Objective To investigate the association between physical activity levels and blood lipids among college freshmen, and to provide scientific evidence for the health management of college freshmen. Methods An electronic questionnaire survey on physical activity was conducted on freshmen of a university, and fasting blood biochemical indicators were detected. The International Physical Activity Questionnaire (IPAQ) short form was used to evaluate the physical activity levels of the participants. Dyslipidemia was defined as an abnormality in any one of the following serum lipid parameters: total cholesterol, triglycerides, low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), or non-high-density lipoprotein cholesterol. Binary logistic regression and stratified analyses were employed to explore the relationship between physical activity and blood lipids. Results A total of 3 401 participants were included, with an average age of 18.45 ± 0.92 years, and 60.5% were female. The prevalence of dyslipidemia was 17.7%, with a higher rate among males (22.1%) than females (14.8%). After adjusting for confounding factors related to blood lipids, high-intensity physical activity was negatively associated with the risk of elevated LDL-C among males (OR = 0.36, 95% CI: 0.13–0.99, P = 0.049). Conclusion Among freshmen at a medical college in Hubei Province, high-intensity physical activity is negatively associated with the risk of elevated LDL-C in males, but this association needs to be further confirmed by larger prospective cohort studies.

[Objective] To explore the relationship between neutrophil activation under cardiopulmonary bypass (CPB) and the incidence of cardiac surgery-associated acute kidney injury (CS-AKI). [Methods] This prospective cohort study enrolled adult patients who scheduled for cardiac surgery under CPB at West China Hospital between May 1, 2022 and March 31, 2023. The primary outcome was acute kidney injury (AKI). Blood samples (5 mL) were obtained from the central vein before surgery, at rewarming, at the end of CPB, and 24 hours after surgery. Neutrophils were labeled with CD11b, CD54 and other markers. To assess the effect of neutrophils activation on AKI, propensity score matching (PSM) was employed to equilibrate covariates between the groups. [Results] A total of 120 patients included into the study, and 17 (14.2%) developed AKI. Both CD11b⁺ and CD54⁺ neutrophils significantly increased during the rewarming phase and the increases were kept until 24 hours after surgery. During rewarming, the numbers of CD11b⁺ neutrophils were significantly higher in AKI compared to non-AKI (4.71×10⁹/L vs 3.31×10⁹/L, Z=-2.14, P<0.05). Similarly, the CD54⁺ neutrophils counts were also significantly higher in AKI than in non-AKI before surgery (2.75×10⁹/L vs 1.79×10⁹/L, Z=-2.99, P<0.05), during rewarming (3.12×10⁹/L vs 1.62×10⁹/L, Z=-4.34, P<0.05), and at the end of CPB (4.28×10⁹/L vs 2.14×10⁹/L, Z=-3.91, P<0.05). An analysis of 32 matched patients (16 in each group) revealed that CD11b⁺ and CD54⁺ neutrophil levels of AKI were 1.74 folds (4.83×10⁹/L vs 2.77×10⁹/L, Z=-2.72, P<0.05) and 2.34 folds (3.32×10⁹/L vs 1.42×10⁹/L, Z=-4.12, P<0.05), respectively, of non-AKI at rewarming phase. [Conclusion] Neutrophils are activated during CPB, and they can be identified by CD11b/CD54 markers. The activated neutrophils of AKI patients are approximately 2 folds of non-AKI during the rewarming phase, with disparity reached peak between groups during rewarming. These findings suggest the removal of 50% of activated neutrophils during the rewarming phase may be effective to reduce the risk of AKI.

