1.Role of endoplasmic reticulum stress-mediated DEAD-box helicase 3 X-linked in a mouse model of concanavalin A-induced immune-mediated liver injury
Zhenzhen PAN ; Ling XU ; Xianru ZHU ; Zihao FAN ; Yaling CAO ; Yinkang MO ; Sai YAN ; Feng REN
Journal of Clinical Hepatology 2026;42(1):134-142
ObjectiveTo investigate the role of DEAD-box helicase 3 X-linked (DDX3X) in immune-mediated liver injury (ILI), and to clarify its mechanism by regulating endoplasmic reticulum stress (ERS)-dependent apoptotic pathway and its association with the clinical progression of hepatitis B. MethodsMice were given injection of concanavalin A (ConA) via the caudal vein to establish a model of ILI, PBS (control group) and different concentrations of ConA were injected into the tail vein of hepatocyte-specific DDX3X-knockout mice (DDX3XΔHep and DDX3X-flox mice (DDX3Xfl/fl), respectively.. The log-rank survival analysis, measurement of the serum levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT), and HE staining of liver tissue were performed to assess liver injury, and qRT-PCR and Western Blot were used to measure the mRNA and protein expression levels of glucose-regulated protein 78 (GRP78), CCAAT/enhancer-binding protein homologous protein (CHOP), and DDX3X in liver tissue. Intraperitoneal injection of 4-phenylbutyric acid (4-PBA, 100 mg/kg) was performed to inhibit ERS. Serum samples (n=30) and liver tissue samples (n=6) were collected from healthy controls, chronic hepatitis B (CHB) patients, and hepatitis B virus-associated liver failure (HBV-LF) patients; ELISA was used to measure the serum level of DDX3X, and qRT-PCR/Western Blot was used to analyze the expression of targets in liver tissue. A one-way analysis of variance was used for comparison of continuous data between multiple groups, and the least significant difference t-test was used for further comparison between two groups. ResultsCompared with the control group of mice, the expression of DDX3X in the liver of mice induced by ConA was significantly increased after liver injury (P<0.05), and hepatocyte-specific DDX3X knockout increased the 72-hour survival rate of mice by 55% (compared with 20% in the DDX3Xfl/fl group), with significant reductions in the serum levels of ALT and AST (P<0.000 1) and the expression levels of the ERS markers GRP78 and CHOP (P<0.05). After ERS was inhibited by 4-PBA, there was alleviation of liver injury (with reductions in ALT and AST, P <0.001) and a reduction in DDX3X expression (P<0.01). The analysis of clinical samples showed that the mRNA and protein expression levels of liver DDX3X in CHB patients and HBV-LF patients were significantly higher than those in healthy controls (all P<0.01), and there was a significant increase in the serum level of DDX3X in HBV-LF patients (P<0.000 1). ConclusionDDX3X exacerbates ILI by regulating the ERS-dependent apoptotic pathway (GRP78/CHOP), and its expression is associated with the progression of hepatitis B. Therefore, it can be used as a potential therapeutic target.
2.The first record of Anopheles messeae (Diptera: Culicidae) parasitized by water mites in China
Xue-ru CHEN ; Wen-zhen YAO ; Yu-hao LI ; Gui-chang LI ; Tao MENG ; Qun-ling FENG ; Xin-hui LIU ; Li-hong QIAO ; Xiang-ting WU ; Xue-feng ZHANG ; Cheng-lin LI ; Xue-cheng DONG ; Da-wei WANG ; Xiao-yan SI ; Yu-hong GUO
Acta Parasitologica et Medica Entomologica Sinica 2026;33(1):53-57
Objective This study reports on the obligatory parasitism of water mites Arrenurus sp. on Anopheles messeae at the Manzhouli Port, Inner Mongolia, China. Methods Duing July 2024, a survey on the mosquito diversity was conducted at the Manzhouli Port. Captured mosquitoes and their ectoparasites were identified to species level. Results A total of 1840 adult mosquitoes were collected, representing species from three genera: Culex(Cx. modestus, Cx. pipiens pallens), Aedes(Ae. dorsalis, Ae. flavidorsalis, Ae. flavescens), and Anopheles (An. messeae). Among all the mosqutioes specimens,3 out of 150 captured An. messeae were found to carry ectoparasitic mites, with number of 2,4,27 mites separately. Morphological and molecular identification reached the same result as water mites(Hydrachnidiae, Hydracrina). COI gene sequence showed 94% similarity with the closest species Arrenurus truncatellus. Conlusions Literature review suggests water mites are host-specific parasitism of mosquito species and herein with the first record of Arrenurus sp. parasiting on An. Messeae in the most high-latitude region globally.
