ObjectiveTo investigate the role of DEAD-box helicase 3 X-linked （DDX3X） in immune-mediated liver injury （ILI）， and to clarify its mechanism by regulating endoplasmic reticulum stress （ERS）-dependent apoptotic pathway and its association with the clinical progression of hepatitis B. MethodsMice were given injection of concanavalin A （ConA） via the caudal vein to establish a model of ILI， PBS （control group） and different concentrations of ConA were injected into the tail vein of hepatocyte-specific DDX3X-knockout mice （DDX3X^ΔHep and DDX3X-flox mice （DDX3X^fl/fl）， respectively.. The log-rank survival analysis， measurement of the serum levels of aspartate aminotransferase （AST） and alanine aminotransferase （ALT）， and HE staining of liver tissue were performed to assess liver injury， and qRT-PCR and Western Blot were used to measure the mRNA and protein expression levels of glucose-regulated protein 78 （GRP78）， CCAAT/enhancer-binding protein homologous protein （CHOP）， and DDX3X in liver tissue. Intraperitoneal injection of 4-phenylbutyric acid （4-PBA， 100 mg/kg） was performed to inhibit ERS. Serum samples （n=30） and liver tissue samples （n=6） were collected from healthy controls， chronic hepatitis B （CHB） patients， and hepatitis B virus-associated liver failure （HBV-LF） patients； ELISA was used to measure the serum level of DDX3X， and qRT-PCR/Western Blot was used to analyze the expression of targets in liver tissue. A one-way analysis of variance was used for comparison of continuous data between multiple groups， and the least significant difference t-test was used for further comparison between two groups. ResultsCompared with the control group of mice， the expression of DDX3X in the liver of mice induced by ConA was significantly increased after liver injury （P<0.05）， and hepatocyte-specific DDX3X knockout increased the 72-hour survival rate of mice by 55% （compared with 20% in the DDX3X^fl/fl group）， with significant reductions in the serum levels of ALT and AST （P<0.000 1） and the expression levels of the ERS markers GRP78 and CHOP （P<0.05）. After ERS was inhibited by 4-PBA， there was alleviation of liver injury （with reductions in ALT and AST， P <0.001） and a reduction in DDX3X expression （P<0.01）. The analysis of clinical samples showed that the mRNA and protein expression levels of liver DDX3X in CHB patients and HBV-LF patients were significantly higher than those in healthy controls （all P<0.01）， and there was a significant increase in the serum level of DDX3X in HBV-LF patients （P<0.000 1）. ConclusionDDX3X exacerbates ILI by regulating the ERS-dependent apoptotic pathway （GRP78/CHOP）， and its expression is associated with the progression of hepatitis B. Therefore， it can be used as a potential therapeutic target.

Objective This study reports on the obligatory parasitism of water mites Arrenurus sp. on Anopheles messeae at the Manzhouli Port, Inner Mongolia, China. Methods Duing July 2024, a survey on the mosquito diversity was conducted at the Manzhouli Port. Captured mosquitoes and their ectoparasites were identified to species level. Results A total of 1840 adult mosquitoes were collected, representing species from three genera: Culex(Cx. modestus, Cx. pipiens pallens), Aedes(Ae. dorsalis, Ae. flavidorsalis, Ae. flavescens), and Anopheles (An. messeae). Among all the mosqutioes specimens,3 out of 150 captured An. messeae were found to carry ectoparasitic mites, with number of 2,4,27 mites separately. Morphological and molecular identification reached the same result as water mites(Hydrachnidiae, Hydracrina). COI gene sequence showed 94% similarity with the closest species Arrenurus truncatellus. Conlusions Literature review suggests water mites are host-specific parasitism of mosquito species and herein with the first record of Arrenurus sp. parasiting on An. Messeae in the most high-latitude region globally.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