BACKGROUND: Most studies have evaluated disability-adjusted life years (DALYs) of colorectal cancer (CRC) patients based on a set of generic disability weights (DWs). This study aimed to apply local CRC-stage-specific DWs to estimate the burden of DALYs for CRC (CRC-DALYs) in populations in China and consider the influence of local screening coverage of CRC. METHODS: A prevalence-based model was constructed using data from various sources. Years lived with disability (YLDs) were estimated mainly via cumulative prevalence data (based on CRC incidence rates, population numbers, and survival rates), stage-specific proportions of CRC, and DWs of the local population. Years of life lost (YLLs) were calculated based on the CRC mortality rates and standard life expectancies. CRC incidence and mortality rates for the years 2020, 2025, and 2030 were estimated by joinpoint regression, and the corresponding DALYs were predicted. The main assumption was made for CRC screening coverage. Sensitivity analyses were used to assess the impact of population, DWs, and coverage. RESULTS: In 2017, among the Chinese population, the estimated number of CRC-DALYs was 4,303,314 (11.9% for YLDs). If CRC screening coverage rate in China (2.3%) remains unchanged, the overall DALYs in 2030 are predicted to increase by 37.2% (45.1% of those aged ≥65 years). More optimistically, the DALYs would then decrease by 0.7% in 2030 (from 5,902,454 to 5,860,200) if the coverage could be increased to 25.0%. A sensitivity analysis revealed that using local DWs would change the base-case values by 5.7%. CONCLUSIONS The estimated CRC-DALYs in China using population-specific DWs were considerably lower (with a higher percentage of YLDs) than the global burden of disease (GBD) estimates (5,865,004, of 4.6% for YLDs), suggesting the impact extent of applying local parameters. Sustainable scale-up CRC screening needs to be in place to moderate the growth trend of CRC-DALYs in China.
Humans ; Colorectal Neoplasms/diagnosis* ; China/epidemiology* ; Disability-Adjusted Life Years ; Male ; Prevalence ; Female ; Middle Aged ; Aged ; Early Detection of Cancer ; Quality-Adjusted Life Years ; Adult ; Incidence

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To explore the preventive and therapeutic effects of Dahuang Zhechong Pill (DZP) on pulmonary fibrosis and the underlying mechanisms. METHODS: The first key rate-limiting enzyme hexokinase 2 (HK2) of glycolysis was silenced and over-expressed through small interfering RNA and lentivirus using lung fibroblast MRC-5 cell line, respectively. The cell viability, migration, invasion and proliferation were detected by cell counting kit-8, wound healing assay, transwell assay, and flow cytometry. The mRNA and protein expression levels of HK2 were detected by RT-PCR and Western blotting, respectively. The contents of glucose, adenosine triphosphate (ATP) and lactate in MRC-5 cells were determined by enzyme-linked immunosorbnent assay (ELISA). Then, the relationship between miR-29b-2-5p and HK2 was explored by luciferase reporter gene assay. Pulmonary fibrosis cell model was induced by transforming growth factor-β 1 (TGF-β 1) in MRC-5 cells, and the medicated serum of DZP (DMS) was prepared in rats. MRC-5 cells were divided into control, TGF-β 1, TGF-β 1+10% DMS, TGF-β 1+10% DMS+miR-29b-2-5p inhibitor, TGF-β 1+10% DMS+inhibitor negative control, TGF-β 1+10% DMS+miR-29b-2-5p mimic and TGF-β 1+10% DMS+mimic negative control groups. After miR-29b-2-5p mimics and inhibitors were transfected into MRC-5 cells, all groups except control and model group were treated with DMS. The effect of DMS on MRC-5 cells were detected using aforementioned methods and immunofluorescence. Similarly, the contents of glucose, ATP and lactate in each group were measured by ELISA. RESULTS: The mRNA and protein expressions of HK2 in MRC-5 cells were successfully silenced and overexpressed through si-HK2-3 and lentiviral transfection, respectively. After silencing HK2, the mRNA and protein expressions of HK2 were significantly decreased (P<0.01), and the concentrations of glucose, ATP and lactate were also significantly decreased (P<0.05). The proliferation, migration and invasion of MRC-5 cells were significantly declined (P<0.05 or P<0.01), while the apoptosis of MRC-5 cells was significantly increased (P<0.01). After overexpressing HK2, the mRNA and protein expressions of HK2 were significantly increased (P<0.05), and the concentrations of glucose, ATP and lactate were also significantly increased (P<0.05 or P<0.01). The proliferation, migration and invasion of MRC-5 cells were significantly increased (P<0.05 or P<0.01), while the apoptosis of MRC-5 cells was significantly decreased (P<0.05). The relative luciferase activity of 3'UTR-WT+hsa-miR-29b-2-5p transfected with HK2 was significantly decreased (P<0.01). After miR-29b-2-5p mimic and inhibitor were transfected into the MRC-5 cells, DMS intervention could significantly reduce the concentration of glucose, ATP and lactate, and the mRNA and proteins expressions of HK2, phosphofructokinase and pyruvate kinase isoform M2 (P<0.05 or P<0.01). The proliferation, migration and invasion of MRC-5 cells were alleviated (P<0.05 or P<0.01), and the deposition of fibronectin, α-smooth muscle actin, and collagen I were significantly decreased (P<0.05 or P<0.01). CONCLUSIONS Glycolysis is closely related to pulmonary fibrosis. DZP reduced glycolysis and inhibited fibroblasts' excessive differentiation and abnormal collagen deposition through the miR-29b-2-5p/HK2 pathway, which played a role in delaying the process of pulmonary fibrosis.
MicroRNAs/genetics* ; Glycolysis/genetics* ; Animals ; Pulmonary Fibrosis/metabolism* ; Humans ; Drugs, Chinese Herbal/therapeutic use* ; Hexokinase/genetics* ; Cell Line ; Cell Proliferation/drug effects* ; Rats, Sprague-Dawley ; Rats ; Cell Movement/drug effects* ; Male ; Cell Survival/drug effects* ; Signal Transduction/drug effects*

