1.Predictive Modeling of Symptomatic Intracranial Hemorrhage Following Endovascular Thrombectomy: Insights From the Nationwide TREAT-AIS Registry
Jia-Hung CHEN ; I-Chang SU ; Yueh-Hsun LU ; Yi-Chen HSIEH ; Chih-Hao CHEN ; Chun-Jen LIN ; Yu-Wei CHEN ; Kuan-Hung LIN ; Pi-Shan SUNG ; Chih-Wei TANG ; Hai-Jui CHU ; Chuan-Hsiu FU ; Chao-Liang CHOU ; Cheng-Yu WEI ; Shang-Yih YAN ; Po-Lin CHEN ; Hsu-Ling YEH ; Sheng-Feng SUNG ; Hon-Man LIU ; Ching-Huang LIN ; Meng LEE ; Sung-Chun TANG ; I-Hui LEE ; Lung CHAN ; Li-Ming LIEN ; Hung-Yi CHIOU ; Jiunn-Tay LEE ; Jiann-Shing JENG ;
Journal of Stroke 2025;27(1):85-94
Background:
and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking.
Methods:
This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance.
Results:
Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal.
Conclusions
The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.
2.Predictive Modeling of Symptomatic Intracranial Hemorrhage Following Endovascular Thrombectomy: Insights From the Nationwide TREAT-AIS Registry
Jia-Hung CHEN ; I-Chang SU ; Yueh-Hsun LU ; Yi-Chen HSIEH ; Chih-Hao CHEN ; Chun-Jen LIN ; Yu-Wei CHEN ; Kuan-Hung LIN ; Pi-Shan SUNG ; Chih-Wei TANG ; Hai-Jui CHU ; Chuan-Hsiu FU ; Chao-Liang CHOU ; Cheng-Yu WEI ; Shang-Yih YAN ; Po-Lin CHEN ; Hsu-Ling YEH ; Sheng-Feng SUNG ; Hon-Man LIU ; Ching-Huang LIN ; Meng LEE ; Sung-Chun TANG ; I-Hui LEE ; Lung CHAN ; Li-Ming LIEN ; Hung-Yi CHIOU ; Jiunn-Tay LEE ; Jiann-Shing JENG ;
Journal of Stroke 2025;27(1):85-94
Background:
and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking.
Methods:
This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance.
Results:
Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal.
Conclusions
The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.
3.Biomimetic nanoparticle delivery systems b ased on red blood cell membranes for disease treatment
Chen-xia GAO ; Yan-yu XIAO ; Yu-xue-yuan CHEN ; Xiao-liang REN ; Mei-ling CHEN
Acta Pharmaceutica Sinica 2025;60(2):348-358
Nanoparticle delivery systems have good application prospects in the field of precision therapy, but the preparation process of nanomaterial has problems such as short
4.Predictive Modeling of Symptomatic Intracranial Hemorrhage Following Endovascular Thrombectomy: Insights From the Nationwide TREAT-AIS Registry
Jia-Hung CHEN ; I-Chang SU ; Yueh-Hsun LU ; Yi-Chen HSIEH ; Chih-Hao CHEN ; Chun-Jen LIN ; Yu-Wei CHEN ; Kuan-Hung LIN ; Pi-Shan SUNG ; Chih-Wei TANG ; Hai-Jui CHU ; Chuan-Hsiu FU ; Chao-Liang CHOU ; Cheng-Yu WEI ; Shang-Yih YAN ; Po-Lin CHEN ; Hsu-Ling YEH ; Sheng-Feng SUNG ; Hon-Man LIU ; Ching-Huang LIN ; Meng LEE ; Sung-Chun TANG ; I-Hui LEE ; Lung CHAN ; Li-Ming LIEN ; Hung-Yi CHIOU ; Jiunn-Tay LEE ; Jiann-Shing JENG ;
Journal of Stroke 2025;27(1):85-94
Background:
and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking.
Methods:
This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance.
Results:
Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal.
Conclusions
The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.