3.Research progress in chemical constituents and pharmacological activities of Abelmoschi Corolla and prediction of its quality markers.
Shi-Han GUAN ; Chang LIU ; Xiao-Tong YAN ; Jin-Wei HAN ; Feng-Ting YIN ; Hui SUN ; Guang-Li YAN ; Ling KONG ; Ying HAN ; Xi-Jun WANG
China Journal of Chinese Materia Medica 2025;50(4):908-921
Abelmoschi Corolla, the dried corolla of Abelmoschus manihot, has anti-inflammatory, antioxidant, and anti-fibrosis activities. Its chemical constituents mainly include flavonoids, organic acids, steroids, and polysaccharides. This study reviewed the research progress in the chemical constituents and pharmacological activities of Abelmoschi Corolla in recent 20 years. According to the concept of quality marker(Q-marker), the Q-markers of Abelmoschi Corolla were predicted from plant phylogeny, chemical constituent specificity, traditional efficacy, chemical constituent measurability, and absorbed constituents. The primary Q-markers for Abelmoschi Corolla were anticipated to include quercetin-3'-O-β-D-glucopyranoside, gossypetin-8-O-β-D-glucuronide, isoquercetin, myricetin,quercetin, and hyperoside, with the aim of providing reference data for improving the quality evaluation system of Abelmoschi Corolla.
Abelmoschus/chemistry*
;
Drugs, Chinese Herbal/pharmacology*
;
Flowers/chemistry*
;
Humans
;
Animals
;
Quality Control
;
Flavonoids/chemistry*
4.Prescriptions and syndromes of Chaihu and Longgu Muli Decoction for treatment of tachyarrhythmia accompanied by anxiety state based on Delphi method.
Gang LIU ; Yan-Li LI ; Kui-Po YAN ; Hai-Feng YAN ; Lei ZHANG ; Ming-Yuan DU ; Yi-Zhuo LI ; Cui-Ling ZHU
China Journal of Chinese Materia Medica 2025;50(6):1680-1687
Chaihu and Longgu Muli Decoction has demonstrated significant efficacy in the treatment of tachyarrhythmia accompanied by anxiety and depression. However, there is a lack of standardized guidelines for its clinical application. In this study, the Chaihu and Longgu Muli Decoction was investigated through extensive research on ancient and modern literature, as well as a collection of clinical medical records. The basic information, medication details, and diagnostic information from medical records, personal experience literature, and clinical cases in the treatment of tachyarrhythmia accompanied by anxiety were extracted and analyzed to preliminarily identify the prescription characteristics and syndrome patterns. Subsequently, the Delphi method was employed to construct an item pool based on the data obtained in the first step. An expert questionnaire was prepared to collect scores and revision opinions from experts regarding these items. After statistical analysis and group discussions, a second round of questionnaires was formed by screening out certain items. This process was repeated until a final item set for the treatment of tachyarrhythmia accompanied by anxiety with Chaihu and Longgu Muli Decoction was determined. These findings provided guidance for clinical prescription practices. By extracting 71 syndromes and signs, as well as 33 tongue and pulse characteristics, the main syndrome features included palpitations, chest tightness, irritability, etc., which were basically consistent with the ancient syndromes. Through frequency analysis and group discussions, 71 items were screened out. After screening, modification, and primary and secondary division, 11 main diagnostic items and 10 secondary diagnostic items were determined. On this basis, the research team believes that Chaihu and Longgu Muli Decoction is mainly indicated for the following syndromes in the treatment of tachyarrhythmia accompanied by anxiety(palpitations, poor sleep, bitter taste, dry mouth, irritability/easily angered/anxiety/fearfulness/easily startled, red tongue with greasy yellow coating, rapid pulse, high work/life pressure, tachyarrhythmia on electrocardiogram/Holter monitor, and positive results on anxiety scale). Secondary syndromes include chest tightness, shortness of breath, feeling heavy and weak in the body, sweating, poor appetite, constipation, greasy white tongue coating, wiry pulse, slippery pulse, or knotted and intermittent pulse.