Mineral oil contaminants composed of saturated hydrocarbons(MOSH)and aromatic hydrocarbons(MOAH)are commonly found in edible oils and related processed foods.Currently,the analysis of mineral oils primarily employs the liquid chromatography-gas chromatography-flame ionization detector(LC-GC-FID)method.Liquid chromatography is used to purify and separate MOSH and MOAH from interfering substances,and the interface technology transfers MOSH or MOAH into different GC channels for quantitative analysis.The MOSH and MOAH chromatograms typically exhibit an irregular hump shape,with sharp peaks above the hump representing natural hydrocarbon interferences,which usually do not affect the identification of the hump profile.However,when the purification of interferences is incomplete,they can form one or more gaps above the hump,interfering with the accurate judgment and delineation of the hump profile,and leading to poor reproducibility of analysis results of mineral oil.In this study,an algorithm that mimicked the manual drawing of the hump shape or contour was proposed for automatically determining the mineral oil hump contour(i.e.,the lower envelope line).The algorithm used a multiple second-order difference quotient filtering method to identify and remove the gaps above the hump.The method involved first searching and determining the lowest value of the mineral oil hump,which was the valley point sequence,and then applying second-order difference quotient filtering to the valley point sequence.Compared to the hump,the second-order difference quotient of sharp peaks was a significantly larger negative value.By filtering out the points in the valley point sequence with larger negative second-order difference quotients(or multiple second-order difference quotients),the sharp peaks above the hump were removed.To verify the accuracy of the algorithm,42 different types of samples,including edible oils and milk powders were analyzed,using both the automatic algorithm and manual methods.The results showed that there were no significant differences in the detected mineral oil contents between these two methods.

