This study explores whether the current external quality assessment (EQA) level and acceptable bias for basic semen analysis in China are clinically useful. We collected data of semen EQA from Andrology laboratories in the Hunan Province (China) in 2022 and searched for data in the published literature from January 2000 to December 2023 in China. On the basis of these data, we analyzed the coefficients of variation and acceptable biases of different quality control materials for basic semen analysis through robust statistics. We compared these findings with quality specifications based on biological variation from optimal, desirable, and minimum levels of bias to seek a unified and more suitable semen EQA bias evaluation standard for China's national conditions. Different sources of semen quality control material exhibited considerable variation in acceptable biases among laboratories, ranging from 8.2% to 56.9%. A total of 50.0% of the laboratories met the minimum quality specifications for progressive motility (PR), whereas 100.0% and 75.0% of laboratories met only the minimum quality specifications for sperm concentration and total motility (nonprogressive [NP] + PR), respectively. The Z value for sperm concentration and PR+NP was equivalent to the desirable performance specification, whereas the Z value for PR was equivalent only to the minimum performance specification. This study highlights the feasibility of operating external quality assessment schemes for basic semen analysis using quality specifications based on biological variation. These specifications should be unified among external quality control (EQC) centers based on biological variation.
Semen Analysis/standards* ; Humans ; China ; Male ; Quality Control ; Sperm Motility ; Sperm Count/standards*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To investigate the molecular epidemiology of children with phenylketonuria (PKU) in Gansu, China, providing foundational data for intervention strategies. METHODS: A retrospective analysis was conducted on 1 159 PKU families who attended Gansu Provincial Maternity and Child Care Hospital from January 2012 to December 2024. Sanger sequencing, multiplex ligation-dependent probe amplification, whole exome sequencing, and deep intronic variant analysis were used to analyze the PAH gene. RESULTS: For the 1 159 children with PKU, 2 295 variants were identified in 2 318 alleles, resulting in a detection rate of 99.01%. The detection rates were 100% (914/914) in 457 classic PKU families, 99.45% (907/912) in 456 mild PKU families, and 96.34% (474/492) in 246 mild hyperphenylalaninemia families. The 2 295 variants detected comprised 208 distinct mutation types, among which c.728G>A (14.95%, 343/2 295) had the highest frequency, followed by c.611A>G (4.88%, 112/2 295) and c.721C>T (4.79%, 110/2 295). The cumulative frequency of the top 23 hotspot variants reached 70.28% (1 613/2 295), and most variant alleles were detected in exon 7 (29.19%, 670/2 295). CONCLUSIONS Deep intronic variant analysis of the PAH gene can improve the genetic diagnostic rate of PKU. The development of targeted detection kits for PAH hotspot variants may enable precision screening programs and enhance preventive strategies for PKU.
Humans ; Phenylketonurias/epidemiology* ; Female ; Male ; Retrospective Studies ; Phenylalanine Hydroxylase/genetics* ; Mutation ; Child, Preschool ; China/epidemiology* ; Child ; Infant

OBJECTIVE: To explore the clinical significance of circulating tumor DNA (ctDNA) in response evaluation and relapse monitoring for patients with primary mediastinal large B-cell lymphoma (PMBCL). METHODS: The clinical characteristics, efficacy and survival of 38 PMBCL patients in our hospital from January 2010 to April 2020 were retrospectively analyzed. The ctDNA monitoring was conducted by targeted next-generation sequencing (NGS). RESULTS: Among the 38 patients, 26 cases were female, and 32 cases were diagnosed with Ann Arbor stage I-II. The 5-year overall survival (OS) rate and progression-free survival (PFS) rate were 74.7% and 61.7%, respectively. Males and those with high aaIPI scores (3 points) had a relatively poor prognosis. The NGS results of 23 patients showed that STAT6 (65.2%), SOCS1 (56.5%), and TNFAIP3 (56.5%) were the most common mutated genes. Patients with stable disease (SD)/progressive disease (PD) exhibited enrichment in cell cycle, FoxO, and TNF signaling pathways. A total of 29 patients underwent end-of-treatment PET/CT (EOT PET/CT), and 16 of them received ctDNA monitoring with 12 negative. Among 6 patients with EOT PET/CT positive (Deauville 4), 4 underwent ctDNA monitoring, and 3 of them were negative, being still in continuous remission without any subsequent anti-tumor therapy. CONCLUSION CtDNA may be combined with PET/CT to assess efficacy, monitor relapse, and guide treatment of PMBCL.
Humans ; Circulating Tumor DNA/blood* ; Female ; Mediastinal Neoplasms ; Male ; Retrospective Studies ; High-Throughput Nucleotide Sequencing ; Prognosis ; Lymphoma, Large B-Cell, Diffuse/genetics* ; Middle Aged ; Adult ; Aged ; Neoplasm Recurrence, Local ; Mutation