6.Exploration of evaluation criteria based on the biological variation in the external quality assessment for basic semen analysis in China.
Xi-Yan WU ; Jin-Chun LU ; Xin-Hua PENG ; Jing-Liang HE ; Dao WANG ; Cong-Ling DAI ; Wen-Bing ZHU ; Gang LIU ; Wei-Na LI
Asian Journal of Andrology 2025;27(5):621-626
This study explores whether the current external quality assessment (EQA) level and acceptable bias for basic semen analysis in China are clinically useful. We collected data of semen EQA from Andrology laboratories in the Hunan Province (China) in 2022 and searched for data in the published literature from January 2000 to December 2023 in China. On the basis of these data, we analyzed the coefficients of variation and acceptable biases of different quality control materials for basic semen analysis through robust statistics. We compared these findings with quality specifications based on biological variation from optimal, desirable, and minimum levels of bias to seek a unified and more suitable semen EQA bias evaluation standard for China's national conditions. Different sources of semen quality control material exhibited considerable variation in acceptable biases among laboratories, ranging from 8.2% to 56.9%. A total of 50.0% of the laboratories met the minimum quality specifications for progressive motility (PR), whereas 100.0% and 75.0% of laboratories met only the minimum quality specifications for sperm concentration and total motility (nonprogressive [NP] + PR), respectively. The Z value for sperm concentration and PR+NP was equivalent to the desirable performance specification, whereas the Z value for PR was equivalent only to the minimum performance specification. This study highlights the feasibility of operating external quality assessment schemes for basic semen analysis using quality specifications based on biological variation. These specifications should be unified among external quality control (EQC) centers based on biological variation.
Semen Analysis/standards*
;
Humans
;
China
;
Male
;
Quality Control
;
Sperm Motility
;
Sperm Count/standards*
7.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
8.Genetic profiling and intervention strategies for phenylketonuria in Gansu, China: an analysis of 1 159 cases.
Chuan ZHANG ; Pei ZHANG ; Bing-Bo ZHOU ; Xing WANG ; Lei ZHENG ; Xiu-Jing LI ; Jin-Xian GUO ; Pi-Liang CHEN ; Ling HUI ; Zhen-Qiang DA ; You-Sheng YAN
Chinese Journal of Contemporary Pediatrics 2025;27(7):808-814
OBJECTIVES:
To investigate the molecular epidemiology of children with phenylketonuria (PKU) in Gansu, China, providing foundational data for intervention strategies.
METHODS:
A retrospective analysis was conducted on 1 159 PKU families who attended Gansu Provincial Maternity and Child Care Hospital from January 2012 to December 2024. Sanger sequencing, multiplex ligation-dependent probe amplification, whole exome sequencing, and deep intronic variant analysis were used to analyze the PAH gene.
RESULTS:
For the 1 159 children with PKU, 2 295 variants were identified in 2 318 alleles, resulting in a detection rate of 99.01%. The detection rates were 100% (914/914) in 457 classic PKU families, 99.45% (907/912) in 456 mild PKU families, and 96.34% (474/492) in 246 mild hyperphenylalaninemia families. The 2 295 variants detected comprised 208 distinct mutation types, among which c.728G>A (14.95%, 343/2 295) had the highest frequency, followed by c.611A>G (4.88%, 112/2 295) and c.721C>T (4.79%, 110/2 295). The cumulative frequency of the top 23 hotspot variants reached 70.28% (1 613/2 295), and most variant alleles were detected in exon 7 (29.19%, 670/2 295).
CONCLUSIONS
Deep intronic variant analysis of the PAH gene can improve the genetic diagnostic rate of PKU. The development of targeted detection kits for PAH hotspot variants may enable precision screening programs and enhance preventive strategies for PKU.
Humans
;
Phenylketonurias/epidemiology*
;
Female
;
Male
;
Retrospective Studies
;
Phenylalanine Hydroxylase/genetics*
;
Mutation
;
Child, Preschool
;
China/epidemiology*
;
Child
;
Infant
9.Clinical Applications of Circulating Tumor DNA in Response Evaluation and Relapse Monitoring of Primary Mediastinal Large B-Cell Lymphoma.
