1.Five-year survival analysis and influencing factors of elderly lung cancer patients with chronic obstructive pulmonary disease in Mianyang City
Haishi XUE ; Ling HUANG ; Junjie XIA ; Yu QIU ; Ke GE ; Jincheng WANG ; Yuting CHEN ; Runjiao CHEN ; Lingna LI ; An LAN ; Yan HOU
Journal of Public Health and Preventive Medicine 2026;37(1):138-141
Objective To study the five-year survival status and influencing factors of elderly patients with lung cancer complicated with chronic obstructive pulmonary disease (COPD). Methods A cohort study was conducted to follow up 450 patients with lung cancer and chronic obstructive pulmonary disease who were hospitalized in our hospital from January 2018 to December 2023. The endpoint of the follow-up was the end of a five-year period or death. The Life Tables method was used to calculate survival rates and plot survival curves. The Cox proportional hazards model was used to analyze the influencing factors of five-year survival. Results The results indicated that the overall five-year survival rate of patients was 4.89%, and it decreased year by year. Cox regression analysis showed that age, gender, family functioning, and psychological status significantly influenced patient survival rate (all P<0.05). Stratified analysis found that the smoking status, family functioning, and psychological status of male patients all had an impact on survival rate (all P<0.05), while the psychological status of female patients had a more significant impact on survival (P=0.008). Conclusion This study provides a scientific basis for comprehensive intervention of elderly lung cancer patients with COPD. It is recommended that clinical attention should be paid to psychological and family factors to improve patient prognosis.
2.Progress on the hazards and control of ship-borne vector organisms
Yun-chuan HE ; Hui-ling HAO ; Bin SUN ; Hong-yan LYU ; Deng-yong HOU ; Xiao-meng REN
Acta Parasitologica et Medica Entomologica Sinica 2026;33(2):144-151
In the context of burgeoning economic trade, there has been a remarkable increase in the number of ships travelling between domestic and international ports. Inbound and outbound cargo ships, cruise liners, ferries, and other types of vessels have emerged as critical vehicles for the dispersal of vector organisms and the spread of infectious disease agents. Public health concerns associated with these vessels represent a significant threat to human welfare. In this paper, we comprehensively review the hazards posed by vector organisms on ships, the latest advances in prevention and control strategies, and proposes appropriate countermeasures. The aim is to provide effective guidance for the prevention and control of public health security issues caused by ship-borne vector organisms.
3.Heat stress affects expression levels of circadian clock gene Bmal1 and cyclins in rat thoracic aortic endothelial cells.
Xiaoyu CHANG ; Hanwen ZHANG ; Hongting CAO ; Ling HOU ; Xin MENG ; Hong TAO ; Yan LUO ; Guanghua LI
Journal of Southern Medical University 2025;45(7):1353-1362
OBJECTIVES:
To investigate the structural changes of rat thoracic aorta and changes in expression levels of Bmal1 and cyclins in thoracic aorta endothelial cells following heat stress.
METHODS:
Twenty male SD rats were randomized equally into control group and heat stress group. After exposure to 32 ℃ for 2 weeks in the latter group, the rats were examined for histopathological changes and Bmal1 expression in the thoracic aorta using HE staining and immunohistochemistry. In the cell experiments, cultured rat thoracic aortic endothelial cells (RTAECs) were incubated at 40 ℃ for 12 h with or without prior transfection with a Bmal1-specific small interfering RNA (si-Bmal1) or a negative sequence. In both rat thoracic aorta and RTAECs, the expressions of Bmal1, the cell cycle proteins CDK1, CDK4, CDK6, and cyclin B1, and apoptosis-related proteins Bax and Bcl-2 were detected using Western blotting. TUNEL staining was used to detect cell apoptosis in rat thoracic aorta, and the changes in cell cycle distribution and apoptosis in RTAECs were analyzed with flow cytometry.
RESULTS:
Compared with the control rats, the rats exposed to heat stress showed significantly increased blood pressures and lowered heart rate with elastic fiber disruption and increased expressions of Bmal1, cyclin B1 and CDK1 in the thoracic aorta (P<0.05). In cultured RTAECs, heat stress caused significant increase of Bmal1, cyclin B1 and CDK1 protein expression levels, which were obviously lowered in cells with prior si-Bmal1 transfection. Bmal1 knockdown also inhibited heat stress-induced increase of apoptosis in RTAECs as evidenced by decreased expression of Bax and increased expression of Bcl-2.