Ischemic stroke (IS) is a globally life-threatening disease. Presently, few therapeutic medicines are available for treating IS, and rt-PA is the only drug approved by the US Food and Drug Administration (FDA) in the US. In fact, many agents showing excellent neuroprotection but no blood flow-improving activity in animals have not achieved ideal clinical efficacy, while thrombolytic drugs only improving blood flow without neuroprotection have limited their wider application. To address these challenges and meet the huge unmet clinical need, we have designed and identified a novel compound AAPB with dual effects of neuroprotection and cerebral blood flow improvement. AAPB significantly reduced cerebral infarction and neural function deficit in tMCAO rats, pMCAO rats, and IS rhesus monkeys, as well as displayed exceptional safety profiles and excellent pharmacokinetic properties in rats and dogs. AAPB has now entered phase I of clinical trials fighting IS in China.

Cemental tear is a rare and indetectable condition unless obvious clinical signs present with the involvement of surrounding periodontal and periapical tissues. Due to its clinical manifestations similar to common dental issues, such as vertical root fracture, primary endodontic diseases, and periodontal diseases, as well as the low awareness of cemental tear for clinicians, misdiagnosis often occurs. The critical principle for cemental tear treatment is to remove torn fragments, and overlooking fragments leads to futile therapy, which could deteriorate the conditions of the affected teeth. Therefore, accurate diagnosis and subsequent appropriate interventions are vital for managing cemental tear. Novel diagnostic tools, including cone-beam computed tomography (CBCT), microscopes, and enamel matrix derivatives, have improved early detection and management, enhancing tooth retention. The implementation of standardized diagnostic criteria and treatment protocols, combined with improved clinical awareness among dental professionals, serves to mitigate risks of diagnostic errors and suboptimal therapeutic interventions. This expert consensus reviewed the epidemiology, pathogenesis, potential predisposing factors, clinical manifestations, diagnosis, differential diagnosis, treatment, and prognosis of cemental tear, aiming to provide a clinical guideline and facilitate clinicians to have a better understanding of cemental tear.
Humans ; Dental Cementum/injuries* ; Consensus ; Diagnosis, Differential ; Cone-Beam Computed Tomography ; Tooth Fractures/therapy*

Objective:To evaluate the safety of neoadjuvant therapy with pembrolizumab combined with 5-fluorouracil (5-FU) and cisplatin in patients with advanced temporal bone squamous cell carcinoma (TBSCC), and its impact on tumor response rate and disease-free survival (DFS).Methods:This prospective, single-arm, open-label clinical study enrolled patients with advanced (Stage Ⅲ/Ⅳ) TBSCC from Sun Yat-sen Memorial Hospital. Patients received 2-3 cycles of neoadjuvant therapy with pembrolizumab, 5-FU, and cisplatin, followed by definitive surgery. Postoperatively, patients received 6 cycles of pembrolizumab combined with radiotherapy. The primary endpoint was the 2-year disease-free survival (DFS) rate. Secondary endpoints included objective response rate (ORR) and safety indicators. Survival analysis was performed using the Kaplan-Meier method. Adverse events (AE) were assessed using the National Cancer Institute′s Common Terminology Criteria for Adverse Events (CTCAE), version 5.0. Statistical analyses were conducted using SPSS software, version 22.0.Results:From August 2021 to April 2024, 16 patients with advanced TBSCC were enrolled (13 males and 3 females), with a median age of 54 years and a median follow-up time of 2.32 years. Following neoadjuvant therapy, the objective response rate (ORR) was 64.3% (9/14), and the disease control rate (DCR) was 92.9% (13/14). The 2-year DFS rate was 86.6%. Common treatment-related adverse events (TRAE) included leukopenia (56.3%, 9/16), nausea and vomiting (50.0%, 8/16), diarrhea, oral mucositis, and elevated liver function tests (25.0%, 4/16). One patient (6.25%) experienced a grade 3 adverse event.Conclusion:Neoadjuvant pembrolizumab-chemotherapy significantly enhances objective response rate and disease-free survival in advanced TBSCC.

