis
;
Semen/metabolism*
;
Tumor Necrosis Factor-alpha/metabolism*
;
Histones/metabolism*
;
Interleukin-1beta/metabolism*
6.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
7.Nonsurgical Treatment of Chronic Subdural Hematoma Patients with Chinese Medicine: Case Report Series.
Kang-Ning LI ; Wei-Ming LIU ; Ying-Zhi HOU ; Run-Fa TIAN ; Shuo ZHANG ; Liang WU ; Long XU ; Jia-Ji QIU ; Yan-Ping TONG ; Tao YANG ; Yong-Ping FAN
Chinese journal of integrative medicine 2025;31(10):937-941
8.The application of surgical robots in head and neck tumors.
Xiaoming HUANG ; Qingqing HE ; Dan WANG ; Jiqi YAN ; Yu WANG ; Xuekui LIU ; Chuanming ZHENG ; Yan XU ; Yanxia BAI ; Chao LI ; Ronghao SUN ; Xudong WANG ; Mingliang XIANG ; Yan WANG ; Xiang LU ; Lei TAO ; Ming SONG ; Qinlong LIANG ; Xiaomeng ZHANG ; Yuan HU ; Renhui CHEN ; Zhaohui LIU ; Faya LIANG ; Ping HAN
Journal of Clinical Otorhinolaryngology Head and Neck Surgery 2025;39(11):1001-1008
9.Psychological stress-activated NR3C1/NUPR1 axis promotes ovarian tumor metastasis.
Bin LIU ; Wen-Zhe DENG ; Wen-Hua HU ; Rong-Xi LU ; Qing-Yu ZHANG ; Chen-Feng GAO ; Xiao-Jie HUANG ; Wei-Guo LIAO ; Jin GAO ; Yang LIU ; Hiroshi KURIHARA ; Yi-Fang LI ; Xu-Hui ZHANG ; Yan-Ping WU ; Lei LIANG ; Rong-Rong HE
Acta Pharmaceutica Sinica B 2025;15(6):3149-3162
Ovarian tumor (OT) is the most lethal form of gynecologic malignancy, with minimal improvements in patient outcomes over the past several decades. Metastasis is the leading cause of ovarian cancer-related deaths, yet the underlying mechanisms remain poorly understood. Psychological stress is known to activate the glucocorticoid receptor (NR3C1), a factor associated with poor prognosis in OT patients. However, the precise mechanisms linking NR3C1 signaling and metastasis have yet to be fully elucidated. In this study, we demonstrate that chronic restraint stress accelerates epithelial-mesenchymal transition (EMT) and metastasis in OT through an NR3C1-dependent mechanism involving nuclear protein 1 (NUPR1). Mechanistically, NR3C1 directly regulates the transcription of NUPR1, which in turn increases the expression of snail family transcriptional repressor 2 (SNAI2), a key driver of EMT. Clinically, elevated NR3C1 positively correlates with NUPR1 expression in OT patients, and both are positively associated with poorer prognosis. Overall, our study identified the NR3C1/NUPR1 axis as a critical regulatory pathway in psychological stress-induced OT metastasis, suggesting a potential therapeutic target for intervention in OT metastasis.
10.International clinical practice guideline on the use of traditional Chinese medicine for functional dyspepsia (2025).
Sheng-Sheng ZHANG ; Lu-Qing ZHAO ; Xiao-Hua HOU ; Zhao-Xiang BIAN ; Jian-Hua ZHENG ; Hai-He TIAN ; Guan-Hu YANG ; Won-Sook HONG ; Yu-Ying HE ; Li LIU ; Hong SHEN ; Yan-Ping LI ; Sheng XIE ; Jin SHU ; Bin-Fang ZENG ; Jun-Xiang LI ; Zhen LIU ; Zheng-Hua XIAO ; Jing-Dong XIAO ; Pei-Yong ZHENG ; Shao-Gang HUANG ; Sheng-Liang CHEN ; Gui-Jun FEI
Journal of Integrative Medicine 2025;23(5):502-518
Functional dyspepsia (FD), characterized by persistent or recurrent dyspeptic symptoms without identifiable organic, systemic or metabolic causes, is an increasingly recognized global health issue. The objective of this guideline is to equip clinicians and nursing professionals with evidence-based strategies for the management and treatment of adult patients with FD using traditional Chinese medicine (TCM). The Guideline Development Group consulted existing TCM consensus documents on FD and convened a panel of 35 clinicians to generate initial clinical queries. To address these queries, a systematic literature search was conducted across PubMed, EMBASE, the Cochrane Library, China National Knowledge Infrastructure (CNKI), VIP Database, China Biology Medicine (SinoMed) Database, Wanfang Database, Traditional Medicine Research Data Expanded (TMRDE), and the Traditional Chinese Medical Literature Analysis and Retrieval System (TCMLARS). The evidence from the literature was critically appraised using the Grading of Recommendations Assessment, Development, and Evaluation (GRADE) approach. The strength of the recommendations was ascertained through a consensus-building process involving TCM and allopathic medicine experts, methodologists, pharmacologists, nursing specialists, and health economists, leveraging their collective expertise and empirical knowledge. The guideline comprises a total of 43 evidence-informed recommendations that span a range of clinical aspects, including the pathogenesis according to TCM, diagnostic approaches, therapeutic interventions, efficacy assessments, and prognostic considerations. Please cite this article as: Zhang SS, Zhao LQ, Hou XH, Bian ZX, Zheng JH, Tian HH, Yang GH, Hong WS, He YY, Liu L, Shen H, Li YP, Xie S, Shu J, Zeng BF, Li JX, Liu Z, Xiao ZH, Xiao JD, Zheng PY, Huang SG, Chen SL, Fei GJ. International clinical practice guideline on the use of traditional Chinese medicine for functional dyspepsia (2025). J Integr Med. 2025; 23(5):502-518.
Dyspepsia/drug therapy*
;
Humans
;
Medicine, Chinese Traditional/methods*
;
Practice Guidelines as Topic
;
Drugs, Chinese Herbal/therapeutic use*

Result Analysis
Print
Save
E-mail