CONCLUSIONS
Heat stress upregulates Bmal1 expression and causes alterations in expressions of cyclins to trigger apoptosis of rat thoracic aorta endothelial cells, which can be partly alleviated by suppressing Bmal1 expression.
Animals
;
ARNTL Transcription Factors/genetics*
;
Male
;
Aorta, Thoracic/metabolism*
;
Rats
;
Rats, Sprague-Dawley
;
Endothelial Cells/metabolism*
;
Apoptosis
;
Cells, Cultured
;
Heat-Shock Response
;
Cyclin B1/metabolism*
;
CDC2 Protein Kinase/metabolism*
;
Cyclins/metabolism*
;
RNA, Small Interfering
;
bcl-2-Associated X Protein/metabolism*
4.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
5.Guideline for Adult Weight Management in China
Weiqing WANG ; Qin WAN ; Jianhua MA ; Guang WANG ; Yufan WANG ; Guixia WANG ; Yongquan SHI ; Tingjun YE ; Xiaoguang SHI ; Jian KUANG ; Bo FENG ; Xiuyan FENG ; Guang NING ; Yiming MU ; Hongyu KUANG ; Xiaoping XING ; Chunli PIAO ; Xingbo CHENG ; Zhifeng CHENG ; Yufang BI ; Yan BI ; Wenshan LYU ; Dalong ZHU ; Cuiyan ZHU ; Wei ZHU ; Fei HUA ; Fei XIANG ; Shuang YAN ; Zilin SUN ; Yadong SUN ; Liqin SUN ; Luying SUN ; Li YAN ; Yanbing LI ; Hong LI ; Shu LI ; Ling LI ; Yiming LI ; Chenzhong LI ; Hua YANG ; Jinkui YANG ; Ling YANG ; Ying YANG ; Tao YANG ; Xiao YANG ; Xinhua XIAO ; Dan WU ; Jinsong KUANG ; Lanjie HE ; Wei GU ; Jie SHEN ; Yongfeng SONG ; Qiao ZHANG ; Hong ZHANG ; Yuwei ZHANG ; Junqing ZHANG ; Xianfeng ZHANG ; Miao ZHANG ; Yifei ZHANG ; Yingli LU ; Hong CHEN ; Li CHEN ; Bing CHEN ; Shihong CHEN ; Guiyan CHEN ; Haibing CHEN ; Lei CHEN ; Yanyan CHEN ; Genben CHEN ; Yikun ZHOU ; Xianghai ZHOU ; Qiang ZHOU ; Jiaqiang ZHOU ; Hongting ZHENG ; Zhongyan SHAN ; Jiajun ZHAO ; Dong ZHAO ; Ji HU ; Jiang HU ; Xinguo HOU ; Bimin SHI ; Tianpei HONG ; Mingxia YUAN ; Weibo XIA ; Xuejiang GU ; Yong XU ; Shuguang PANG ; Tianshu GAO ; Zuhua GAO ; Xiaohui GUO ; Hongyi CAO ; Mingfeng CAO ; Xiaopei CAO ; Jing MA ; Bin LU ; Zhen LIANG ; Jun LIANG ; Min LONG ; Yongde PENG ; Jin LU ; Hongyun LU ; Yan LU ; Chunping ZENG ; Binhong WEN ; Xueyong LOU ; Qingbo GUAN ; Lin LIAO ; Xin LIAO ; Ping XIONG ; Yaoming XUE
Chinese Journal of Endocrinology and Metabolism 2025;41(11):891-907
Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.
6.Identification and Potential Clinical Utility of Common Genetic Variants in Gestational Diabetes among Chinese Pregnant Women
Claudia Ha-ting TAM ; Ying WANG ; Chi Chiu WANG ; Lai Yuk YUEN ; Cadmon King-poo LIM ; Junhong LENG ; Ling WU ; Alex Chi-wai NG ; Yong HOU ; Kit Ying TSOI ; Hui WANG ; Risa OZAKI ; Albert Martin LI ; Qingqing WANG ; Juliana Chung-ngor CHAN ; Yan Chou YE ; Wing Hung TAM ; Xilin YANG ; Ronald Ching-wan MA
Diabetes & Metabolism Journal 2025;49(1):128-143
Background:
The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications.
Methods:
We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants.
Results:
Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals.
Conclusion
Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.
