In the context of burgeoning economic trade, there has been a remarkable increase in the number of ships travelling between domestic and international ports. Inbound and outbound cargo ships, cruise liners, ferries, and other types of vessels have emerged as critical vehicles for the dispersal of vector organisms and the spread of infectious disease agents. Public health concerns associated with these vessels represent a significant threat to human welfare. In this paper, we comprehensively review the hazards posed by vector organisms on ships, the latest advances in prevention and control strategies, and proposes appropriate countermeasures. The aim is to provide effective guidance for the prevention and control of public health security issues caused by ship-borne vector organisms.

Objective This study reports on the obligatory parasitism of water mites Arrenurus sp. on Anopheles messeae at the Manzhouli Port, Inner Mongolia, China. Methods Duing July 2024, a survey on the mosquito diversity was conducted at the Manzhouli Port. Captured mosquitoes and their ectoparasites were identified to species level. Results A total of 1840 adult mosquitoes were collected, representing species from three genera: Culex(Cx. modestus, Cx. pipiens pallens), Aedes(Ae. dorsalis, Ae. flavidorsalis, Ae. flavescens), and Anopheles (An. messeae). Among all the mosqutioes specimens,3 out of 150 captured An. messeae were found to carry ectoparasitic mites, with number of 2,4,27 mites separately. Morphological and molecular identification reached the same result as water mites(Hydrachnidiae, Hydracrina). COI gene sequence showed 94% similarity with the closest species Arrenurus truncatellus. Conlusions Literature review suggests water mites are host-specific parasitism of mosquito species and herein with the first record of Arrenurus sp. parasiting on An. Messeae in the most high-latitude region globally.

ObjectiveTo explore the mechanism by which aerobic exercise improves hippocampal neuroinflammation and learning and memory ability in brain-aged mice via interferon regulatory factor 7 (IRF7). MethodsA total of 60 male specific pathogen-free (SPF) C57BL/6J mice were enrolled in the experiment, including 30 young mice (2 months old) and 30 naturally aging mice (12 months old). Young mice and old mice were respectively randomly assigned to four groups: young control group (group C, n=15), young exercise group (group CE, n=15), and aging control group (group A, n=15), aging exercise group (group AE, n=15). Mice in the exercise groups received an 8-week continuous treadmill aerobic exercise intervention, while control mice were kept under routine feeding without exercise intervention. After the intervention, Barnes maze and Y-maze behavioral tests were performed to comprehensively assess the learning and memory abilities of each group of mice. Transmission electron microscopy was used to observe the ultrastructural morphological changes of hippocampal synapses. Western blot assay was utilized to detect the protein expression and phosphorylation levels of Janus kinase 1 (JAK1), signal transducer and activator of transcription 1 (STAT1), as well as the expression of postsynaptic density protein 95 (PSD95). Immunofluorescence staining was applied to quantify the fluorescence intensity of ionized calcium-binding adapter molecule 1 (IBA1) in hippocampal tissues. The expression levels of inflammatory cytokines including interferon-α (IFN-α), interferon-β (IFN-β), tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) were measured by enzyme-linked immunosorbent assay (ELISA). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed to detect the mRNA expression level of IRF7, and DNA methylation assay was further conducted to analyze the methylation level of the IRF7 gene in mouse hippocampus. ResultsAt the molecular level, compared with group C, the protein expression levels of JAK1, STAT1, p‑JAK1, and p‑STAT1 in group A were significantly increased (P<0.05), whereas PSD95 expression was decreased (P<0.05). ELISA assays showed that the levels of IFN‑α, IFN‑β, TNF‑α, and IL‑1β were significantly elevated in group A (P<0.001). RT‑PCR analysis revealed that, compared with group C, the mRNA expression of IRF7 in group A was markedly upregulated (P<0.000 1), while the CpG methylation rate of the IRF7 promoter was significantly reduced (P<0.05). In contrast, all the above parameters in the AE group showed improvements relative to those in group A. Immunofluorescence staining indicated positive IBA1 expression in the brain tissues of group A mice. Exercise intervention reversed these abnormal changes. ConclusionIn aged mice, aerobic exercise induces hypermethylation of the IRF7 promoter region, suppresses IRF7 expression and activation of the downstream IFN‑I/JAK1/STAT1 signaling pathway, accompanied by alleviated neuroinflammation, improved learning and memory, and ameliorated brain aging-related phenotypes.