AIM To investigate the effects of Shuyu Pills combined with evolimus on the epithelial mesenchymal transformation of triple negative breast cancer cells 4T1 and MDA-MB-231 induced by TGF-β1.METHODS The 4T1 and MDA-MB-231 cells were divided into the blank group and the induction group to induce the epithelial mesenchymal transformation with TGF-β1 cytokine treatment,followed by the assignment into the model group,the Shuyu Pills group,the everolimus group and the Shuyu Pills combined with everolimus group.CCK8 method,plate cloning method,cell scratch test and Transewll test were used to detect the proliferation,cloning formation,migration and invasion ability of the cells whose expressions of E-cadherin,N-cadherin,Vimentin,MMP9,MMP2 and pathway proteins PTEN,PI3K,Akt and mTOR were detected by Western blot.RESULTS Compared with the blank group,the induction group displayed a cell morphological change from epithelioid to stromal,decreased expression of E-cadherin protein(P＜0.01);and increased protein expressions of N-cadherin and Vimentin(P＜0.05).Compared with the model group,each group intervened with the medicine displayed decreased proliferation,clone formation,migration and invasion ability of both kinds of cells(P＜0.01);increased protein expressions of PTEN and E-cadherin(P＜0.05,P＜0.01);and decreased protein expressions of PI3K,Akt,mTOR,N-cadherin,Vimentin,MMP9 and MMP2(P＜0.05,P＜0.01);and more significantly in the Shuyu Pills combined with evolimus group(P＜0.05,P＜0.01).CONCLUSION With a more ideal effect than the single uses in inhibiting the TGF-β1-induced epithelial mesenchymal transformation of triple-negative breast cancer cells,the combination use of Shuyu Pills and everolimus may work through the regulation of PI3K/Akt/mTOR signaling pathway.

In this study,indigo-dyed cotton and silk textiles were subjected to simulated aging treatments by ultraviolet light(UV)and hydrochloric acid solution(pH=2)according to the potential preservation environments of ancient textile cultural relics.Scanning electron microscope(SEM)was used for microstructural observation of the simulated textiles,and a combination method of ultra-high performance liquid chromatography-quadrupole time-of-flight mass spectrometry(UPLC-Q-TOF-MS)and portable Raman spectroscopy(P-RS)was developed for detection of indigo dye in cotton and silk textiles before and after aging.The results revealed that,in silk samples after UV aging and acid aging,the indigo dye along with isatin which was the indigo degradation product could be detected by UPLC-Q-TOF-MS,while in cotton samples after UV aging and acid aging,the signal of isatin was less prominent although the characteristic peaks of indigo were detectable.However,the characteristic signals of indigo in both UV-aged and acid aged textiles could be effectively detected by P-RS,which provided a quick and convenient method for detection of indigo dye in textiles.Compared with UV aging and acid aging,acid-aged samples exhibited a more robust signal response to indigo dye,offering a rapid and non-destructive method for indigo detection.The developed UPLC-Q-TOF-MS and P-RS methods could be used in efficient and rapid identification of indigo dye,which hold potential in the preservation and restoration of ancient textile cultural relics.

Background: and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking. Methods: This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance. Results: Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal. Conclusions The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To assess the efficacy of Qingda Granule (QDG) in ameliorating hypertension-induced cardiac damage and investigate the underlying mechanisms involved. METHODS: Twenty spontaneously hypertensive rats (SHRs) were used to develope a hypertension-induced cardiac damage model. Another 10 Wistar Kyoto (WKY) rats were used as normotension group. Rats were administrated intragastrically QDG [0.9 g/(kg•d)] or an equivalent volume of pure water for 8 weeks. Blood pressure, histopathological changes, cardiac function, levels of oxidative stress and inflammatory response markers were measured. Furthermore, to gain insights into the potential mechanisms underlying the protective effects of QDG against hypertension-induced cardiac injury, a network pharmacology study was conducted. Predicted results were validated by Western blot, radioimmunoassay immunohistochemistry and quantitative polymerase chain reaction, respectively. RESULTS: The administration of QDG resulted in a significant decrease in blood pressure levels in SHRs (P<0.01). Histological examinations, including hematoxylin-eosin staining and Masson trichrome staining revealed that QDG effectively attenuated hypertension-induced cardiac damage. Furthermore, echocardiography demonstrated that QDG improved hypertension-associated cardiac dysfunction. Enzyme-linked immunosorbent assay and colorimetric method indicated that QDG significantly reduced oxidative stress and inflammatory response levels in both myocardial tissue and serum (P<0.01). CONCLUSIONS Both network pharmacology and experimental investigations confirmed that QDG exerted its beneficial effects in decreasing hypertension-induced cardiac damage by regulating the angiotensin converting enzyme (ACE)/angiotensin II (Ang II)/Ang II receptor type 1 axis and ACE/Ang II/Ang II receptor type 2 axis.
Animals ; Drugs, Chinese Herbal/therapeutic use* ; Hypertension/pathology* ; Renin-Angiotensin System/drug effects* ; Rats, Inbred SHR ; Oxidative Stress/drug effects* ; Male ; Rats, Inbred WKY ; Blood Pressure/drug effects* ; Myocardium/pathology* ; Rats ; Inflammation/pathology*

