Objective To investigate the association between physical activity levels and blood lipids among college freshmen, and to provide scientific evidence for the health management of college freshmen. Methods An electronic questionnaire survey on physical activity was conducted on freshmen of a university, and fasting blood biochemical indicators were detected. The International Physical Activity Questionnaire (IPAQ) short form was used to evaluate the physical activity levels of the participants. Dyslipidemia was defined as an abnormality in any one of the following serum lipid parameters: total cholesterol, triglycerides, low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), or non-high-density lipoprotein cholesterol. Binary logistic regression and stratified analyses were employed to explore the relationship between physical activity and blood lipids. Results A total of 3 401 participants were included, with an average age of 18.45 ± 0.92 years, and 60.5% were female. The prevalence of dyslipidemia was 17.7%, with a higher rate among males (22.1%) than females (14.8%). After adjusting for confounding factors related to blood lipids, high-intensity physical activity was negatively associated with the risk of elevated LDL-C among males (OR = 0.36, 95% CI: 0.13–0.99, P = 0.049). Conclusion Among freshmen at a medical college in Hubei Province, high-intensity physical activity is negatively associated with the risk of elevated LDL-C in males, but this association needs to be further confirmed by larger prospective cohort studies.

Objective To gain insights into the biological characteristics of different populations of Culex tritaeniorhynchus within and around the Yellow Sea wetland from the perspective of the occurrence of resistance, we investigated the levels of resistance to deltamethrin and kdr gene mutation in the wetland and its peripheral areas. Methods Specimens were collected from Cx. tritaeniorhynchus populations at two monitoring sites in the Rare Bird National Nature Reserve and Tiaozi Ni Wetland Scenic Area, and also from two populations in Yancheng City and the Liuhe District of Nanjing, and the resistance of these mosquitoes to deltamethrin was determined using the CDC biotest bottle method. For each concentration of deltamethrin assessed, a random subset of exposed specimens was selected for amplification of the kdr gene fragment, followed by Sanger sequencing to identify and analyze resistance-associated mutations. Results The LC50 levels of deltamethrin among mosquitoes from the four populations in Luhe, Yancheng, the Rare Bird National Nature Reserve and the Tiaozi Ni Wetland Scenic Area were 2.048 5, 7.798 2, 3.473 3, and 17.695 5 mg/mL, respectively, with corresponding concentrations of deltamethrin ranging from 0.005 to 5.000,0.050 to 50.000,0.050 to 25.000 and 0.050 to 50.000 mg/mL, respectively. Furthermore, the ranges of the KT50 values were 11.76-107.43, 67.05-216.30,29.77-107.43 and 28.40-329.51 min; the 1-h knockdown rates were 34.58%-99.15%, 9.52%-43.80%, 55.09%-73.01%, and 10.09%-68.07%; and the 24-h mortality rates were 12.15%-67.52%,9.52%-79.56%,13.17%-82.21%, and 11.01%-78.99%, respectively. With respect to kdr gene mutation, we assayed a total of 63,70,59, and 57 mosquitoes for the four populations, for which we detected L1014F mutation frequencies of 14.29%, 35.00%, 20.34%, and 31.58%, respectively, with a majority of these mutations being heterozygous for resistance. In addition, five adult mosquitoes were identified has having synonymous mutations at site 1011[i. e. , AAT(asparagine)mutation to AAC(asparagine)]. Conclusions Our findings revealed the clear resistance of Cx. tritaeniorhynchus to deltamethrin in the Yancheng region of the Yellow Sea wetland, and the resistance phenotype and kdr frequency of Cx. tritaeniorhynchus in the wetland environment were comparable to those of Cx. tritaeniorhynchus in the wetland environment, thereby indicating that the resistance of different populations of Cx. tritaeniorhynchus was homogeneous under the pressure of different insecticide selection within and around the wetland. However, the underlying mechanisms need to be further studied.

