Objective To study the five-year survival status and influencing factors of elderly patients with lung cancer complicated with chronic obstructive pulmonary disease (COPD). Methods A cohort study was conducted to follow up 450 patients with lung cancer and chronic obstructive pulmonary disease who were hospitalized in our hospital from January 2018 to December 2023. The endpoint of the follow-up was the end of a five-year period or death. The Life Tables method was used to calculate survival rates and plot survival curves. The Cox proportional hazards model was used to analyze the influencing factors of five-year survival. Results The results indicated that the overall five-year survival rate of patients was 4.89%, and it decreased year by year. Cox regression analysis showed that age, gender, family functioning, and psychological status significantly influenced patient survival rate (all P<0.05). Stratified analysis found that the smoking status, family functioning, and psychological status of male patients all had an impact on survival rate (all P<0.05), while the psychological status of female patients had a more significant impact on survival (P=0.008). Conclusion This study provides a scientific basis for comprehensive intervention of elderly lung cancer patients with COPD. It is recommended that clinical attention should be paid to psychological and family factors to improve patient prognosis.

Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.

Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.

Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.

Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To investigate the structural changes of rat thoracic aorta and changes in expression levels of Bmal1 and cyclins in thoracic aorta endothelial cells following heat stress. METHODS: Twenty male SD rats were randomized equally into control group and heat stress group. After exposure to 32 ℃ for 2 weeks in the latter group, the rats were examined for histopathological changes and Bmal1 expression in the thoracic aorta using HE staining and immunohistochemistry. In the cell experiments, cultured rat thoracic aortic endothelial cells (RTAECs) were incubated at 40 ℃ for 12 h with or without prior transfection with a Bmal1-specific small interfering RNA (si-Bmal1) or a negative sequence. In both rat thoracic aorta and RTAECs, the expressions of Bmal1, the cell cycle proteins CDK1, CDK4, CDK6, and cyclin B1, and apoptosis-related proteins Bax and Bcl-2 were detected using Western blotting. TUNEL staining was used to detect cell apoptosis in rat thoracic aorta, and the changes in cell cycle distribution and apoptosis in RTAECs were analyzed with flow cytometry. RESULTS: Compared with the control rats, the rats exposed to heat stress showed significantly increased blood pressures and lowered heart rate with elastic fiber disruption and increased expressions of Bmal1, cyclin B1 and CDK1 in the thoracic aorta (P<0.05). In cultured RTAECs, heat stress caused significant increase of Bmal1, cyclin B1 and CDK1 protein expression levels, which were obviously lowered in cells with prior si-Bmal1 transfection. Bmal1 knockdown also inhibited heat stress-induced increase of apoptosis in RTAECs as evidenced by decreased expression of Bax and increased expression of Bcl-2. CONCLUSIONS Heat stress upregulates Bmal1 expression and causes alterations in expressions of cyclins to trigger apoptosis of rat thoracic aorta endothelial cells, which can be partly alleviated by suppressing Bmal1 expression.
Animals ; ARNTL Transcription Factors/genetics* ; Male ; Aorta, Thoracic/metabolism* ; Rats ; Rats, Sprague-Dawley ; Endothelial Cells/metabolism* ; Apoptosis ; Cells, Cultured ; Heat-Shock Response ; Cyclin B1/metabolism* ; CDC2 Protein Kinase/metabolism* ; Cyclins/metabolism* ; RNA, Small Interfering ; bcl-2-Associated X Protein/metabolism*