OBJECTIVE: To evaluate the efficacy and safety of Shexiang Tongxin Dropping Pill (STDP) in treating stable angina patients with phlegm-heat and blood-stasis syndrome by exercise duration and metabolic equivalents. METHODS: This multicenter, randomized, double-blind, placebo-controlled clinical trial enrolled stable angina patients with phlegm-heat and blood-stasis syndrome from 22 hospitals. They were randomized 1:1 to STDP (35 mg/pill, 6 pills per day) or placebo for 56 days. The primary outcome was the exercise duration and metabolic equivalents (METs) assessed by the standard Bruce exercise treadmill test after 56 days of treatment. The secondary outcomes included the total angina symptom score, Chinese medicine (CM) symptom scores, Seattle Angina Questionnaire (SAQ) scores, changes in ST-T on electrocardiogram and adverse events (AEs). RESULTS: This trial enrolled 309 patients, including 155 and 154 in the STDP and placebo groups, respectively. STDP significantly prolonged exercise duration with an increase of 51.0 s, compared to a decrease of 12.0 s with placebo (change rate: -11.1% vs. 3.2%, P<0.01). The increase in METs was significantly greater in the STDP group than in the placebo group (change: -0.4 vs. 0.0, change rate: -5.0% vs. 0.0%, P<0.01). The improvement of total angina symptom scores (25.0% vs. 0.0%), CM symptom scores (38.7% vs. 11.8%), reduction of nitroglycerin consumption (100.0% vs. 11.3%), and all domains of SAQ, were significantly greater with STDP than placebo (all P<0.01). The changes in Q-T intervals at 28 and 56 days from baseline were similar between the two groups (both P>0.05). Twenty-five participants (16.3%) with STDP and 16 (10.5%) with placebo experienced AEs (P=0.131), with no serious AEs observed. CONCLUSION STDP could improve exercise tolerance in patients with stable angina and phlegm-heat and blood stasis syndrome, with a favorable safety profile. (Registration No. ChiCTR-IPR-15006020).
Humans ; Double-Blind Method ; Drugs, Chinese Herbal/adverse effects* ; Male ; Female ; Middle Aged ; Angina, Stable/physiopathology* ; Aged ; Syndrome ; Treatment Outcome ; Placebos ; Tablets

Digital technologies have become an integral part of complete denture restoration. With advancement in computer-aided design and computer-aided manufacturing (CAD/CAM), tools such as intraoral scanning, facial scanning, 3D printing, and numerical control machining are reshaping the workflow of complete denture restoration. Unlike conventional methods that rely heavily on clinical experience and manual techniques, digital technologies offer greater precision, predictability, and efficacy. They also streamline the process by reducing the number of patient visits and improving overall comfort. Despite these improvements, the clinical application of digital complete denture restoration still faces challenges that require further standardization. The major issues include appropriate case selection, establishing consistent digital workflows, and evaluating long-term outcomes. To address these challenges and provide clinical guidance for practitioners, this expert consensus outlines the principles, advantages, and limitations of digital complete denture technology. The aim of this review was to offer practical recommendations on indications, clinical procedures and precautions, evaluation metrics, and outcome assessment to support digital restoration of complete denture in clinical practice.
Humans ; Denture, Complete ; Computer-Aided Design ; Denture Design/methods* ; Consensus ; Printing, Three-Dimensional