Objective: To investigate the longitudinal associations between dietary patterns in early childhood and myopia among children, so as to provide evidence for improving early childhood dietary patterns and promoting healthy ocular development among children. Methods: Participants were derived from the Ma-anshan Birth Cohort (MABC). A total of 1 432 children were included. Dietary patterns at 2.5 years of age were collected in 2017 using a food frequency questionnaire completed by parents. In 2022, cycloplegic refraction and ocular biometric parameters were measured in children aged 7-8 years. Food components were grouped into tertiles ( T1-T 3), and latent class analysis (LCA) was used to identify dietary pattern at the age of 2.5. Log-binomial regression and multiple linear regression model were applied to examine the associations of dietary patterns and their latent classes with myopia, spherical equivalent (SE), and axial length (AL). Results: The prevalence of myopia among children was 23.9%. After adjusting for covariates, the T 2 group of cereals and tubers was negatively associated with myopia rate ( RR=0.72, 95%CI =0.57-0.90) and AL ( β=-0.15, 95%CI =-0.24 to -0.05), and positively associated with SE ( β=0.21, 95%CI =0.06-0.35)(all P ＜0.05). Linear regression models showed that the T 2 group of fruits and vegetables was positively associated with AL ( β=0.09, 95%CI =0.00- 0.19 ); the T 3 group of high sugar foods ( β=0.11, 95%CI =0.00-0.21) and the T 3 group of processed foods ( β= 0.10 , 95%CI =0.00-0.19) were positively associated with AL; total scores for high sugar foods ( β=0.07, 95%CI =0.00-0.14) and processed foods ( β=0.09, 95%CI =0.01-0.17) were positively associated with AL (all P <0.05). After adjusting for sex, age, and parental myopia, the comprehensive high intake pattern was positively associated with AL ( β=0.12, 95%CI =0.00-0.23, P <0.05). After further adjusting for daily screen time and daily outdoor activity time, the association was no longer statistically significant ( β= 0.11 , 95%CI =-0.00-0.23, P >0.05). Conclusions Moderate consumption of cereals and tubers in early childhood may reduce the risk of myopia and delay AL growth. In contrast, high sugar and highly processed diets may promote AL and increase myopia risk. Establishing healthy dietary habits in early childhood and limiting intake of high sugar and processed foods is crucial for promoting ocular development in children.

Objective To investigate the influencing factors of advanced bone age in early adolescence, and to provide a scientific basis for the early identification of children and adolescents with abnormal bone age development. Methods A prospective cohort study design was adopted. From July 2022 to September 2023, height, weight, and body composition data of children were collected, with the baseline age of the study participants being 8.42±0.50 years. Subsequently, from March 2024 to November 2025, these children in the cohort were followed up and their bone age development was monitored. In the end, a total of 1142 participants with complete data were included in the study. Results In early adolescence, there were 239 individuals (20.93%) with early bone age development and 103 (9.02%) with delayed development. The proportion of early bone age development was higher among individuals whose mothers had gestational hypertension during pregnancy, and the difference was statistically significant (χ²=8.90, P<0.05). The proportion of early bone age development was higher among boys, and the difference was statistically significant (χ²=41.69, P＜0.001). Disordered multiclass logistic regression analysis showed that after adjusting for demographic factors, overweight (OR=2.65, 95%CI:1.81-3.88), obesity (OR=6.51, 95%CI: 4.45-9.53), and excessive body fat percentage (OR=4.60, 95% CI: 3.01-7.03) were associated with an increased risk of early bone age development in children and adolescents. Conclusion Being overweight/obese and having an excessive body fat percentage can increase the risk of early bone age development in adolescents.

[Objective] To explore the relationship between neutrophil activation under cardiopulmonary bypass (CPB) and the incidence of cardiac surgery-associated acute kidney injury (CS-AKI). [Methods] This prospective cohort study enrolled adult patients who scheduled for cardiac surgery under CPB at West China Hospital between May 1, 2022 and March 31, 2023. The primary outcome was acute kidney injury (AKI). Blood samples (5 mL) were obtained from the central vein before surgery, at rewarming, at the end of CPB, and 24 hours after surgery. Neutrophils were labeled with CD11b, CD54 and other markers. To assess the effect of neutrophils activation on AKI, propensity score matching (PSM) was employed to equilibrate covariates between the groups. [Results] A total of 120 patients included into the study, and 17 (14.2%) developed AKI. Both CD11b⁺ and CD54⁺ neutrophils significantly increased during the rewarming phase and the increases were kept until 24 hours after surgery. During rewarming, the numbers of CD11b⁺ neutrophils were significantly higher in AKI compared to non-AKI (4.71×10⁹/L vs 3.31×10⁹/L, Z=-2.14, P<0.05). Similarly, the CD54⁺ neutrophils counts were also significantly higher in AKI than in non-AKI before surgery (2.75×10⁹/L vs 1.79×10⁹/L, Z=-2.99, P<0.05), during rewarming (3.12×10⁹/L vs 1.62×10⁹/L, Z=-4.34, P<0.05), and at the end of CPB (4.28×10⁹/L vs 2.14×10⁹/L, Z=-3.91, P<0.05). An analysis of 32 matched patients (16 in each group) revealed that CD11b⁺ and CD54⁺ neutrophil levels of AKI were 1.74 folds (4.83×10⁹/L vs 2.77×10⁹/L, Z=-2.72, P<0.05) and 2.34 folds (3.32×10⁹/L vs 1.42×10⁹/L, Z=-4.12, P<0.05), respectively, of non-AKI at rewarming phase. [Conclusion] Neutrophils are activated during CPB, and they can be identified by CD11b/CD54 markers. The activated neutrophils of AKI patients are approximately 2 folds of non-AKI during the rewarming phase, with disparity reached peak between groups during rewarming. These findings suggest the removal of 50% of activated neutrophils during the rewarming phase may be effective to reduce the risk of AKI.

