Lung cancer constitutes the most prevalent and lethal malignant tumor in China. Approximately 85% of lung cancer diagnoses correspond to the non-small cell histological subtype [non-small cell lung cancer (NSCLC)]. Despite surgery being the mainstay for early-stage disease, postoperative recurrence remains high and adjuvant chemotherapy offers limited benefit. In recent years, targeted therapy has demonstrated substantial advantages in driver mutation-positive NSCLC. To this end, the Lung Cancer Medical Education Committee of the Chinese Medical Education Association developed guidelines based on a systematic review of evidence through November 2025, using the Grading of Recommendations, Assessment, Development and Evaluations (GRADE) approach and a modified Delphi method. Focusing on epidermal growth factor receptor (EGFR) and anaplastic lymphoma kinase (ALK), and addressing ROS proto-oncogene 1 (ROS1), B-Raf proto-oncogene serine/threonine kinase (BRAF) V600E mutation, and mesenchymal-epithelial transition factor (MET) exon 14 (METex14) skipping, the guideline covers molecular testing, neoadjuvant/adjuvant therapy, perioperative strategies, minimal residual disease monitoring, and postoperative surveillance. It defines testing requirements, specifies stage-directed and subtype-specific treatments, and standardizes minimal residual disease monitoring. These recommendations emphasize precision and feasibility to improve survival and quality of life.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Objective:To evaluate the safety of neoadjuvant therapy with pembrolizumab combined with 5-fluorouracil (5-FU) and cisplatin in patients with advanced temporal bone squamous cell carcinoma (TBSCC), and its impact on tumor response rate and disease-free survival (DFS).Methods:This prospective, single-arm, open-label clinical study enrolled patients with advanced (Stage Ⅲ/Ⅳ) TBSCC from Sun Yat-sen Memorial Hospital. Patients received 2-3 cycles of neoadjuvant therapy with pembrolizumab, 5-FU, and cisplatin, followed by definitive surgery. Postoperatively, patients received 6 cycles of pembrolizumab combined with radiotherapy. The primary endpoint was the 2-year disease-free survival (DFS) rate. Secondary endpoints included objective response rate (ORR) and safety indicators. Survival analysis was performed using the Kaplan-Meier method. Adverse events (AE) were assessed using the National Cancer Institute′s Common Terminology Criteria for Adverse Events (CTCAE), version 5.0. Statistical analyses were conducted using SPSS software, version 22.0.Results:From August 2021 to April 2024, 16 patients with advanced TBSCC were enrolled (13 males and 3 females), with a median age of 54 years and a median follow-up time of 2.32 years. Following neoadjuvant therapy, the objective response rate (ORR) was 64.3% (9/14), and the disease control rate (DCR) was 92.9% (13/14). The 2-year DFS rate was 86.6%. Common treatment-related adverse events (TRAE) included leukopenia (56.3%, 9/16), nausea and vomiting (50.0%, 8/16), diarrhea, oral mucositis, and elevated liver function tests (25.0%, 4/16). One patient (6.25%) experienced a grade 3 adverse event.Conclusion:Neoadjuvant pembrolizumab-chemotherapy significantly enhances objective response rate and disease-free survival in advanced TBSCC.

In this study,indigo-dyed cotton and silk textiles were subjected to simulated aging treatments by ultraviolet light(UV)and hydrochloric acid solution(pH=2)according to the potential preservation environments of ancient textile cultural relics.Scanning electron microscope(SEM)was used for microstructural observation of the simulated textiles,and a combination method of ultra-high performance liquid chromatography-quadrupole time-of-flight mass spectrometry(UPLC-Q-TOF-MS)and portable Raman spectroscopy(P-RS)was developed for detection of indigo dye in cotton and silk textiles before and after aging.The results revealed that,in silk samples after UV aging and acid aging,the indigo dye along with isatin which was the indigo degradation product could be detected by UPLC-Q-TOF-MS,while in cotton samples after UV aging and acid aging,the signal of isatin was less prominent although the characteristic peaks of indigo were detectable.However,the characteristic signals of indigo in both UV-aged and acid aged textiles could be effectively detected by P-RS,which provided a quick and convenient method for detection of indigo dye in textiles.Compared with UV aging and acid aging,acid-aged samples exhibited a more robust signal response to indigo dye,offering a rapid and non-destructive method for indigo detection.The developed UPLC-Q-TOF-MS and P-RS methods could be used in efficient and rapid identification of indigo dye,which hold potential in the preservation and restoration of ancient textile cultural relics.

Sarin(GB)is a typical representative of nerve agents with high toxicity,and very low amount can cause death.GB can cause water and atmospheric environment poisoning,so the detection of GB in water and air is of great significance.In this work,a colorimetric sensor array(CSA)based on GB inhibition of cholinesterase activity was constructed to detect GB with high selectivity.A 4×4 colorimetric array was constructed using acetylcholinesterase(AChE),butyryl cholinesterase(BuChE)and the corresponding substrate acetylthiocholine iodide(S-ACh),butyryl thiocholine iodide(S-BCh),acetylcholine chloride(ACh),butyryl choline chloride(BCh)and 2,6-dichloroindophenol ethyl ester(DCIE).The linear curve of the sensor was Y=131.3×lgC+271.6(R2=0.997),where Y was the array response Euclidean distance,C was the concentration of GB(mg/L),the linear range was 0.03?0.32 mg/L,and the detection limit was 27.6 μg/L.The method could effectively distinguish chemical warfare agents(CWA)such as VX,Soman(GD),mustard gas(HD),Louie reagent(L),and had high anti-interference ability,sensitivity and good repeatability.It was successfully applied to the detection of GB in simulated water and simulated air samples,and the sample recovery rate was 97.2% ?100.9%.This method would be potentially applied to the field rapid detection of nerve agents.

