Background/Aims: Liver transplantation (LT) following total hepatectomy is a life-saving treatment for hepatocellular carcinoma (HCC). The HCC recurrence after LT hinders the effectiveness of the procedure. The objective of this study is to develop a pre-operative risk stratification model based on a liquid biopsy. Methods: We conducted a comprehensive multi-omics study of 260 HCC patients from three centers, including clinical data, low-coverage whole-genome sequencing of cell-free DNA (cfDNA) from plasma, as well as whole-exome, single-nucleus RNA, and spatial transcriptomics from matched tumor and non-tumor tissues. Results: We identified cfDNA-derived copy number alteration (CNA) signatures associated with post-transplant recurrence. By integrating cfDNA-derived CNA profiles with single-cell transcriptomic data, we traced recurrence-associated cfDNA to a distinct subpopulation of malignant cells within the primary tumor. These cells were embedded in a pro-metastatic microenvironment of specialized endothelial subtypes and cancer-associated fibroblasts. Notably, most recurrence-associated lesions were detectable in cfDNA prior to liver transplantation (LT). Building on these insights, we developed the ZJU Criteria based on CNA fragments and tumor markers, a pre-LT risk prediction tool that integrates conventional clinical factors with cfDNA-derived CNA signatures, and validated it using internal and independent external cohorts. Conclusion Our findings suggest that post-transplant recurrence commonly originates from advanced subclones that emerge late during tumor evolution. The ZJU Criteria provides an accurate, non-invasive strategy that significantly improves pre-LT risk stratification and clinical decision-making for patients with HCC.

In the context of burgeoning economic trade, there has been a remarkable increase in the number of ships travelling between domestic and international ports. Inbound and outbound cargo ships, cruise liners, ferries, and other types of vessels have emerged as critical vehicles for the dispersal of vector organisms and the spread of infectious disease agents. Public health concerns associated with these vessels represent a significant threat to human welfare. In this paper, we comprehensively review the hazards posed by vector organisms on ships, the latest advances in prevention and control strategies, and proposes appropriate countermeasures. The aim is to provide effective guidance for the prevention and control of public health security issues caused by ship-borne vector organisms.

Objective This study reports on the obligatory parasitism of water mites Arrenurus sp. on Anopheles messeae at the Manzhouli Port, Inner Mongolia, China. Methods Duing July 2024, a survey on the mosquito diversity was conducted at the Manzhouli Port. Captured mosquitoes and their ectoparasites were identified to species level. Results A total of 1840 adult mosquitoes were collected, representing species from three genera: Culex(Cx. modestus, Cx. pipiens pallens), Aedes(Ae. dorsalis, Ae. flavidorsalis, Ae. flavescens), and Anopheles (An. messeae). Among all the mosqutioes specimens,3 out of 150 captured An. messeae were found to carry ectoparasitic mites, with number of 2,4,27 mites separately. Morphological and molecular identification reached the same result as water mites(Hydrachnidiae, Hydracrina). COI gene sequence showed 94% similarity with the closest species Arrenurus truncatellus. Conlusions Literature review suggests water mites are host-specific parasitism of mosquito species and herein with the first record of Arrenurus sp. parasiting on An. Messeae in the most high-latitude region globally.

Abelmoschi Corolla, the dried corolla of Abelmoschus manihot, has anti-inflammatory, antioxidant, and anti-fibrosis activities. Its chemical constituents mainly include flavonoids, organic acids, steroids, and polysaccharides. This study reviewed the research progress in the chemical constituents and pharmacological activities of Abelmoschi Corolla in recent 20 years. According to the concept of quality marker(Q-marker), the Q-markers of Abelmoschi Corolla were predicted from plant phylogeny, chemical constituent specificity, traditional efficacy, chemical constituent measurability, and absorbed constituents. The primary Q-markers for Abelmoschi Corolla were anticipated to include quercetin-3'-O-β-D-glucopyranoside, gossypetin-8-O-β-D-glucuronide, isoquercetin, myricetin,quercetin, and hyperoside, with the aim of providing reference data for improving the quality evaluation system of Abelmoschi Corolla.
Abelmoschus/chemistry* ; Drugs, Chinese Herbal/pharmacology* ; Flowers/chemistry* ; Humans ; Animals ; Quality Control ; Flavonoids/chemistry*

