Objective To introduce the causes of accidents and the diagnosis and treatment of two patients with radiation-induced skin injury admitted to our hospital in 2023, and to provide a reference for the clinical treatment of subsequent radiation-induced skin injury. Methods The clinical treatment process of two patients with acute skin injury caused by external radiation exposure were summarized and analyzed. Results The exposure history of the two patients was reconstructed, the flaw detection scenario was simulated, the biological dose and hand skin exposure dose were estimated, and the infrared thermal imaging device was used for dynamic monitoring. A comprehensive analysis was conducted based on clinical manifestations and other data. The diagnosis of “Xie” was excessive exposure combined with acute radiation-induced skin injury on both hands (Grade IV for the right hand palm, index finger, and middle finger and Grade II for the left hand little finger). The diagnosis of “Hao” was acute radiation-induced skin injury on both hands (Grade I). The two patients received different clinical treatment measures: “Xie” was treated with both local and systemic therapies, while “Hao” was mainly treated with systemic therapy. Conclusion After systematic and effective treatment, the radiation-induced skin injuries healed in both patients.

ObjectiveTo evaluate the therapeutic effect of Huazhuo SanJie Chubi presciption （HSCD） on chronic gouty arthritis （CGA） rats with low-grade inflammation and to explore the underlying mechanism with a focus on macrophage polarization. MethodsThe 41 male 6-week-old SD rats were randomly allocated， using the random number table， to a normal group （n=8） and a model group （n =33）. CGA with low-grade inflammation was induced in the model group by daily gavage of potassium oxonate （250 mg·kg^-1·d^-1） and hypoxanthine （300 mg·kg^-1·d^-1）， combined with intra-articular injection of a monosodium urate （MSU） crystal suspension （50 μL， 25 g·L^-¹） into the left ankle twice weekly. After 4 weeks of modeling， 3 rats were randomly selected from each group for model validation. The remaining successfully modeled rats were randomly divided into a model group， an HSCD group （10.35 g·kg^-1·d^-1， gavage once daily）， an M1 polarization agonist group （L-methionine sulfoximine， 300 mg·kg^-1， subcutaneous injection every other day）， an M1 polarization agonist + HSCD group， an M2 polarization inhibitor group （PD0325901， 10 mg·kg^-1·d^-1， gavage once daily）， and M2 polarization inhibitor + HSCD group. The corresponding drug or drug combination was administered according to group assignment， whereas rats in the normal and model groups received 0.5% carboxymethyl cellulose sodium （CMC-Na） vehicle （10.35 g·kg^-1·d^-1， gavage once daily）. All interventions were continued for four weeks. During the intervention period， except for the normal group， potassium oxonate （250 mg·kg⁻¹） and hypoxanthine （300 mg·kg^-1） were co-administered by gavage every other day to maintain the model. At the end of treatment， serum uric acid （SUA）， ankle joint diameter and joint swelling index were measured. The levels of high-sensitivity C-reactive protein （hs-CRP）， interleukin-1β （IL-1β）， interleukin-6 （IL-6）， tumor necrosis factor-α （TNF-α）， chemokine C-C motif ligand 2 （CCL2）， S100 calcium-binding protein A8/A9 （S100A8/A9）， interleukin-10 （IL-10） and arginase-1 （Arg-1） in serum and joint fluid were determined by enzyme-linked immunosorbent assay （ELISA）. High-frequency ultrasound was used to assess MSU deposition in the ankle joint. Hematoxylin-eosin （HE） staining was performed to evaluate synovial histopathological changes. Quantitative Real-time PCR and immunofluorescence were used to detect the mRNA and protein expression of the M1 macrophage polarization markers inducible nitric oxide synthase （iNOS） and the M2 macrophage polarization marker scavenger receptor cysteine-rich type 1 protein M130 （CD163） in synovial tissue. ResultsCompared with the normal group， the model group showed significantly elevated SUA level and joint swelling index， and increased levels of pro-inflammatory cytokines， CCL2， and S100A8/A9 in both serum and joint fluid （P<0.05）， accompanied by MSU deposition and synovial inflammation in the ankle joint. The mRNA and protein expression levels of macrophage polarization M1/M2 markers iNOS and CD163 in synovial tissues were also significantly up-regulated （P<0.05）. Compared with model group， rats in HSCD group had significantly lower SUA levels， attenuated joint swelling， reduced serum levels of pro-inflammatory cytokines， and decreased levels of CCL2 and S100A8/A9 in both serum and joint fluid， accompanied with alleviated MSU deposition and synovial inflammation （P<0.05）. HSCD markedly downregulated the mRNA and protein expression of M1 marker iNOS （P<0.05）， whereas it had no significant effect on the expression of M2 marker CD163. Compared with the M1 polarization agonist group， the M1 polarization agonist + HSCD group showed significantly reduced joint swelling， lower serum levels of pro-inflammatory cytokines， and decreased levels of CCL2 and S100A8/A9 in joint fluid （P<0.05）. In addition， synovial inflammatory cell infiltration and angiogenesis were attenuated， and iNOS mRNA and protein expression levels were significantly reduced （P<0.05）. Compared with the M2 polarization inhibitor group， the M2 polarization inhibitor + HSCD group exhibited reduced joint swelling， decreased levels of CCL2 and S100A8/A9 in joint fluid and ameliorated synovial inflammation （P<0.05）， whereas the levels of anti-inflammatory mediators （IL-10， Arg-1） and CD163 mRNA and protein expression were not significantly increased. ConclusionHSCD alleviates low-grade inflammation in CGA rats， at least in part， by inhibiting macrophage polarization toward the M1 phenotype.