Objective This study aimed to provide an effective scientific basis for prevention and control of cockroaches on aircrafts by identifying cockroach-carried pathogens,and assess the insecticidal efficacy of gel bait mediated cockroach control on aircrafts,to provide technical guidance for aircraft disinsection.Methods Cassette-trapping was used to trap cockroaches,and the carried pathogens were detected using bacterial cultivation techniques.The gel bait mediated killing rate was calculated after 1,7,and 30 d by field application of gel bait.Results A total of 411 cockroaches were captured,and all were identified as Blattella germanica.26 strains of pathogenic bacteria were isolated from the trapped cockroaches.The killing rates of cockroaches were 58.8％-96.3％with 1-30 day application of gel bait.Statistically significant differences were observed in cockroach killing rates on different days(χ2=58.95,P<0.01).Conclusions B.germanica carry a large variety of pathogenic bacteria and opportunistic pathogens and are thus important infectious disease carriers.Gel bait agents have proven to be very effective against cockroaches on aircrafts.

Objective:This study aims to initially establish a scoring system for comprehensively reflecting the severity of intracranial atherosclerotic lesions and to explore the correlation between this score and atherosclerotic risk factors as well as stroke events.Methods:This study retrospectively analyzed patients who underwent head and neck computer tomography angiography(CTA)examinations and had head MRI examinations within one month before or after the CTA examination from January 2021 to August 2024 in Beijing Hospital.An intracranial atherosclerosis disease score(ICADS)system was constructed based on the degree and number of vascular stenosis.The relationship between ICADS and atherosclerotic risk factors was explored by grouping patients according to the quartile of ICADS.Patients were divided into acute stroke group and non-acute stroke group to compare differences in ICADS and cerebrovascular disease risk factors between the two groups, and to investigate the correlation between stroke events and ICADS.Results:There were statistically significant differences in the proportions of patients with hypertension and diabetes among different ICADS groups.Multiple linear regression analysis showed that hypertension( B=1.17, 95% CI: 0.20-2.14, P<0.05)and diabetes( B=2.75, 95% CI: 1.85-3.64, P<0.001)were risk factors for higher ICADS.The ICADS was higher in the acute stroke group than in the non-acute stroke group(9 vs.6, P<0.001), and a higher ICADS was identified as a risk factor for stroke( OR=1.10, 95% CI: 1.07-1.14, P<0.001). Conclusions:ICADS can comprehensively reflect the severity of intracranial atherosclerotic lesions and is correlated with stroke events, making it useful for clinical screening of high-risk patients for stroke.

BACKGROUND: Most studies have evaluated disability-adjusted life years (DALYs) of colorectal cancer (CRC) patients based on a set of generic disability weights (DWs). This study aimed to apply local CRC-stage-specific DWs to estimate the burden of DALYs for CRC (CRC-DALYs) in populations in China and consider the influence of local screening coverage of CRC. METHODS: A prevalence-based model was constructed using data from various sources. Years lived with disability (YLDs) were estimated mainly via cumulative prevalence data (based on CRC incidence rates, population numbers, and survival rates), stage-specific proportions of CRC, and DWs of the local population. Years of life lost (YLLs) were calculated based on the CRC mortality rates and standard life expectancies. CRC incidence and mortality rates for the years 2020, 2025, and 2030 were estimated by joinpoint regression, and the corresponding DALYs were predicted. The main assumption was made for CRC screening coverage. Sensitivity analyses were used to assess the impact of population, DWs, and coverage. RESULTS: In 2017, among the Chinese population, the estimated number of CRC-DALYs was 4,303,314 (11.9% for YLDs). If CRC screening coverage rate in China (2.3%) remains unchanged, the overall DALYs in 2030 are predicted to increase by 37.2% (45.1% of those aged ≥65 years). More optimistically, the DALYs would then decrease by 0.7% in 2030 (from 5,902,454 to 5,860,200) if the coverage could be increased to 25.0%. A sensitivity analysis revealed that using local DWs would change the base-case values by 5.7%. CONCLUSIONS The estimated CRC-DALYs in China using population-specific DWs were considerably lower (with a higher percentage of YLDs) than the global burden of disease (GBD) estimates (5,865,004, of 4.6% for YLDs), suggesting the impact extent of applying local parameters. Sustainable scale-up CRC screening needs to be in place to moderate the growth trend of CRC-DALYs in China.
Humans ; Colorectal Neoplasms/diagnosis* ; China/epidemiology* ; Disability-Adjusted Life Years ; Male ; Prevalence ; Female ; Middle Aged ; Aged ; Early Detection of Cancer ; Quality-Adjusted Life Years ; Adult ; Incidence

