[Objective] To explore the relationship between neutrophil activation under cardiopulmonary bypass (CPB) and the incidence of cardiac surgery-associated acute kidney injury (CS-AKI). [Methods] This prospective cohort study enrolled adult patients who scheduled for cardiac surgery under CPB at West China Hospital between May 1, 2022 and March 31, 2023. The primary outcome was acute kidney injury (AKI). Blood samples (5 mL) were obtained from the central vein before surgery, at rewarming, at the end of CPB, and 24 hours after surgery. Neutrophils were labeled with CD11b, CD54 and other markers. To assess the effect of neutrophils activation on AKI, propensity score matching (PSM) was employed to equilibrate covariates between the groups. [Results] A total of 120 patients included into the study, and 17 (14.2%) developed AKI. Both CD11b⁺ and CD54⁺ neutrophils significantly increased during the rewarming phase and the increases were kept until 24 hours after surgery. During rewarming, the numbers of CD11b⁺ neutrophils were significantly higher in AKI compared to non-AKI (4.71×10⁹/L vs 3.31×10⁹/L, Z=-2.14, P<0.05). Similarly, the CD54⁺ neutrophils counts were also significantly higher in AKI than in non-AKI before surgery (2.75×10⁹/L vs 1.79×10⁹/L, Z=-2.99, P<0.05), during rewarming (3.12×10⁹/L vs 1.62×10⁹/L, Z=-4.34, P<0.05), and at the end of CPB (4.28×10⁹/L vs 2.14×10⁹/L, Z=-3.91, P<0.05). An analysis of 32 matched patients (16 in each group) revealed that CD11b⁺ and CD54⁺ neutrophil levels of AKI were 1.74 folds (4.83×10⁹/L vs 2.77×10⁹/L, Z=-2.72, P<0.05) and 2.34 folds (3.32×10⁹/L vs 1.42×10⁹/L, Z=-4.12, P<0.05), respectively, of non-AKI at rewarming phase. [Conclusion] Neutrophils are activated during CPB, and they can be identified by CD11b/CD54 markers. The activated neutrophils of AKI patients are approximately 2 folds of non-AKI during the rewarming phase, with disparity reached peak between groups during rewarming. These findings suggest the removal of 50% of activated neutrophils during the rewarming phase may be effective to reduce the risk of AKI.

BACKGROUND: Most studies have evaluated disability-adjusted life years (DALYs) of colorectal cancer (CRC) patients based on a set of generic disability weights (DWs). This study aimed to apply local CRC-stage-specific DWs to estimate the burden of DALYs for CRC (CRC-DALYs) in populations in China and consider the influence of local screening coverage of CRC. METHODS: A prevalence-based model was constructed using data from various sources. Years lived with disability (YLDs) were estimated mainly via cumulative prevalence data (based on CRC incidence rates, population numbers, and survival rates), stage-specific proportions of CRC, and DWs of the local population. Years of life lost (YLLs) were calculated based on the CRC mortality rates and standard life expectancies. CRC incidence and mortality rates for the years 2020, 2025, and 2030 were estimated by joinpoint regression, and the corresponding DALYs were predicted. The main assumption was made for CRC screening coverage. Sensitivity analyses were used to assess the impact of population, DWs, and coverage. RESULTS: In 2017, among the Chinese population, the estimated number of CRC-DALYs was 4,303,314 (11.9% for YLDs). If CRC screening coverage rate in China (2.3%) remains unchanged, the overall DALYs in 2030 are predicted to increase by 37.2% (45.1% of those aged ≥65 years). More optimistically, the DALYs would then decrease by 0.7% in 2030 (from 5,902,454 to 5,860,200) if the coverage could be increased to 25.0%. A sensitivity analysis revealed that using local DWs would change the base-case values by 5.7%. CONCLUSIONS The estimated CRC-DALYs in China using population-specific DWs were considerably lower (with a higher percentage of YLDs) than the global burden of disease (GBD) estimates (5,865,004, of 4.6% for YLDs), suggesting the impact extent of applying local parameters. Sustainable scale-up CRC screening needs to be in place to moderate the growth trend of CRC-DALYs in China.
Humans ; Colorectal Neoplasms/diagnosis* ; China/epidemiology* ; Disability-Adjusted Life Years ; Male ; Prevalence ; Female ; Middle Aged ; Aged ; Early Detection of Cancer ; Quality-Adjusted Life Years ; Adult ; Incidence