Drugs, Chinese Herbal/therapeutic use*
;
Humans
;
Delphi Technique
;
Anxiety/complications*
;
Tachycardia/psychology*
;
Female
;
Male
;
Middle Aged
;
Adult
;
Aged
5.Effects of total extract of Anthriscus sylvestris on immune inflammation and thrombosis in rats with pulmonary arterial hypertension based on TGF-β1/Smad3 signaling pathway.
Ya-Juan ZHENG ; Pei-Pei YUAN ; Zhen-Kai ZHANG ; Yan-Ling LIU ; Sai-Fei LI ; Yuan RUAN ; Yi CHEN ; Yang FU ; Wei-Sheng FENG ; Xiao-Ke ZHENG
China Journal of Chinese Materia Medica 2025;50(9):2472-2483
This study aimed to explore the effects and mechanisms of total extracts from Anthriscus sylvestris on pulmonary hypertension in rats. Sixty male SD rats were divided into normal(NC) group, model(M) group, positive drug sildenafil(Y) group, low-dose A. sylvestris(ES-L) group, medium-dose A. sylvestris(ES-M) group, and high-dose A. sylvestris(ES-H) group. On day 1, rats were intraperitoneally injected with monocrotaline(60 mg·kg~(-1)) to induce pulmonary hypertension, and the rat model was established on day 28. From days 15 to 28, intragastric administration of the respective treatments was performed. After modeling and treatment, small animal echocardiography was used to detect the right heart function of the rats. Arterial blood gas was measured using a blood gas analyzer. Hematoxylin and eosin(HE) staining and Masson staining were performed to observe cardiopulmonary pathological damage. Flow cytometry was used to detect apoptosis in the lung and myocardial tissues and reactive oxygen species(ROS) levels. Western blot was applied to detect the expression levels of transforming growth factor-β1(TGF-β1), phosphorylated mothers against decapentaplegic homolog 3(p-Smad3), Smad3, tissue plasminogen activator(t-PA), and plasminogen activator inhibitor-1(PAI-1) in lung tissue. A blood routine analyzer was used to measure inflammatory immune cell levels in the blood. Enzyme-linked immunosorbent assay(ELISA) was used to detect the expression levels of P-selectin and thromboxane A2(TXA2) in plasma. The results showed that, compared with the NC group, right heart hypertrophy index, right ventricular free wall thickness, right heart internal diameter, partial carbon dioxide pressure(PaCO_2), apoptosis in cardiopulmonary tissue, and ROS levels were significantly increased in the M group. In contrast, the ratio of pulmonary blood flow acceleration time(PAT)/ejection time(PET), right cardiac output, change rate of right ventricular systolic area, systolic displacement of the tricuspid ring, oxygen partial pressure(PaO_2), and blood oxygen saturation(SaO_2) were significantly decreased in the M group. After administration of the total extract of A. sylvestris, right heart function and blood gas levels were significantly improved, while apoptosis in cardiopulmonary tissue and ROS levels significantly decreased. Further testing revealed that the total extract of A. sylvestris significantly decreased the levels of interleukin-1β(IL-1β), interleukin-6(IL-6), and PAI-1 proteins in lung tissue, while increasing the expression of t-PA. Additionally, the extract reduced the levels of inflammatory cells such as leukocytes, lymphocytes, granulocytes, and monocytes in the blood, as well as the levels of P-selectin and TXA2 in plasma. Metabolomics results showed that the total extract of A. sylvestris significantly affected metabolic pathways, including arginine biosynthesis, tyrosine metabolism, and taurine and hypotaurine metabolism. In conclusion, the total extract of A. sylvestris may exert an anti-pulmonary hypertension effect by inhibiting the TGF-β1/Smad3 signaling pathway, thereby alleviating immune-inflammatory responses and thrombosis.