Background: and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking. Methods: This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance. Results: Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal. Conclusions The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.

This study explores whether the current external quality assessment (EQA) level and acceptable bias for basic semen analysis in China are clinically useful. We collected data of semen EQA from Andrology laboratories in the Hunan Province (China) in 2022 and searched for data in the published literature from January 2000 to December 2023 in China. On the basis of these data, we analyzed the coefficients of variation and acceptable biases of different quality control materials for basic semen analysis through robust statistics. We compared these findings with quality specifications based on biological variation from optimal, desirable, and minimum levels of bias to seek a unified and more suitable semen EQA bias evaluation standard for China's national conditions. Different sources of semen quality control material exhibited considerable variation in acceptable biases among laboratories, ranging from 8.2% to 56.9%. A total of 50.0% of the laboratories met the minimum quality specifications for progressive motility (PR), whereas 100.0% and 75.0% of laboratories met only the minimum quality specifications for sperm concentration and total motility (nonprogressive [NP] + PR), respectively. The Z value for sperm concentration and PR+NP was equivalent to the desirable performance specification, whereas the Z value for PR was equivalent only to the minimum performance specification. This study highlights the feasibility of operating external quality assessment schemes for basic semen analysis using quality specifications based on biological variation. These specifications should be unified among external quality control (EQC) centers based on biological variation.
Semen Analysis/standards* ; Humans ; China ; Male ; Quality Control ; Sperm Motility ; Sperm Count/standards*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To investigate the molecular epidemiology of children with phenylketonuria (PKU) in Gansu, China, providing foundational data for intervention strategies. METHODS: A retrospective analysis was conducted on 1 159 PKU families who attended Gansu Provincial Maternity and Child Care Hospital from January 2012 to December 2024. Sanger sequencing, multiplex ligation-dependent probe amplification, whole exome sequencing, and deep intronic variant analysis were used to analyze the PAH gene. RESULTS: For the 1 159 children with PKU, 2 295 variants were identified in 2 318 alleles, resulting in a detection rate of 99.01%. The detection rates were 100% (914/914) in 457 classic PKU families, 99.45% (907/912) in 456 mild PKU families, and 96.34% (474/492) in 246 mild hyperphenylalaninemia families. The 2 295 variants detected comprised 208 distinct mutation types, among which c.728G>A (14.95%, 343/2 295) had the highest frequency, followed by c.611A>G (4.88%, 112/2 295) and c.721C>T (4.79%, 110/2 295). The cumulative frequency of the top 23 hotspot variants reached 70.28% (1 613/2 295), and most variant alleles were detected in exon 7 (29.19%, 670/2 295). CONCLUSIONS Deep intronic variant analysis of the PAH gene can improve the genetic diagnostic rate of PKU. The development of targeted detection kits for PAH hotspot variants may enable precision screening programs and enhance preventive strategies for PKU.
Humans ; Phenylketonurias/epidemiology* ; Female ; Male ; Retrospective Studies ; Phenylalanine Hydroxylase/genetics* ; Mutation ; Child, Preschool ; China/epidemiology* ; Child ; Infant

OBJECTIVE: To explore the clinical significance of circulating tumor DNA (ctDNA) in response evaluation and relapse monitoring for patients with primary mediastinal large B-cell lymphoma (PMBCL). METHODS: The clinical characteristics, efficacy and survival of 38 PMBCL patients in our hospital from January 2010 to April 2020 were retrospectively analyzed. The ctDNA monitoring was conducted by targeted next-generation sequencing (NGS). RESULTS: Among the 38 patients, 26 cases were female, and 32 cases were diagnosed with Ann Arbor stage I-II. The 5-year overall survival (OS) rate and progression-free survival (PFS) rate were 74.7% and 61.7%, respectively. Males and those with high aaIPI scores (3 points) had a relatively poor prognosis. The NGS results of 23 patients showed that STAT6 (65.2%), SOCS1 (56.5%), and TNFAIP3 (56.5%) were the most common mutated genes. Patients with stable disease (SD)/progressive disease (PD) exhibited enrichment in cell cycle, FoxO, and TNF signaling pathways. A total of 29 patients underwent end-of-treatment PET/CT (EOT PET/CT), and 16 of them received ctDNA monitoring with 12 negative. Among 6 patients with EOT PET/CT positive (Deauville 4), 4 underwent ctDNA monitoring, and 3 of them were negative, being still in continuous remission without any subsequent anti-tumor therapy. CONCLUSION CtDNA may be combined with PET/CT to assess efficacy, monitor relapse, and guide treatment of PMBCL.
Humans ; Circulating Tumor DNA/blood* ; Female ; Mediastinal Neoplasms ; Male ; Retrospective Studies ; High-Throughput Nucleotide Sequencing ; Prognosis ; Lymphoma, Large B-Cell, Diffuse/genetics* ; Middle Aged ; Adult ; Aged ; Neoplasm Recurrence, Local ; Mutation