Acori Tatarinowii Rhizoma is the dried rhizome of Acorus tatarinowii in the family of Tennantiaceae, which has the efficacy of opening up the orifices and expelling phlegm, awakening the mind and wisdom, and resolving dampness and opening up the stomach. Modern studies have shown that volatile oil is the main active ingredient of Acori Tatarinowii Rhizoma, and α-asarone and β-asarone have been proved to be the active ingredients in the volatile oil of Acori Tatarinowii Rhizoma, with pharmacological effects such as anti-Alzheimer's disease, antiepileptic, anti-Parkinson's disease, antidepressant, anticerebral ischemia/reperfusion injury, anti-thrombosis, lipid-lowering, and antitumor. By summarising and outlining the pharmacological effects of α-asarone and β-asarone and elucidating the possible mechanisms of their pharmacological effects, we can provide theoretical basis for the further research and clinical application of Acori Tatarinowii Rhizoma.
Allylbenzene Derivatives ; Acorus/chemistry* ; Anisoles/chemistry* ; Rhizome/chemistry* ; Drugs, Chinese Herbal/chemistry* ; Humans ; Animals

This study aimed to explore the effects and mechanisms of total extracts from Anthriscus sylvestris on pulmonary hypertension in rats. Sixty male SD rats were divided into normal(NC) group, model(M) group, positive drug sildenafil(Y) group, low-dose A. sylvestris(ES-L) group, medium-dose A. sylvestris(ES-M) group, and high-dose A. sylvestris(ES-H) group. On day 1, rats were intraperitoneally injected with monocrotaline(60 mg·kg~(-1)) to induce pulmonary hypertension, and the rat model was established on day 28. From days 15 to 28, intragastric administration of the respective treatments was performed. After modeling and treatment, small animal echocardiography was used to detect the right heart function of the rats. Arterial blood gas was measured using a blood gas analyzer. Hematoxylin and eosin(HE) staining and Masson staining were performed to observe cardiopulmonary pathological damage. Flow cytometry was used to detect apoptosis in the lung and myocardial tissues and reactive oxygen species(ROS) levels. Western blot was applied to detect the expression levels of transforming growth factor-β1(TGF-β1), phosphorylated mothers against decapentaplegic homolog 3(p-Smad3), Smad3, tissue plasminogen activator(t-PA), and plasminogen activator inhibitor-1(PAI-1) in lung tissue. A blood routine analyzer was used to measure inflammatory immune cell levels in the blood. Enzyme-linked immunosorbent assay(ELISA) was used to detect the expression levels of P-selectin and thromboxane A2(TXA2) in plasma. The results showed that, compared with the NC group, right heart hypertrophy index, right ventricular free wall thickness, right heart internal diameter, partial carbon dioxide pressure(PaCO_2), apoptosis in cardiopulmonary tissue, and ROS levels were significantly increased in the M group. In contrast, the ratio of pulmonary blood flow acceleration time(PAT)/ejection time(PET), right cardiac output, change rate of right ventricular systolic area, systolic displacement of the tricuspid ring, oxygen partial pressure(PaO_2), and blood oxygen saturation(SaO_2) were significantly decreased in the M group. After administration of the total extract of A. sylvestris, right heart function and blood gas levels were significantly improved, while apoptosis in cardiopulmonary tissue and ROS levels significantly decreased. Further testing revealed that the total extract of A. sylvestris significantly decreased the levels of interleukin-1β(IL-1β), interleukin-6(IL-6), and PAI-1 proteins in lung tissue, while increasing the expression of t-PA. Additionally, the extract reduced the levels of inflammatory cells such as leukocytes, lymphocytes, granulocytes, and monocytes in the blood, as well as the levels of P-selectin and TXA2 in plasma. Metabolomics results showed that the total extract of A. sylvestris significantly affected metabolic pathways, including arginine biosynthesis, tyrosine metabolism, and taurine and hypotaurine metabolism. In conclusion, the total extract of A. sylvestris may exert an anti-pulmonary hypertension effect by inhibiting the TGF-β1/Smad3 signaling pathway, thereby alleviating immune-inflammatory responses and thrombosis.
Animals ; Male ; Smad3 Protein/metabolism* ; Transforming Growth Factor beta1/metabolism* ; Rats, Sprague-Dawley ; Rats ; Signal Transduction/drug effects* ; Hypertension, Pulmonary/genetics* ; Thrombosis/immunology* ; Drugs, Chinese Herbal/administration & dosage* ; Humans ; Apoptosis/drug effects*