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To explore the preventive and therapeutic effects of Dahuang Zhechong Pill (DZP) on pulmonary fibrosis and the underlying mechanisms. METHODS: The first key rate-limiting enzyme hexokinase 2 (HK2) of glycolysis was silenced and over-expressed through small interfering RNA and lentivirus using lung fibroblast MRC-5 cell line, respectively. The cell viability, migration, invasion and proliferation were detected by cell counting kit-8, wound healing assay, transwell assay, and flow cytometry. The mRNA and protein expression levels of HK2 were detected by RT-PCR and Western blotting, respectively. The contents of glucose, adenosine triphosphate (ATP) and lactate in MRC-5 cells were determined by enzyme-linked immunosorbnent assay (ELISA). Then, the relationship between miR-29b-2-5p and HK2 was explored by luciferase reporter gene assay. Pulmonary fibrosis cell model was induced by transforming growth factor-β 1 (TGF-β 1) in MRC-5 cells, and the medicated serum of DZP (DMS) was prepared in rats. MRC-5 cells were divided into control, TGF-β 1, TGF-β 1+10% DMS, TGF-β 1+10% DMS+miR-29b-2-5p inhibitor, TGF-β 1+10% DMS+inhibitor negative control, TGF-β 1+10% DMS+miR-29b-2-5p mimic and TGF-β 1+10% DMS+mimic negative control groups. After miR-29b-2-5p mimics and inhibitors were transfected into MRC-5 cells, all groups except control and model group were treated with DMS. The effect of DMS on MRC-5 cells were detected using aforementioned methods and immunofluorescence. Similarly, the contents of glucose, ATP and lactate in each group were measured by ELISA. RESULTS: The mRNA and protein expressions of HK2 in MRC-5 cells were successfully silenced and overexpressed through si-HK2-3 and lentiviral transfection, respectively. After silencing HK2, the mRNA and protein expressions of HK2 were significantly decreased (P<0.01), and the concentrations of glucose, ATP and lactate were also significantly decreased (P<0.05). The proliferation, migration and invasion of MRC-5 cells were significantly declined (P<0.05 or P<0.01), while the apoptosis of MRC-5 cells was significantly increased (P<0.01). After overexpressing HK2, the mRNA and protein expressions of HK2 were significantly increased (P<0.05), and the concentrations of glucose, ATP and lactate were also significantly increased (P<0.05 or P<0.01). The proliferation, migration and invasion of MRC-5 cells were significantly increased (P<0.05 or P<0.01), while the apoptosis of MRC-5 cells was significantly decreased (P<0.05). The relative luciferase activity of 3'UTR-WT+hsa-miR-29b-2-5p transfected with HK2 was significantly decreased (P<0.01). After miR-29b-2-5p mimic and inhibitor were transfected into the MRC-5 cells, DMS intervention could significantly reduce the concentration of glucose, ATP and lactate, and the mRNA and proteins expressions of HK2, phosphofructokinase and pyruvate kinase isoform M2 (P<0.05 or P<0.01). The proliferation, migration and invasion of MRC-5 cells were alleviated (P<0.05 or P<0.01), and the deposition of fibronectin, α-smooth muscle actin, and collagen I were significantly decreased (P<0.05 or P<0.01). CONCLUSIONS Glycolysis is closely related to pulmonary fibrosis. DZP reduced glycolysis and inhibited fibroblasts' excessive differentiation and abnormal collagen deposition through the miR-29b-2-5p/HK2 pathway, which played a role in delaying the process of pulmonary fibrosis.
MicroRNAs/genetics* ; Glycolysis/genetics* ; Animals ; Pulmonary Fibrosis/metabolism* ; Humans ; Drugs, Chinese Herbal/therapeutic use* ; Hexokinase/genetics* ; Cell Line ; Cell Proliferation/drug effects* ; Rats, Sprague-Dawley ; Rats ; Cell Movement/drug effects* ; Male ; Cell Survival/drug effects* ; Signal Transduction/drug effects*

Objective Lentivirus-mediated interference with synaptic nuclear protein γ(SNCG)in human oral squamous cell carcinoma was established to study the role of SNCG in the migration and invasion of oral squamous cell carcinoma.Methods Oral cancer CAL27 cells were infected with LV-shNC and LV-shSNCG constructed by lentivirus vector,respective,and then selected with puromycin to obtain cell lines stably interfering with SNCG,which were named NC group and experimental group,respectively.Detect the expression of SNCG through real-time quantitative polymerase chain reaction(qRT-PCR)and Western blot experiments;Transwell and scratch experiments were used to detect changes in migration and invasion ability.Results Compared with the NC group,the experimental group showed an 80％reduction in SNCG mRNA expression(P＜0.01).The relative expression level of SNCG protein was also decreased in the experimental group compared to the NC group(P＜0.01).In the NC group and the experimental group,the migration area percentages at 36 hours were 0.54±0.06 and 0.40±0.02,respectively;and at 48 hours were 0.83±0.01 and 0.47±0.05,respectively.The experimental group showed decrease in migration area compared to the NC group,and these differences were statistically significant(P＜0.05,P＜0.001).Compared to the NC group,the migration and invasion cell numbers in the experimental group(98.00±13.49 and 88.00±5.72)were significantly reduced to(48.00±2.16 and 49.00±2.94),and these differences were statistically significant(P＜0.01,P＜0.001).Conclusion Interference of SNCG expression can significantly reduce the migration and invasion ability of oral squamous cell carcinoma cells.