Objective To investigate the expressions of annexin A2 and glycogen synthesis kinase-3β(GSK-3β)in cutaneous squamous cell carcinoma(CSCC)tissues,and to analyze their correlation with CSCC as well as their clinical pathological diagnostic value.Methods The pathological tissues of 68 patients with CSCC and 40 patients with keratoacanthoma(KA)who underwent surgical treatment in the Department of Dermatology of the Second Hospital of Nanning from October 2020 to May 2024 were collected,and the surrounding normal skin tissues of 32 patients with benign skin diseases were used as controls.The expressions of annexin A2,GSK-3β and β-catenin were detected by immunohistochemistry and Western blotting.Spearman was used to evaluate the correlation between the expressions of annexin A2 and GSK-3β and the pathological characteristics in CSCC.The receiver operating characteristic(ROC)curve was drawn to analyze the clinical diagnostic value of annexin A2 and GSK-3β in CSCC.Results Compared with the normal skin tissues,the expressions of annexin A2 and β-catenin in CSCC increased,and GSK-3β decreased(P＜0.05);Compared with the KA tissues,the expression of annexin A2 in CSCC tissues increased(P＜0.05).The expression of annexin A2 was negatively correlated with that of GSK-3β in CSCC(r=-0.3901,P＜0.01).GSK-3β expression was related to tissue differentiation,with lower expression in poorly differentiated patients'cancer tissues(P＜0.05).The sensitivity of annexin A2 and GSK-3β for diagnosis of CSCC was 85.3%and 41.2%,respectively,with specificities of 46.9%and 84.4%respectively.The sensitivity of annexin A2 for distinguishing between CSCC and KA was 85.3%,with a specificity of 40.0%.Conclusion Annexin A2 and GSK-3β may be used as potential biomarkers for the early diagnosis or differential diagnosis of CSCC,and play important roles in the development of CSCC.Their mechanism may be related to the activation of Wnt/β-catenin signaling pathway.

Objective To investigate the associations of reproductive health indicators with lung function and chronic obstructive pulmonary disease(COPD)among women aged 40 years and above.Methods From Jul to Sep,2021,female subjects aged 40 years and above were randomly selected from the Shanghai Suburban Adult Cohort and Biobank for COPD screening.A questionnaire was used to obtain information on demographic characteristics and reproductive health indicators.Linear regression was used to analyze the effects of reproductive health indicators on forced vital capacity(FVC)and forced expiratory volume in the first second(FEV1).Logistic regression was also used to analyze the effects of reproductive health factors on FVC as a percentage of the predicted value(FVC%Pred)and FEV1%Pred as well as on COPD.Results A total of 1876 women aged 40 years and above were enrolled with mean age of(62.1±8.2)years old,among them,78.1%were menopausal,and 40.9%had been pregnant≥3 times.Multivariate analysis showed that FVC and FEV1 decreased in postmenopausal women,but menopause was not associated with a decrease in their percentage of predicted values.Pregnancies≥3 times was a risk factor for COPD(for 3 times,OR=4.92,95%CI:1.48-19.95,P<0.05;for≥4 times,OR=9.06,95%CI:2.32-41.57,P<0.01),while pregnancies of 2 times did not increase the risk of COPD.Conclusion In women aged 40 years and above,menopause is associated with poorer FVC and FEV1,and excessive pregnancy(≥3 times)is a risk factor for COPD.

Objective To explore the evidence,urinary biomarkers,and partial mechanisms of hypercoagulability in the pathogenesis of IgA vasculitis(IgAV).Methods Differential expression of proteins in the urine of 10 healthy children and 10 children with IgAV was screened using high-performance liquid chromatography-tandem mass spectrometry,followed by Reactome pathway analysis.Protein-protein interaction(PPI)network analysis was conducted using STRING and Cytoscape software.In the validation cohort,15 healthy children and 25 children with IgAV were included,and the expression levels of differential urinary proteins were verified using enzyme-linked immunosorbent assay.Results A total of 772 differential proteins were identified between the IgAV group and the control group,with 768 upregulated and 4 downregulated.Reactome pathway enrichment results showed that neutrophil degranulation,platelet activation,and hemostasis pathways were involved in the pathogenesis of IgAV.Among the differential proteins,macrophage migration inhibitory factor(MIF)played a significant role in neutrophil degranulation and hemostasis,while thrombin was a key protein in platelet activation and hemostasis pathways.PPI analysis indicated that thrombin directly interacted with several proteins involved in inflammatory responses,and these interactions involved MIF.Validation results showed that compared to healthy children,children with IgAV had significantly higher urine thrombin/creatinine and urine MIF/creatinine levels(P<0.05).Conclusions Thrombin contributes to the pathogenesis of IgAV through interactions with inflammatory factors.Urinary thrombin and MIF can serve as biomarkers reflecting the hypercoagulable and inflammatory states in children with IgAV.