This study primarily investigates the effect of Liuwei Dihuang Pills on the activation and proliferation of female germline stem cells(FGSCs) in the ovaries and cortex of mice with premature ovarian failure(POF), and how it improves ovarian function. ICR mice were randomly divided into the control group, model group, Liuwei Dihuang Pills group, Liuwei Dihuang Pills double-dose group, and estradiol valerate group. A mouse model of POF was established by intraperitoneal injection of cyclophosphamide. After successful modeling, the mice were treated with Liuwei Dihuang Pills or estradiol valerate for 28 days. Vaginal smears were prepared to observe the estrous cycle and body weight. After the last administration, mice were sacrificed and sampled. Serum levels of estradiol(E_2), follicle-stimulating hormone(FSH), luteinizing hormone(LH), and anti-Müllerian hormone(AMH) were measured by enzyme-linked immunosorbent assay(ELISA). Hematoxylin-eosin(HE) staining was used to observe ovarian morphology and to count follicles at all stages to evaluate ovarian function. Immunohistochemistry was used to detect the expression of mouse vasa homolog(MVH), a marker of ovarian FGSCs. Immunofluorescence staining, using co-labeling of MVH and proliferating cell nuclear antigen(PCNA), was used to detect the expression and localization of specific markers of FGSCs. Western blot was employed to assess the protein expression of MVH, octamer-binding transcription factor 4(Oct4), and PCNA in the ovaries. The results showed that compared with the control group, the model group exhibited disordered estrous cycles, decreased ovarian index, increased atretic follicles, and a reduced number of follicles at all stages. FSH and LH levels were significantly elevated, while AMH and E_2 levels were significantly reduced, indicating the success of the model. After treatment with Liuwei Dihuang Pills or estradiol valerate, hormone levels improved, the number of atretic follicles decreased, and the number of follicles at all stages increased. MVH marker protein and PCNA proliferative protein expression in ovarian tissue also increased. These results suggest that Liuwei Dihuang Pills regulate estrous cycles and hormone disorders in POF mice, promote the proliferation of FGSCs, improve follicular development in POF mice, and enhance ovarian function.
Animals ; Female ; Drugs, Chinese Herbal/administration & dosage* ; Mice ; Cell Proliferation/drug effects* ; Mice, Inbred ICR ; Ovary/cytology* ; Primary Ovarian Insufficiency/genetics* ; Follicle Stimulating Hormone/metabolism* ; Humans ; Anti-Mullerian Hormone/blood* ; Antineoplastic Agents/adverse effects* ; Luteinizing Hormone/metabolism* ; Cyclophosphamide/adverse effects*