Objective:To explore the clinical and genetic characteristics of two children diagnosed with two rare genetic diseases simultaneously.Methods:Two children with comorbidity of two genetic diseases due to dual genetic mutations diagnosed at the Third Affiliated Hospital of Zhengzhou University respectively in May 2022 and March 2023 were selected as the study subjects. Clinical and genetic data of the two children were retrospectively analyzed. This study has been approved by the Ethics Committee of the Third Affiliated Hospital of Zhengzhou University (Ethic No. 2021-062-01).Results:Child 1 was a 2-year-and-4-month-old boy whose clinical manifestations included facial dysmorphism, developmental delay, short stature, microcephaly, cleft palate, cryptorchidism, hypospadias, recurrent infections and immunological abnormalities. Whole exome sequencing revealed that he had harbored a heterozygous c.6595delT (p.Y2199Ifs*65) variant of the KMT2D gene and a heterozygous c. 1892G>A (p.R631Q) variant of the PIK3R1 gene. This has led to a dual genetic diagnosis of Kabuki syndrome and PI3Kδ-related immunodeficiency type 36. Child 2 was a 15-year-old girl whose clinical manifestations included epilepsy, Albright′s hereditary osteodystrophy, long body trunk, short limbs, hypocalcemia, hyperphosphatemia and hyperparathyroidism. The child also had a family history of short stature. Whole exome sequencing revealed that she had harbored a heterozygous c. 2T>C (p.Met1? ) variant of the GNAS gene and deletion of exons 2 to 6 of the SHOX gene. The two variants have led to dual diagnose of pseudohypoparathyroidism and X-linked idiopathic short stature. Conclusion:When the clinical phenotype of a genetic disease is complex and cannot be fully explained with a single genetic variant, multiple pathogenic variants should be considered, and this may lead to the diagnosis of co-morbid genetic diseases. To adopt or supplement corresponding genetic testing in time and re-analyze the genetic data may facilitate accurate diagnosis of comorbid genetic diseases.

Glycoengineering was carried out in the mammalian cell line CHO for the production of pro-tein-based drugs.Firstly,the genome sequence of the Rosa26 locus of CHO cells was determined,the gRNA sequences were designed,and the landing pad was integrated into the Rosa26 locus of CHO cells by CRISPR/Cas9 technology.Three targeting vectors co-expressed by glycosyltransferases,which are β-1,4 galactosyltransferase(B4GALT1),α-2,6-sialyltransferase 1(ST6GAL1)and N-acetaminoglycosyl-transferase Ⅲ(GnT Ⅲ),were constructed by overlapping PCR and seamless ligation technology,and the three glycosyltransferase genes were integrated into the CHO Rosa26 locus by Cre enzyme-mediated cassette exchange technology.PCR confirmed that three glycosyltransferases had been successfully site-directed integrated into the Rosa26 site.The mRNA expression levels of the three glycosyltransferases were more than 50 000-fold by qRT-PCR,and the protein expression levels of the three glycosyltrans-ferases were more than 4-fold via western blotting(P＜0.001).A CHO-engineered cell line with three glycosyltransferases integrated into Rosa26 site was successfully constructed.