ObjectiveThis paper aims to observe the effect of Huazhuo Sanjie Chubi prescription （HSCD） on the gouty bone erosion model rats and investigate its action mechanism. MethodsThirty-six two-month-old male SD rats were randomly divided into the blank group with nine rats and the modeling group with 27 rats. The rats in the modeling group were administered hypoxanthine solution at 300 mg·kg^-1·d^-1 and potassium oxonate solution at 250 mg·kg^-1·d^-1， combined with intra-articular injection of 200 μL monosodium urate （MSU） crystal suspension at 25 g·L^-1 into the right ankle joint （joint injection once every three days）， so as to induce the gouty bone erosion model. After four weeks of modeling， three rats were selected from these two groups to validate the model. The modeled 24 rats were randomly divided into the model group， HSCD group （10.35 g·kg^-1·d^-1）， allopurinol group （20 mg·kg^-1·d^-1）， and inhibitor group （LY294002， 10 mg·kg^-1·d^-1）， with six rats per group. Except for the blank group， rats in all other groups continued to receive hypoxanthine solution at 300 mg·kg^-1 and potassium oxonate solution at 250 mg·kg^-1 via gavage concurrently with administration to maintain modeling intervention. The rats in the HSCD group and allopurinol group received administration by gavage at the above doses. The rats in the inhibitor group received an intraperitoneal injection at the above dose. The rats in the blank group and model group received saline （10.35 g·kg^-1·d^-1） by gavage for four consecutive weeks. After administration， ankle joint swelling of the rats in all groups was observed， and the diameters were measured. Bone volume fraction （BV/TV） and bone surface area to bone volume （BS/BV） were observed and quantitatively analyzed by Micro-CT. Histopathological changes in the ankle joint were observed by hematoxylin-eosin （HE） staining and safranin O-fast green staining. The uric acid in the rats' serum was determined by enzyme colorimetry. The levels of inflammatory factors， including tumor necrosis factor-α （TNF-α）， interleukin （IL）-1β， and IL-6 were measured by enzyme-linked immunosorbent assay （ELISA）. The protein expressions of receptor activator of nuclear factor-κB ligand （RANKL） and phosphorylated （p）-phosphatidylinositol-3-kinase （PI3K） in ankle joint tissues of rats were detected by immunofluorescence staining. The mRNA levels of the proteins related to the bone erosion， including RANKL， tartrate-resistant acid phosphatase （TRAP）， cathepsin K （CTSK）， and matrix metalloproteinase-9 （MMP-9） in the ankle joint tissues of rats were determined by real-time fluorescence quantitative polymerase chain reaction （Real-time PCR）. The expressions of the proteins related to the bone erosion， including RANKL， CTSK， TRAP， MMP-9， and the proteins related to the PI3K/protein kinase B （Akt） signaling pathway， including PI3K， Akt， mammalian target of rapamycin （mTOR）， p-PI3K， phosphorylated protein kinase B （p-Akt）， and phosphorylated mammalian target of rapamycin （p-mTOR）， were detected by Western blot. ResultsCompared with the blank group， the modeling group showed marked ankle swelling and increased diameter. Micro-CT revealed an uneven articular surface and honeycomb-like bone erosion in the ankle joint. Quantitative analysis showed decreased BV/TV and increased BS/BV （P<0.05）. HE staining revealed a narrowed joint space， rough and discontinuous cartilage surfaces， reduced and unevenly distributed chondrocytes， partial hypertrophy， and blurred tidemarks， confirming successful model establishment. After four weeks of intervention， compared with those in the blank group， the rats in the model group exhibited severe ankle swelling and increased diameters （P<0.05）. Micro‑CT showed that the ankle joint surface was irregular， and bone erosion exhibited a honeycomb‑like morphology. The microstructural parameters of the bone revealed a decreased BV/TV and an increased BS/BV （P<0.05）. Histopathological examination revealed a narrowed joint space and severe articular cartilage destruction. The levels of uric acid in the serum and inflammatory factors （IL-1β， IL-6， and TNF-α） were increased （P<0.05）. The mRNA and protein levels of the proteins related to bone erosion in joint