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To explore the preventive and therapeutic effects of Dahuang Zhechong Pill (DZP) on pulmonary fibrosis and the underlying mechanisms. METHODS: The first key rate-limiting enzyme hexokinase 2 (HK2) of glycolysis was silenced and over-expressed through small interfering RNA and lentivirus using lung fibroblast MRC-5 cell line, respectively. The cell viability, migration, invasion and proliferation were detected by cell counting kit-8, wound healing assay, transwell assay, and flow cytometry. The mRNA and protein expression levels of HK2 were detected by RT-PCR and Western blotting, respectively. The contents of glucose, adenosine triphosphate (ATP) and lactate in MRC-5 cells were determined by enzyme-linked immunosorbnent assay (ELISA). Then, the relationship between miR-29b-2-5p and HK2 was explored by luciferase reporter gene assay. Pulmonary fibrosis cell model was induced by transforming growth factor-β 1 (TGF-β 1) in MRC-5 cells, and the medicated serum of DZP (DMS) was prepared in rats. MRC-5 cells were divided into control, TGF-β 1, TGF-β 1+10% DMS, TGF-β 1+10% DMS+miR-29b-2-5p inhibitor, TGF-β 1+10% DMS+inhibitor negative control, TGF-β 1+10% DMS+miR-29b-2-5p mimic and TGF-β 1+10% DMS+mimic negative control groups. After miR-29b-2-5p mimics and inhibitors were transfected into MRC-5 cells, all groups except control and model group were treated with DMS. The effect of DMS on MRC-5 cells were detected using aforementioned methods and immunofluorescence. Similarly, the contents of glucose, ATP and lactate in each group were measured by ELISA. RESULTS: The mRNA and protein expressions of HK2 in MRC-5 cells were successfully silenced and overexpressed through si-HK2-3 and lentiviral transfection, respectively. After silencing HK2, the mRNA and protein expressions of HK2 were significantly decreased (P<0.01), and the concentrations of glucose, ATP and lactate were also significantly decreased (P<0.05). The proliferation, migration and invasion of MRC-5 cells were significantly declined (P<0.05 or P<0.01), while the apoptosis of MRC-5 cells was significantly increased (P<0.01). After overexpressing HK2, the mRNA and protein expressions of HK2 were significantly increased (P<0.05), and the concentrations of glucose, ATP and lactate were also significantly increased (P<0.05 or P<0.01). The proliferation, migration and invasion of MRC-5 cells were significantly increased (P<0.05 or P<0.01), while the apoptosis of MRC-5 cells was significantly decreased (P<0.05). The relative luciferase activity of 3'UTR-WT+hsa-miR-29b-2-5p transfected with HK2 was significantly decreased (P<0.01). After miR-29b-2-5p mimic and inhibitor were transfected into the MRC-5 cells, DMS intervention could significantly reduce the concentration of glucose, ATP and lactate, and the mRNA and proteins expressions of HK2, phosphofructokinase and pyruvate kinase isoform M2 (P<0.05 or P<0.01). The proliferation, migration and invasion of MRC-5 cells were alleviated (P<0.05 or P<0.01), and the deposition of fibronectin, α-smooth muscle actin, and collagen I were significantly decreased (P<0.05 or P<0.01). CONCLUSIONS Glycolysis is closely related to pulmonary fibrosis. DZP reduced glycolysis and inhibited fibroblasts' excessive differentiation and abnormal collagen deposition through the miR-29b-2-5p/HK2 pathway, which played a role in delaying the process of pulmonary fibrosis.
MicroRNAs/genetics* ; Glycolysis/genetics* ; Animals ; Pulmonary Fibrosis/metabolism* ; Humans ; Drugs, Chinese Herbal/therapeutic use* ; Hexokinase/genetics* ; Cell Line ; Cell Proliferation/drug effects* ; Rats, Sprague-Dawley ; Rats ; Cell Movement/drug effects* ; Male ; Cell Survival/drug effects* ; Signal Transduction/drug effects*