Fe/Mn/Gd polymetallic nanooxide(FMGN)were prepared by one-step solvent thermal reaction by using Fe(acac)3,Mn(acac)2 and Gd(acac)3 as reaction precursors.Next,hyaluronic acid(HA)was used to modify FMGN to fabricate tumor-targeting T 1-T 2 dual-mode magnetic resonance imaging(MRI)contrast agent(HA-FMGN)for accurate diagnosis of prostate cancer.The structure and morphology of FMGN were observed by transmission electron microscope(TEM).It was found that FMGN exhibited a uniform nanocluster spherical structure when the feeding ratio of iron acetylacetonate,manganese acetylacetonate,and gadolinium acetylacetonate was 3:2:1.X-ray diffraction(XRD)analysis showed that FMGN had a typical inverse spinel structure of Mn doped Fe 3O 4,with Gd existing in the form of amorphous gadolinium oxide.The longitudinal relaxivity(r 1)and transverse relaxivity(r 2)of FMGN were 13.395 and 428.535 L/(mmol·s),respectively,measured by 0.5 T MRI analyzer,which proved that FMGN had excellent T 1-T 2 dual-mode MRI contrast capability.The cytotoxicity and hemolysis test found that HA-FMGN didn't damage red cells and induce toxicity for normal cells,indicating that HA-FMGN had excellent cell biocompatibility.The internalization efficacy of HA-FMGN was observed by CLSM,and the results showed that HA-FMGN possessed excellent prostate tumor-targeting ability.In vivo MRI experiment showed that HA-FMGN significantly enhanced T 1 and T 2 weighted MRI signal to noise ratio(SNR)of prostate tumor,which promoted the accurate diagnosis of orthotopic prostate cancer.

Objective This study aimed to provide an effective scientific basis for prevention and control of cockroaches on aircrafts by identifying cockroach-carried pathogens,and assess the insecticidal efficacy of gel bait mediated cockroach control on aircrafts,to provide technical guidance for aircraft disinsection.Methods Cassette-trapping was used to trap cockroaches,and the carried pathogens were detected using bacterial cultivation techniques.The gel bait mediated killing rate was calculated after 1,7,and 30 d by field application of gel bait.Results A total of 411 cockroaches were captured,and all were identified as Blattella germanica.26 strains of pathogenic bacteria were isolated from the trapped cockroaches.The killing rates of cockroaches were 58.8％-96.3％with 1-30 day application of gel bait.Statistically significant differences were observed in cockroach killing rates on different days(χ2=58.95,P<0.01).Conclusions B.germanica carry a large variety of pathogenic bacteria and opportunistic pathogens and are thus important infectious disease carriers.Gel bait agents have proven to be very effective against cockroaches on aircrafts.

Objective Lentivirus-mediated interference with synaptic nuclear protein γ(SNCG)in human oral squamous cell carcinoma was established to study the role of SNCG in the migration and invasion of oral squamous cell carcinoma.Methods Oral cancer CAL27 cells were infected with LV-shNC and LV-shSNCG constructed by lentivirus vector,respective,and then selected with puromycin to obtain cell lines stably interfering with SNCG,which were named NC group and experimental group,respectively.Detect the expression of SNCG through real-time quantitative polymerase chain reaction(qRT-PCR)and Western blot experiments;Transwell and scratch experiments were used to detect changes in migration and invasion ability.Results Compared with the NC group,the experimental group showed an 80％reduction in SNCG mRNA expression(P＜0.01).The relative expression level of SNCG protein was also decreased in the experimental group compared to the NC group(P＜0.01).In the NC group and the experimental group,the migration area percentages at 36 hours were 0.54±0.06 and 0.40±0.02,respectively;and at 48 hours were 0.83±0.01 and 0.47±0.05,respectively.The experimental group showed decrease in migration area compared to the NC group,and these differences were statistically significant(P＜0.05,P＜0.001).Compared to the NC group,the migration and invasion cell numbers in the experimental group(98.00±13.49 and 88.00±5.72)were significantly reduced to(48.00±2.16 and 49.00±2.94),and these differences were statistically significant(P＜0.01,P＜0.001).Conclusion Interference of SNCG expression can significantly reduce the migration and invasion ability of oral squamous cell carcinoma cells.