tissue， including RANKL， CTSK， TRAP， and MMP-9， were upregulated （P<0.05）. The ratios of p-PI3K/PI3K， p-Akt/Akt， and p-mTOR/mTOR in the proteins related to the PI3K/Akt signaling pathway were increased （P<0.05）. RANKL and p-PI3K protein fluorescence intensities were elevated （P<0.05）. Compared with those in the model group， the above indicators in all other administration groups showed varying degrees of improvement. The HSCD group and inhibitor groups exhibited more significant effects in reducing ankle swelling， improving bone erosion， bone microstructure （significant decrease in BV/TV and increase in BS/BV）， and the pathology of cartilage erosion， lowering inflammatory factor levels， downregulating the proteins related to the bone erosion， and suppressing activation of the PI3K/Akt/mTOR pathway （P<0.05）. The uric acid levels in rats' serum were reduced in both HSCD and allopurinol groups （P<0.05）. Compared with those in the HSCD group， the rats in the allopurinol group had larger ankle diameters （P<0.05）， more severe bone erosion and bone microstructure damage （P<0.05）， worse improvement of the pathology of cartilage erosion， higher levels of IL-6 and TNF-α （P<0.05）， elevated expressions of the proteins related to the bone erosion， higher expression ratio of proteins related to the PI3K/Akt signaling pathway （P<0.05）， and higher fluorescence intensities of RANKL and p-PI3K proteins （P<0.05）. The inhibitor group achieved comparable results to the HSCD group in improvements of bone microstructure and the reduction of IL-1β and IL-6， stronger suppression of TNF-α and PI3K/Akt/mTOR signaling pathway activation （P<0.05）， but weaker effects on cartilage repair and serum uric acid reduction （P<0.05）. ConclusionHSCD effectively reduces uric acid levels in serum， suppresses inflammatory factor secretion， and downregulates the expressions of proteins related to bone erosion， including RANKL， CTSK， TRAP， and MMP-9 in the joint tissues. Its action mechanism of improving gouty bone erosion may be associated with inhibition of the PI3K/Akt signaling pathway.

: To analyze the prevalence of anemia and iron deficiency among primary and secondary school students in Rural Nutrition Improvement Program areas of Guizhou Province in 2023, and to explore the related factors, so as to provide evidence for Rural Nutrition Improvement Program optimization. Methods: In September 2023, a stratified random cluster sampling strategy was used to select 40 rural compulsory education schools with rural nutrition improvement program in five counties of Guizhou Province. School level questionnaire was employed to collect information of basic characteristics and school meal implementation. A total of 7 826 primary and secondary school students aged 6-16 underwent anthropometry and hemoglobin (Hb) determination; serum ferritin (SF) was additionally measured in a random subsample of 1 795 pupils. Students in Grade 3 and above also completed a questionnaire covering demographic characteristics, dietary behaviours and nutrition knowledge. Group comparisons were conducted by Chi square test or Fisher s exact test, and multivariable Logistic regression models were constructed to identify factors associated with anemia and iron deficiency. Results: The overall Hb level was (133.21±12.95)g/L, with an anemia prevalence of 7.17%. The overall SF level was (69.58±59.01)μg/L, with an iron deficiency prevalence of 2.73%. Multivariable analysis showed that stunting ( OR =1.88), school menus without nutrient calculation ( OR =1.61) and absence of menu planning software in the current semester ( OR =2.34) independently increased anemia risk, whereas obesity reduced it ( OR =0.54) (all P <0.05). Girls ( OR =4.16) and Grades 7-9 ( OR =5.93) increased iron deficiency risk (both P <0.05). Compared with rarely eating fresh vegetables, students with consuming <3 kinds per day ( OR =0.08) or exactly 3 kinds per day ( OR =0.06) had lower iron deficiency risks (both P <0.05). Conclusions Anemia and iron deficiency are prevalent among primary and secondary school students in Guizhou. Targeted intervention measures should be implemented for key populations to enhance the effectiveness of nutrition improvement program.