Objective To evaluate tolerability,safety and pharmacokinetics of JS026 and JS026-JS016 single dose intravenous infusion in healthy adults.Methods This phase 1,randomized,double-blind,placebo-controlled,dose-escalation study totally included 48 participants:32 healthy subjects were enrolled in JS026 single intravenous infusion groups and 16 healthy subjects were enrolled in JS026-JS016 groups.JS026 was sequentially administered from low dose to high dose(30-1 000 mg),with intravenous infusion of JS026 or placebo in JS026 single-dose groups,and intravenous infusion of JS026-JS016 or placebo in the combination drug groups.Blood was collected according to the time point designed for trial.Serum concentrations of JS026 and JS016 were determined by enzyme linked immunosorbnent assay(ELISA),and pharmacokinetics parameters were calculated by WinNonlin 8.2.The power model method was used to evaluate the linear analysis of dose and drug exposure.Results 47 subjects completed trial and 1 subject lost to follow-up.After a single intravenous injection of JS026 of 30 mg,100 mg,300 mg,600 mg,and 1 000 mg,mean Cmax were(9.47±1.53),(33.20±4.95),(96.10±13.70),(177.00±22.20)and(353.00±56.70)μg·mL-1,respectively;mean AUC0-∞ were(4 225.00±607.00),(1.78 × 104±3 268.00),(5.83 × 104±1 038.00),(1.07 × 105±152.00),(1.66 × 105±327.00)μg·h·mL-1,respectively;mean t1/2 of JS026 were 563-709 h.The Cmax and AUC0-∞ of JS026 were basically similar alone or in combination with JS016.The results of Power model showed that Cmax and AUC0-∞ increased approximately linearly with the increasing dose of JS026.Treatment emergent adverse event was not increasing when dose increased and most of adverse event associated with drugs were abnormal on laboratory tests and haematuria,thus JS026 and JS016 was well tolerated in all groups.Conclusion The single intravenous infusion of JS026 can almost be thought to be a linear relationship between the doses and drug serum exposure.JS016 had no significant effect on serum concentration of JS026 and JS026 was well tolerated and safe in healthy subjects within 30-1 000 mg.

Objective To prepare a nano drug(PFOB@Lip-MMC)with liposome as the carrier,liquid perfluorooc-tyl bromide(PFOB)as core and mitomycin C(MMC)loading on the liposome shell and study its inhibitory effect on the proliferation of human pterygium fibroblasts(HPFs).Methods The thin film dispersion-hydration ultrasonic method was used to prepare PFOB@Lip-MMC and detect its physical and chemical properties.Cell Counting Kit-8,Cam-PI cell viability staining and flow cytometry were employed to detect the impact of different concentrations of PFOB@Lip-MMC on the via-bility of HPFs.DiI fluorescence labeled PFOB@Lip-MMC was used to observe the permeability of the nano drug to HPFs under a laser confocal microscope.After establishing HPF inflammatory cell models,they were divided into the control group(with sterile phosphate-buffered saline solution added),PFOB@Lip group(with PFOB@Lip added),MMC group(with MMC added),PFOB@Lip-MMC group(with PFOB@Lip-MMC added)and normal group(with fresh culture medi-um added)according to the experimental requirements.After co-incubation for 24 h,flow cytometer was used to detect the apoptosis rate of inflammatory cells,and the gene expression levels of interleukin(IL)-1β,prostaglandin E2(PGE2),tumor necrosis factor(TNF)-α and vascular endothelial growth factor(VEGF)in cells were analyzed by PCR.Results The average particle size and Zeta potential of PFOB@Lip-MMC were(103.45±2.17)nm and(27.34±1.03)mV,respec-tively,and its entrapped efficiency and drug loading rate were(72.85±3.28)％and(34.27±2.04)％,respectively.The sustained-release MMC of drug-loaded nanospheres reached(78.34±2.92)％in vitro in a 24-hour ocular surface environ-ment.The biological safety of PFOB@Lip-MMC significantly improved compared to MMC.In terms of the DiI fluorescence labeled PFOB@Lip-MMC,after co-incubation with inflammatory HPFs for 2 h,DiI fluorescence labeling was diffusely dis-tributed in the cytoplasm of inflammatory HPFs.The apoptosis rate of inflammatory HPFs in the PFOB@Lip-MMC group[(77.23±4.93)％]was significantly higher than that in the MMC group[(51.62±3.28)％].The PCR examination results showed that the gene transcription levels of IL-1 β,PGE2,TNF-α and VEGF in other groups were significantly reduced com-pared to the control group and PFOB@Lip group,with the most significant decrease in the PFOB@Lip-MMC group(all P＜0.05).Conclusion In this study,a novel nano drug(PFOB@LIP-MMC)that inhibited the proliferation of HPFs was successfully synthesized,and its cytotoxicity was significantly reduced compared to the original drugs.It has good bio-compatibility and anti-inflammatory effects,providing a new treatment approach for reducing the recurrence rate after pte-rygium surgery.