Animals
;
Male
;
Smad3 Protein/metabolism*
;
Transforming Growth Factor beta1/metabolism*
;
Rats, Sprague-Dawley
;
Rats
;
Signal Transduction/drug effects*
;
Hypertension, Pulmonary/genetics*
;
Thrombosis/immunology*
;
Drugs, Chinese Herbal/administration & dosage*
;
Humans
;
Apoptosis/drug effects*
6.Identification of characteristics, supply channels, and imperial court processing of Arecae Semen in the Qing court.
Feng-Yuan LI ; Hua-Sheng PENG ; Xue-Ling GUAN ; Yan JIN ; Ting YAO ; Yuan YUAN ; Lu-Qi HUANG
China Journal of Chinese Materia Medica 2025;50(11):2924-2930
Qing court records show that Arecae Semen was extensively applied. The royal medical records of the Qing Dynasty document nine types of Arecae Semen, with the Palace Museum preserving seven kinds, totaling twelve cultural relics. Historical documents and physical artifacts corroborate each other, providing evidence for the study of the supply channels and court processing of Arecae Semen in the Qing court. According to relevant Qing court archival records, the sources of Arecae Semen used in the imperial court were diverse, including tributes from foreign countries such as Vietnam and Gurkha, annual tributes from local governments in Guangdong, gifts from close aides, and commodities purchased by the Imperial Household Department from civilian shops. The imperial physicians of the Qing court placed great emphasis on the specifications of Arecae Semen slices and were extremely meticulous about their processing. The variety of Arecae Semen slices used in the Qing palace exceeded those recorded in the botanical texts of the era. Compared with the commonly used processing methods for Arecae Semen in the Qing Dynasty, the imperial physicians adjusted the properties and efficacy of the herbs through different processing techniques, based on the patient's condition, constitution, and other factors, in order to meet the clinical treatment needs of the court. The slicing of Arecae Semen in the Qing court required strict control of thickness, with an average thickness of 0.44 mm, which is significantly thinner than the Arecae Semen slices found in today's markets. The texture was softer, making them easier to chew and absorb. Both the Qing court Arecae Semen slices and the Muxiang Binglang Pills focused on the use of authentic medicinal materials, ensuring the quality of the medicine and enhancing the efficacy of Arecae Semen through meticulous selection and preparation.
China
;
Drugs, Chinese Herbal/history*
;
Humans
;
Medicine, Chinese Traditional/history*
;
History, 19th Century
;
History, Ancient
;
History, 17th Century
;
History, 18th Century
8.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
9.Qingda Granule Attenuates Hypertension-Induced Cardiac Damage via Regulating Renin-Angiotensin System Pathway.
Lin-Zi LONG ; Ling TAN ; Feng-Qin XU ; Wen-Wen YANG ; Hong-Zheng LI ; Jian-Gang LIU ; Ke WANG ; Zhi-Ru ZHAO ; Yue-Qi WANG ; Chao-Ju WANG ; Yi-Chao WEN ; Ming-Yan HUANG ; Hua QU ; Chang-Geng FU ; Ke-Ji CHEN
Chinese journal of integrative medicine 2025;31(5):402-411
OBJECTIVE:
To assess the efficacy of Qingda Granule (QDG) in ameliorating hypertension-induced cardiac damage and investigate the underlying mechanisms involved.
METHODS:
Twenty spontaneously hypertensive rats (SHRs) were used to develope a hypertension-induced cardiac damage model. Another 10 Wistar Kyoto (WKY) rats were used as normotension group. Rats were administrated intragastrically QDG [0.9 g/(kg•d)] or an equivalent volume of pure water for 8 weeks. Blood pressure, histopathological changes, cardiac function, levels of oxidative stress and inflammatory response markers were measured. Furthermore, to gain insights into the potential mechanisms underlying the protective effects of QDG against hypertension-induced cardiac injury, a network pharmacology study was conducted. Predicted results were validated by Western blot, radioimmunoassay immunohistochemistry and quantitative polymerase chain reaction, respectively.
RESULTS:
The administration of QDG resulted in a significant decrease in blood pressure levels in SHRs (P<0.01). Histological examinations, including hematoxylin-eosin staining and Masson trichrome staining revealed that QDG effectively attenuated hypertension-induced cardiac damage. Furthermore, echocardiography demonstrated that QDG improved hypertension-associated cardiac dysfunction. Enzyme-linked immunosorbent assay and colorimetric method indicated that QDG significantly reduced oxidative stress and inflammatory response levels in both myocardial tissue and serum (P<0.01).