ObjectiveTo systematically evaluate the content differences of 4 components in Leonuri Herba granules， reveal the quality fluctuation patterns of products from the same and different manufacturers， providing scientific basis for the optimization of production process and quality control. MethodsHigh performance liquid chromatography-diode array detector-charged aerosol detector（HPLC-DAD-CAD） was employed to determine the contents of 4 components（syringic acid， leonurine hydrochloride， ferulic acid， and stachydrine hydrochloride） in samples from 19 manufacturers（53 batches， 159 boxes）. Additionally， fingerprint profiles were constructed， and the fingerprint dissimilarity（P_S） and relative standard deviation（RSD） of different samples from the same manufacturer were calculated. A principal component analysis（PCA） model was established with P_S and the RSD values of the 4 components as variables to classify the manufacturers. Finally， samples from 5 manufacturers（M1-M5） covering three consistency groups were selected to calculate three quality consistency parameters， namely intra-batch consistency（P_A）， inter-batch consistency（P_B）， and P_S. Then， PCA was performed with P_A， P_B， and P_S of these 5 manufacturers as variables. ResultsThe average total content of the 4 index components per bag across the 19 manufacturers ranged from 41.10 mg to 97.54 mg. Among them， the content of stachydrine hydrochloride（a pharmacopoeial quality control component） was 32.46-72.70 mg per bag， all meeting the requirements of the 2025 edition of the Pharmacopoeia of the People's Republic of China， with RSD of 1.7%-17.1%. The content ranges of the other 3 components were as follows：syringic acid of 1.43-41.92 mg per bag， leonurine hydrochloride of 0.67-11.85 mg per bag， and ferulic acid of 0.11-3.81 mg per bag. Notably， leonurine hydrochloride exhibited the most significant content fluctuation among samples from the same manufacturer（RSD of 4.8%-59.2%）. PCA results showed that the 19 manufacturers could be classified into 3 categories. Samples from 8 manufacturers（M2， M6， M7， M8， M10， M15， M17， M18） demonstrated relatively high consistency， five manufacturers（M3， M9， M12， M13， M14） showed moderate consistency， six manufacturers（M1， M4， M5， M11， M16， M19） exhibited low consistency. The two methods yielded consistent classification results for the 5 representative manufacturers， verifying the reliability of the proposed method. Among these， manufacturer M2 showed the best quality consistency and the highest total content of indicator components among M1-M5. ConclusionThe HPLC-DAD-CAD multi-detector hyphenation technology established in this study enables the accurate detection of 4 components in Leonuri Herba granules. Significant differences in the total content of these four components are observed among products from 19 manufacturers. The application of 2 consistency evaluation methods combined with PCA can effectively classify their consistency into 3 categories， and the classification results of the 2 methods are highly consistent. This study provides scientific basis for the process optimization and quality standard improvement of Leonuri Herba granules.