This study aims to explore the protective effect of Chaihu Jia Longgu Muli Decoction on rats with heart failure after myocardial infarction, and to clarify its possible mechanisms, providing a new basis for basic research on the mechanism of classic Chinese medicinal formula-mediated inflammatory response in preventing and treating heart failure induced by apoptosis after myocardial infarction. A heart failure model after myocardial infarction was established in rats by coronary artery ligation. The rats were divided into sham group, model group, and low, medium, and high-dose groups of Chaihu Jia Longgu Muli Decoction, with 10 rats in each group. The low-dose, medium-dose, and high-dose groups of Chaihu Jia Longgu Muli Decoction were given 6.3, 12.6, and 25.2 g·kg~(-1) doses by gavage, respectively. The sham group and model group were given an equal volume of distilled water by gavage once daily for four consecutive weeks. Cardiac function was assessed using color Doppler echocardiography. Myocardial pathology was detected by hematoxylin-eosin(HE) staining, apoptosis was measured by TUNEL assay, and mitophagy was observed by transmission electron microscopy. The levels of tumor necrosis factor-α(TNF-α), interleukin(IL)-1β, and N-terminal pro-B-type natriuretic peptide(NT-proBNP) in serum were detected by enzyme-linked immunosorbent assay(ELISA). The expression of apoptosis-related proteins B-cell lymphoma 2(Bcl-2), Bcl-2-associated X protein(Bax), and cleaved caspase-3 was detected by Western blot. Additionally, the expression of phosphorylated nuclear transcription factor-κB(NF-κB) p65(p-NF-κB p65)(upstream) and nuclear factor kappa B inhibitor alpha(IκBα)(downstream) in the NF-κB signaling pathway was assessed by Western blot. The results showed that compared with the sham group, left ventricular ejection fraction(LVEF) and left ventricular short axis shortening(LVFS) in the model group were significantly reduced, while left ventricular end diastolic diameter(LVEDD) and left ventricular end systolic diameter(LVESD) increased significantly. Myocardial tissue damage was severe, with widened intercellular spaces and disorganized cell arrangement. The apoptosis rate was increased, and mitochondria were enlarged with increased vacuoles. Levels of TNF-α, IL-1β, and NT-proBNP were elevated, indicating an obvious inflammatory response. The expression of pro-apoptotic factors Bax and cleaved caspase-3 increased, while the anti-apoptotic factor Bcl-2 decreased. The expression of p-NF-κB p65 was upregulated, and the expression of IκBα was downregulated. In contrast, the Chaihu Jia Longgu Muli Decoction groups showed significantly improved of LVEF, LVFS and decreased LVEDD, LVESD compared to the model group. Myocardial tissue damage was alleviated, and intercellular spaces were reduced. The apoptosis rate decreased, mitochondrial volume decreased, and the levels of TNF-α, IL-1β, and NT-proBNP were lower. The expression of pro-apoptotic factors Bax and cleaved caspase-3 decreased, while the expression of the anti-apoptotic factor Bcl-2 increased. Additionally, the expression of p-NF-κB p65 decreased, while IκBα expression increased. In summary, this experimental study shows that Chaihu Jia Longgu Muli Decoction can reduce the inflammatory response and apoptosis rate in rats with heart failure after myocardial infarction, which may be related to the regulation of the IκBα/NF-κB signaling pathway.
Animals ; Apoptosis/drug effects* ; Drugs, Chinese Herbal/administration & dosage* ; Rats ; Myocardial Infarction/physiopathology* ; Male ; NF-kappa B/genetics* ; Heart Failure/etiology* ; Rats, Sprague-Dawley ; Signal Transduction/drug effects* ; NF-KappaB Inhibitor alpha/genetics* ; Humans ; Tumor Necrosis Factor-alpha/genetics*

Testicular histology based on testicular biopsy is an important factor for determining appropriate testicular sperm extraction surgery and predicting sperm retrieval outcomes in patients with azoospermia. Therefore, we developed a deep learning (DL) model to establish the associations between testicular grayscale ultrasound images and testicular histology. We retrospectively included two-dimensional testicular grayscale ultrasound from patients with azoospermia (353 men with 4357 images between July 2017 and December 2021 in The First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China) to develop a DL model. We obtained testicular histology during conventional testicular sperm extraction. Our DL model was trained based on ultrasound images or fusion data (ultrasound images fused with the corresponding testicular volume) to distinguish spermatozoa presence in pathology (SPP) and spermatozoa absence in pathology (SAP) and to classify maturation arrest (MA) and Sertoli cell-only syndrome (SCOS) in patients with SAP. Areas under the receiver operating characteristic curve (AUCs), accuracy, sensitivity, and specificity were used to analyze model performance. DL based on images achieved an AUC of 0.922 (95% confidence interval [CI]: 0.908-0.935), a sensitivity of 80.9%, a specificity of 84.6%, and an accuracy of 83.5% in predicting SPP (including normal spermatogenesis and hypospermatogenesis) and SAP (including MA and SCOS). In the identification of SCOS and MA, DL on fusion data yielded better diagnostic performance with an AUC of 0.979 (95% CI: 0.969-0.989), a sensitivity of 89.7%, a specificity of 97.1%, and an accuracy of 92.1%. Our study provides a noninvasive method to predict testicular histology for patients with azoospermia, which would avoid unnecessary testicular biopsy.
Humans ; Male ; Azoospermia/diagnostic imaging* ; Deep Learning ; Testis/pathology* ; Retrospective Studies ; Adult ; Ultrasonography/methods* ; Sperm Retrieval ; Sertoli Cell-Only Syndrome/diagnostic imaging*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test