Background/Aims: Liver transplantation (LT) following total hepatectomy is a life-saving treatment for hepatocellular carcinoma (HCC). The HCC recurrence after LT hinders the effectiveness of the procedure. The objective of this study is to develop a pre-operative risk stratification model based on a liquid biopsy. Methods: We conducted a comprehensive multi-omics study of 260 HCC patients from three centers, including clinical data, low-coverage whole-genome sequencing of cell-free DNA (cfDNA) from plasma, as well as whole-exome, single-nucleus RNA, and spatial transcriptomics from matched tumor and non-tumor tissues. Results: We identified cfDNA-derived copy number alteration (CNA) signatures associated with post-transplant recurrence. By integrating cfDNA-derived CNA profiles with single-cell transcriptomic data, we traced recurrence-associated cfDNA to a distinct subpopulation of malignant cells within the primary tumor. These cells were embedded in a pro-metastatic microenvironment of specialized endothelial subtypes and cancer-associated fibroblasts. Notably, most recurrence-associated lesions were detectable in cfDNA prior to liver transplantation (LT). Building on these insights, we developed the ZJU Criteria based on CNA fragments and tumor markers, a pre-LT risk prediction tool that integrates conventional clinical factors with cfDNA-derived CNA signatures, and validated it using internal and independent external cohorts. Conclusion Our findings suggest that post-transplant recurrence commonly originates from advanced subclones that emerge late during tumor evolution. The ZJU Criteria provides an accurate, non-invasive strategy that significantly improves pre-LT risk stratification and clinical decision-making for patients with HCC.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

AIM To investigate the effects of Shuyu Pills combined with evolimus on the epithelial mesenchymal transformation of triple negative breast cancer cells 4T1 and MDA-MB-231 induced by TGF-β1.METHODS The 4T1 and MDA-MB-231 cells were divided into the blank group and the induction group to induce the epithelial mesenchymal transformation with TGF-β1 cytokine treatment,followed by the assignment into the model group,the Shuyu Pills group,the everolimus group and the Shuyu Pills combined with everolimus group.CCK8 method,plate cloning method,cell scratch test and Transewll test were used to detect the proliferation,cloning formation,migration and invasion ability of the cells whose expressions of E-cadherin,N-cadherin,Vimentin,MMP9,MMP2 and pathway proteins PTEN,PI3K,Akt and mTOR were detected by Western blot.RESULTS Compared with the blank group,the induction group displayed a cell morphological change from epithelioid to stromal,decreased expression of E-cadherin protein(P＜0.01);and increased protein expressions of N-cadherin and Vimentin(P＜0.05).Compared with the model group,each group intervened with the medicine displayed decreased proliferation,clone formation,migration and invasion ability of both kinds of cells(P＜0.01);increased protein expressions of PTEN and E-cadherin(P＜0.05,P＜0.01);and decreased protein expressions of PI3K,Akt,mTOR,N-cadherin,Vimentin,MMP9 and MMP2(P＜0.05,P＜0.01);and more significantly in the Shuyu Pills combined with evolimus group(P＜0.05,P＜0.01).CONCLUSION With a more ideal effect than the single uses in inhibiting the TGF-β1-induced epithelial mesenchymal transformation of triple-negative breast cancer cells,the combination use of Shuyu Pills and everolimus may work through the regulation of PI3K/Akt/mTOR signaling pathway.