7.Identification and Potential Clinical Utility of Common Genetic Variants in Gestational Diabetes among Chinese Pregnant Women
Claudia Ha-ting TAM ; Ying WANG ; Chi Chiu WANG ; Lai Yuk YUEN ; Cadmon King-poo LIM ; Junhong LENG ; Ling WU ; Alex Chi-wai NG ; Yong HOU ; Kit Ying TSOI ; Hui WANG ; Risa OZAKI ; Albert Martin LI ; Qingqing WANG ; Juliana Chung-ngor CHAN ; Yan Chou YE ; Wing Hung TAM ; Xilin YANG ; Ronald Ching-wan MA
Diabetes & Metabolism Journal 2025;49(1):128-143
Background:
The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications.
Methods:
We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants.
Results:
Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals.
Conclusion
Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.
8.Identification and Potential Clinical Utility of Common Genetic Variants in Gestational Diabetes among Chinese Pregnant Women
Claudia Ha-ting TAM ; Ying WANG ; Chi Chiu WANG ; Lai Yuk YUEN ; Cadmon King-poo LIM ; Junhong LENG ; Ling WU ; Alex Chi-wai NG ; Yong HOU ; Kit Ying TSOI ; Hui WANG ; Risa OZAKI ; Albert Martin LI ; Qingqing WANG ; Juliana Chung-ngor CHAN ; Yan Chou YE ; Wing Hung TAM ; Xilin YANG ; Ronald Ching-wan MA
Diabetes & Metabolism Journal 2025;49(1):128-143
Background:
The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications.
Methods:
We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants.
Results:
Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals.
Conclusion
Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.
9.Identification and Potential Clinical Utility of Common Genetic Variants in Gestational Diabetes among Chinese Pregnant Women
Claudia Ha-ting TAM ; Ying WANG ; Chi Chiu WANG ; Lai Yuk YUEN ; Cadmon King-poo LIM ; Junhong LENG ; Ling WU ; Alex Chi-wai NG ; Yong HOU ; Kit Ying TSOI ; Hui WANG ; Risa OZAKI ; Albert Martin LI ; Qingqing WANG ; Juliana Chung-ngor CHAN ; Yan Chou YE ; Wing Hung TAM ; Xilin YANG ; Ronald Ching-wan MA
Diabetes & Metabolism Journal 2025;49(1):128-143
Background:
The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications.
Methods:
We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants.
Results:
Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals.
Conclusion
Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.
10.Expression and clinical significance of annexin A2 and glycogen synthase kinase-3β in cutaneous squamous cell carcinoma
Wen-Qun JIANG ; Pin-Pin HOU ; Mei-Le TAN ; Lin-Quan GAN ; Ling-Yan WU ; Xian-Gui CHENG
Acta Anatomica Sinica 2025;56(3):294-300
Objective To investigate the expressions of annexin A2 and glycogen synthesis kinase-3β(GSK-3β)in cutaneous squamous cell carcinoma(CSCC)tissues,and to analyze their correlation with CSCC as well as their clinical pathological diagnostic value.Methods The pathological tissues of 68 patients with CSCC and 40 patients with keratoacanthoma(KA)who underwent surgical treatment in the Department of Dermatology of the Second Hospital of Nanning from October 2020 to May 2024 were collected,and the surrounding normal skin tissues of 32 patients with benign skin diseases were used as controls.The expressions of annexin A2,GSK-3β and β-catenin were detected by immunohistochemistry and Western blotting.Spearman was used to evaluate the correlation between the expressions of annexin A2 and GSK-3β and the pathological characteristics in CSCC.The receiver operating characteristic(ROC)curve was drawn to analyze the clinical diagnostic value of annexin A2 and GSK-3β in CSCC.Results Compared with the normal skin tissues,the expressions of annexin A2 and β-catenin in CSCC increased,and GSK-3β decreased(P<0.05);Compared with the KA tissues,the expression of annexin A2 in CSCC tissues increased(P<0.05).The expression of annexin A2 was negatively correlated with that of GSK-3β in CSCC(r=-0.3901,P<0.01).GSK-3β expression was related to tissue differentiation,with lower expression in poorly differentiated patients'cancer tissues(P<0.05).The sensitivity of annexin A2 and GSK-3β for diagnosis of CSCC was 85.3%and 41.2%,respectively,with specificities of 46.9%and 84.4%respectively.The sensitivity of annexin A2 for distinguishing between CSCC and KA was 85.3%,with a specificity of 40.0%.Conclusion Annexin A2 and GSK-3β may be used as potential biomarkers for the early diagnosis or differential diagnosis of CSCC,and play important roles in the development of CSCC.Their mechanism may be related to the activation of Wnt/β-catenin signaling pathway.


Result Analysis
Print
Save
E-mail