Objective To evaluate the relationship between diabetic nephropathy(DN)and diabetic retinopathy(DR)in patients with type 2 diabetes mellitus(T2DM)based on imaging and clinical testing data.Methods Totally 600 T2DM patients who visited the First People's Hospital of Ziyang from March 2021 to December 2022 were included.The fundus photography and fundus fluorescein angiography were performed on all these patients and their age,gender,T2DM duration,cardiovascular diseases,cerebrovascular disease,hypertension,smoking history,drinking history,body mass in-dex,systolic blood pressure,diastolic blood pressure and other clinical data were collected.The levels of fasting blood glu-cose(FPG),triglyceride(TG),total cholesterol(TC),high-density lipoprotein cholesterol(HDL-C),low-density lipo-protein cholesterol(LDL-C),glycosylated hemoglobin(HbA1c),24 h urinary albumin(UAlb),urinary albumin to creati-nine ratio(ACR),serum creatinine(Scr)and blood urea nitrogen(BUN)were measured.Logistic regression was used to analyze the risk factors associated with DR.DR staging was performed according to fundus images,and the convolutional neural network(CNN)algorithm was used as an image analysis method to explore the correlation between DR and DN based on emission computed tomography(ECT)and clinical testing data.Results The average lesion area rates of DR and DN detected by the CNN in the non-DR,mild-non-proliferative DR(NPDR),moderate-NPDR,severe-NPDR and pro-liferative DR(PDR)groups were higher than those obtained by the traditional algorithm(TCM).As DR worsened,the Scr,BUN,24 h UAlb and ACR gradually increased.Besides,the incidence of DN in the non-DR,mild-NPDR,moderate-NPDR,severe-NPDR and PDR groups was 1.67％,8.83％,16.16％,22.16％and 30.83％,respectively.Logistic regression analysis showed that the duration of T2DM,smoking history,HbA1c,TC,TG,HDL-C,LDL-C,24 h UAlb,Scr,BUN,ACR and glomerular filtration rate(GFR)were independent risk factors for DR.Renal dynamic ECT analysis demonstrated that with the aggravation of DR,renal blood flow perfusion gradually decreased,resulting in diminished renal filtration.Conclusion The application of CCN in the early stage DR and DN image analysis of T2DM patients will improve the diag-nosis accuracy of DR and DN lesion area.The DN is worsening as the aggravation of DR.

Objective To evaluate the efficacy of surgery,chemotherapy and surgery combined chemotherapy for retinoblastoma(RB),and analyze the prognostic factors of RB patients.Methods Clinical data of 1188 RB patients registered in the Surveillance,Epidemiology and End Results(SEER)database from January 2000 to December 2019 were retrospectively analyzed.The baseline characteristics of patients treated with surgery,chemotherapy or surgery combined with chemotherapy were balanced by inverse probability of treatment weighting(IPTW).Log-rank test analysis was used to compare the survival probability of patients in the 3 groups,and Cox regression models were used to analyse the factors influencing the prognosis of RB patients.Results A total of 1188 RB cases were included in this study,including 426 cases in surgery group,200 cases in chemotherapy group and 562 cases in surgery combined with chemotherapy group.After IPTW weighting,baseline data such as age,sex and race were balanced(P＞0.05).Log-rank test results showed that the survival curves of the three groups were significantly different before and after weighting(P＜0.05).After weighted,the survival of patients in surgery group was significantly better than that in chemotherapy group and surgery combined chemotherapy group(P＜0.05),and there was no statistical significance between chemotherapy group and surgery combined chemotherapy group(P＞0.05).The weighted patient survival probability at 1st,3rd and 5th years were 99.7%,98.9%and 98.6%in surgery group;97.4%,95.8%and 95.8%in chemotherapy group;and 97.9%,95.8%and 95.0%in surgery combined chemotherapy group.Cox regression analysis showed that compared with surgery group,the specific risk ratio of death was 1.367(95%CI 1.100-1.700)in chemotherapy group and 1.132(95%CI 0.963-1.330)in combined chemotherapy group.Compared with patients with 1 RB lesion,the patient-specific mortality risk ratio for patients with 2 or more RB lesions was 0.399(95%CI 0.268-0.594).Conclusions Patients with RB have higher survival rates probability after treatment.After controlling the influence of age,sex and other factors,the effect of surgery was better among the three treatment methods.Multifocality may be an independent prognostic factor in RB patients.