CONCLUSIONS
Both network pharmacology and experimental investigations confirmed that QDG exerted its beneficial effects in decreasing hypertension-induced cardiac damage by regulating the angiotensin converting enzyme (ACE)/angiotensin II (Ang II)/Ang II receptor type 1 axis and ACE/Ang II/Ang II receptor type 2 axis.
Animals
;
Drugs, Chinese Herbal/therapeutic use*
;
Hypertension/pathology*
;
Renin-Angiotensin System/drug effects*
;
Rats, Inbred SHR
;
Oxidative Stress/drug effects*
;
Male
;
Rats, Inbred WKY
;
Blood Pressure/drug effects*
;
Myocardium/pathology*
;
Rats
;
Inflammation/pathology*
10.Shexiang Tongxin Dropping Pill Improves Stable Angina Patients with Phlegm-Heat and Blood-Stasis Syndrome: A Multicenter, Randomized, Double-Blind, Placebo-Controlled Trial.
Ying-Qiang ZHAO ; Yong-Fa XING ; Ke-Yong ZOU ; Wei-Dong JIANG ; Ting-Hai DU ; Bo CHEN ; Bao-Ping YANG ; Bai-Ming QU ; Li-Yue WANG ; Gui-Hong GONG ; Yan-Ling SUN ; Li-Qi WANG ; Gao-Feng ZHOU ; Yu-Gang DONG ; Min CHEN ; Xue-Juan ZHANG ; Tian-Lun YANG ; Min-Zhou ZHANG ; Ming-Jun ZHAO ; Yue DENG ; Chang-Jiang XIAO ; Lin WANG ; Bao-He WANG
Chinese journal of integrative medicine 2025;31(8):685-693
OBJECTIVE:
To evaluate the efficacy and safety of Shexiang Tongxin Dropping Pill (STDP) in treating stable angina patients with phlegm-heat and blood-stasis syndrome by exercise duration and metabolic equivalents.
METHODS:
This multicenter, randomized, double-blind, placebo-controlled clinical trial enrolled stable angina patients with phlegm-heat and blood-stasis syndrome from 22 hospitals. They were randomized 1:1 to STDP (35 mg/pill, 6 pills per day) or placebo for 56 days. The primary outcome was the exercise duration and metabolic equivalents (METs) assessed by the standard Bruce exercise treadmill test after 56 days of treatment. The secondary outcomes included the total angina symptom score, Chinese medicine (CM) symptom scores, Seattle Angina Questionnaire (SAQ) scores, changes in ST-T on electrocardiogram and adverse events (AEs).
RESULTS:
This trial enrolled 309 patients, including 155 and 154 in the STDP and placebo groups, respectively. STDP significantly prolonged exercise duration with an increase of 51.0 s, compared to a decrease of 12.0 s with placebo (change rate: -11.1% vs. 3.2%, P<0.01). The increase in METs was significantly greater in the STDP group than in the placebo group (change: -0.4 vs. 0.0, change rate: -5.0% vs. 0.0%, P<0.01). The improvement of total angina symptom scores (25.0% vs. 0.0%), CM symptom scores (38.7% vs. 11.8%), reduction of nitroglycerin consumption (100.0% vs. 11.3%), and all domains of SAQ, were significantly greater with STDP than placebo (all P<0.01). The changes in Q-T intervals at 28 and 56 days from baseline were similar between the two groups (both P>0.05). Twenty-five participants (16.3%) with STDP and 16 (10.5%) with placebo experienced AEs (P=0.131), with no serious AEs observed.
CONCLUSION
STDP could improve exercise tolerance in patients with stable angina and phlegm-heat and blood stasis syndrome, with a favorable safety profile. (Registration No. ChiCTR-IPR-15006020).
Humans
;
Double-Blind Method
;
Drugs, Chinese Herbal/adverse effects*
;
Male
;
Female
;
Middle Aged
;
Angina, Stable/physiopathology*
;
Aged
;
Syndrome
;
Treatment Outcome
;
Placebos
;
Tablets


Result Analysis
Print
Save
E-mail