Lu PAN ; Xin-Miao JIANG ; Yan TENG ; Ning WANG ; Ling HUANG ; Han-Guo GUO ; Si-Chu LIU ; Xiao-Juan WEI ; Fei-Li CHEN ; Zhan-Li LIANG ; Wen-Yu LI
Journal of Experimental Hematology 2025;33(2):407-415
OBJECTIVE:
To explore the clinical significance of circulating tumor DNA (ctDNA) in response evaluation and relapse monitoring for patients with primary mediastinal large B-cell lymphoma (PMBCL).
METHODS:
The clinical characteristics, efficacy and survival of 38 PMBCL patients in our hospital from January 2010 to April 2020 were retrospectively analyzed. The ctDNA monitoring was conducted by targeted next-generation sequencing (NGS).
RESULTS:
Among the 38 patients, 26 cases were female, and 32 cases were diagnosed with Ann Arbor stage I-II. The 5-year overall survival (OS) rate and progression-free survival (PFS) rate were 74.7% and 61.7%, respectively. Males and those with high aaIPI scores (3 points) had a relatively poor prognosis. The NGS results of 23 patients showed that STAT6 (65.2%), SOCS1 (56.5%), and TNFAIP3 (56.5%) were the most common mutated genes. Patients with stable disease (SD)/progressive disease (PD) exhibited enrichment in cell cycle, FoxO, and TNF signaling pathways. A total of 29 patients underwent end-of-treatment PET/CT (EOT PET/CT), and 16 of them received ctDNA monitoring with 12 negative. Among 6 patients with EOT PET/CT positive (Deauville 4), 4 underwent ctDNA monitoring, and 3 of them were negative, being still in continuous remission without any subsequent anti-tumor therapy.
CONCLUSION
CtDNA may be combined with PET/CT to assess efficacy, monitor relapse, and guide treatment of PMBCL.
Humans
;
Circulating Tumor DNA/blood*
;
Female
;
Mediastinal Neoplasms
;
Male
;
Retrospective Studies
;
High-Throughput Nucleotide Sequencing
;
Prognosis
;
Lymphoma, Large B-Cell, Diffuse/genetics*
;
Middle Aged
;
Adult
;
Aged
;
Neoplasm Recurrence, Local
;
Mutation
10.A novel anti-ischemic stroke candidate drug AAPB with dual effects of neuroprotection and cerebral blood flow improvement.
Jianbing WU ; Duorui JI ; Weijie JIAO ; Jian JIA ; Jiayi ZHU ; Taijun HANG ; Xijing CHEN ; Yang DING ; Yuwen XU ; Xinglong CHANG ; Liang LI ; Qiu LIU ; Yumei CAO ; Yan ZHONG ; Xia SUN ; Qingming GUO ; Tuanjie WANG ; Zhenzhong WANG ; Ya LING ; Wei XIAO ; Zhangjian HUANG ; Yihua ZHANG
Acta Pharmaceutica Sinica B 2025;15(2):1070-1083
Ischemic stroke (IS) is a globally life-threatening disease. Presently, few therapeutic medicines are available for treating IS, and rt-PA is the only drug approved by the US Food and Drug Administration (FDA) in the US. In fact, many agents showing excellent neuroprotection but no blood flow-improving activity in animals have not achieved ideal clinical efficacy, while thrombolytic drugs only improving blood flow without neuroprotection have limited their wider application. To address these challenges and meet the huge unmet clinical need, we have designed and identified a novel compound AAPB with dual effects of neuroprotection and cerebral blood flow improvement. AAPB significantly reduced cerebral infarction and neural function deficit in tMCAO rats, pMCAO rats, and IS rhesus monkeys, as well as displayed exceptional safety profiles and excellent pharmacokinetic properties in rats and dogs. AAPB has now entered phase I of clinical trials fighting IS in China.

Result Analysis
Print
Save
E-mail