AIM To study the chemical constituents from Inula japonica Thunb.and their anti-asthmatic activity.METHODS Separation and purification were performed using silica gel and Sephadex LH-20,then the structures of obtained compounds were identified by physicochemical properties and spectral data.The effect of compounds on the release rate of β-Hex was evaluated by substrate coloration method.RESULTS Twenty-three compounds were isolated and identified as dehydrodontic acid(1),vitexin(2),alternariol(3),globuxanthone(4),1,3,6,7-tetrahydroxyxanthone(5),hydroxyhydrolapachol(6),isoscopoletin(7),elephanmollen(8),benzoylcholine(9),hoconobiflavone(10),clovandiol(11),hydroxydihydrobovolide(12),5,7-dihydroxycoumarin(13),scopoletin(14),orlichenol glucoside(15),urolignoside(16),9-angeloyloxythymol(17),6,3′,4′-trihydroxyaurone(18),flufuran(19),sweroside(20),guajadial(21),5,7,4′-trimethoxy-4-phenylcoumarin(22),dibutylphthalate(23).After intervention with compounds 9 and 16,the release rates of β-Hex were(56.64±2.37)％and(58.07±2.29)％,respectively.CONCLUSION Compounds 1-23 are isolated from Ⅰ.japonica for the first time.Compounds 9 and 16 have anti-asthmatic activity.

Sarin(GB)is a typical representative of nerve agents with high toxicity,and very low amount can cause death.GB can cause water and atmospheric environment poisoning,so the detection of GB in water and air is of great significance.In this work,a colorimetric sensor array(CSA)based on GB inhibition of cholinesterase activity was constructed to detect GB with high selectivity.A 4×4 colorimetric array was constructed using acetylcholinesterase(AChE),butyryl cholinesterase(BuChE)and the corresponding substrate acetylthiocholine iodide(S-ACh),butyryl thiocholine iodide(S-BCh),acetylcholine chloride(ACh),butyryl choline chloride(BCh)and 2,6-dichloroindophenol ethyl ester(DCIE).The linear curve of the sensor was Y=131.3×lgC+271.6(R2=0.997),where Y was the array response Euclidean distance,C was the concentration of GB(mg/L),the linear range was 0.03?0.32 mg/L,and the detection limit was 27.6 μg/L.The method could effectively distinguish chemical warfare agents(CWA)such as VX,Soman(GD),mustard gas(HD),Louie reagent(L),and had high anti-interference ability,sensitivity and good repeatability.It was successfully applied to the detection of GB in simulated water and simulated air samples,and the sample recovery rate was 97.2% ?100.9%.This method would be potentially applied to the field rapid detection of nerve agents.

Testicular histology based on testicular biopsy is an important factor for determining appropriate testicular sperm extraction surgery and predicting sperm retrieval outcomes in patients with azoospermia. Therefore, we developed a deep learning (DL) model to establish the associations between testicular grayscale ultrasound images and testicular histology. We retrospectively included two-dimensional testicular grayscale ultrasound from patients with azoospermia (353 men with 4357 images between July 2017 and December 2021 in The First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China) to develop a DL model. We obtained testicular histology during conventional testicular sperm extraction. Our DL model was trained based on ultrasound images or fusion data (ultrasound images fused with the corresponding testicular volume) to distinguish spermatozoa presence in pathology (SPP) and spermatozoa absence in pathology (SAP) and to classify maturation arrest (MA) and Sertoli cell-only syndrome (SCOS) in patients with SAP. Areas under the receiver operating characteristic curve (AUCs), accuracy, sensitivity, and specificity were used to analyze model performance. DL based on images achieved an AUC of 0.922 (95% confidence interval [CI]: 0.908-0.935), a sensitivity of 80.9%, a specificity of 84.6%, and an accuracy of 83.5% in predicting SPP (including normal spermatogenesis and hypospermatogenesis) and SAP (including MA and SCOS). In the identification of SCOS and MA, DL on fusion data yielded better diagnostic performance with an AUC of 0.979 (95% CI: 0.969-0.989), a sensitivity of 89.7%, a specificity of 97.1%, and an accuracy of 92.1%. Our study provides a noninvasive method to predict testicular histology for patients with azoospermia, which would avoid unnecessary testicular biopsy.
Humans ; Male ; Azoospermia/diagnostic imaging* ; Deep Learning ; Testis/pathology* ; Retrospective Studies ; Adult ; Ultrasonography/methods* ; Sperm Retrieval ; Sertoli Cell-Only Syndrome/diagnostic imaging*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test