ObjectiveTo systematically evaluate the content differences of 4 components in Leonuri Herba granules， reveal the quality fluctuation patterns of products from the same and different manufacturers， providing scientific basis for the optimization of production process and quality control. MethodsHigh performance liquid chromatography-diode array detector-charged aerosol detector（HPLC-DAD-CAD） was employed to determine the contents of 4 components（syringic acid， leonurine hydrochloride， ferulic acid， and stachydrine hydrochloride） in samples from 19 manufacturers（53 batches， 159 boxes）. Additionally， fingerprint profiles were constructed， and the fingerprint dissimilarity（P_S） and relative standard deviation（RSD） of different samples from the same manufacturer were calculated. A principal component analysis（PCA） model was established with P_S and the RSD values of the 4 components as variables to classify the manufacturers. Finally， samples from 5 manufacturers（M1-M5） covering three consistency groups were selected to calculate three quality consistency parameters， namely intra-batch consistency（P_A）， inter-batch consistency（P_B）， and P_S. Then， PCA was performed with P_A， P_B， and P_S of these 5 manufacturers as variables. ResultsThe average total content of the 4 index components per bag across the 19 manufacturers ranged from 41.10 mg to 97.54 mg. Among them， the content of stachydrine hydrochloride（a pharmacopoeial quality control component） was 32.46-72.70 mg per bag， all meeting the requirements of the 2025 edition of the Pharmacopoeia of the People's Republic of China， with RSD of 1.7%-17.1%. The content ranges of the other 3 components were as follows：syringic acid of 1.43-41.92 mg per bag， leonurine hydrochloride of 0.67-11.85 mg per bag， and ferulic acid of 0.11-3.81 mg per bag. Notably， leonurine hydrochloride exhibited the most significant content fluctuation among samples from the same manufacturer（RSD of 4.8%-59.2%）. PCA results showed that the 19 manufacturers could be classified into 3 categories. Samples from 8 manufacturers（M2， M6， M7， M8， M10， M15， M17， M18） demonstrated relatively high consistency， five manufacturers（M3， M9， M12， M13， M14） showed moderate consistency， six manufacturers（M1， M4， M5， M11， M16， M19） exhibited low consistency. The two methods yielded consistent classification results for the 5 representative manufacturers， verifying the reliability of the proposed method. Among these， manufacturer M2 showed the best quality consistency and the highest total content of indicator components among M1-M5. ConclusionThe HPLC-DAD-CAD multi-detector hyphenation technology established in this study enables the accurate detection of 4 components in Leonuri Herba granules. Significant differences in the total content of these four components are observed among products from 19 manufacturers. The application of 2 consistency evaluation methods combined with PCA can effectively classify their consistency into 3 categories， and the classification results of the 2 methods are highly consistent. This study provides scientific basis for the process optimization and quality standard improvement of Leonuri Herba granules.

ObjectiveTo establish the fingerprints of 15 batches of Hengzhi Kechuan capsules， to quantitatively analyze 10 index components， and to evaluate the quality uniformity of samples from different batches. MethodsThe fingerprints and quantitative analysis of Hengzhi Kechuan capsules were established by a combination method of high performance liquid chromatography coupled with diode array detector and charged aerosol detector（HPLC-DAD-CAD）， adenosine， guanosine， vanillic acid， safflomin A， agarotetrol， naringin， hesperidin， militarine， ginsenoside Rb₁， and glycyrrhizic acid were selected as quality attribute indexes. A total of 15 batches of Hengzhi Kechuan capsules from 2022 to 2024（3 boxes per batch） were qualitatively and quantitatively analyzed， and the quality uniformity level of the manufacturers was characterized by parameters of intra-batch consistency（P_A） and inter-batch consistency（P_B）. The homogeneity and difference of quality attribute indexes of samples from different years were analyzed by heatmap clustering analysis. ResultsHPLC fingerprints and quantitative method of Hengzhi Kechuan capsules were established， and the methods could be used for qualitative and quantitative analysis of this preparation， which was found to be stable and reliable by method validation. The similarity of fingerprints of 15 batches of samples was 0.887-0.975， a total of 13 common peaks were calibrated， and 10 common peaks were designated， all of which were quality attribute index components. The results of quantitative analysis showed that the contents of the above 10 ingredients in the samples were 0.038-0.078， 0.115-0.251， 0.007-0.018， 0.291-0.673， 0.122-0.257， 0.887-1.905， 1.841-3.364， 1.412-2.450， 2.207-3.112， 0.650-1.161， respectively. And the contents of ginsenoside Rb₁ and glycyrrhizic acid met the limit requirements in the 2020 edition of Chinese Pharmacopoeia. For the samples from 15 batches， the P_A values of the 10 index components were all <10%， indicating good intra-batch homogeneity， and the P_B values ranged from 33.86% to 92.97%， suggesting that the inter-batch homogeneity was poor. Heatmap clustering analysis showed that the samples from different years were clustered into separate categories， and adenosine， guanosine， safflomin A， naringin， hesperidin and agarotetrol were the main differential components. ConclusionThe intra-annual quality uniformity of Hengzhi Kechuan capsules is good and the inter-annual quality uniformity is insufficient， which may be related to the quality difference of Pinellinae Rhizoma Praeparatum， Carthami Flos， Citri Sarcodactylis Fructus， Citri Reticulatae Pericarpium， Aquilariae Lignum Resinatum， Citri Fructus， etc. In this study， the fingerprint and multi-indicator determination method of Hengzhi Kechuan capsules was established， which can be used for more accurate and efficient quality control and standardization enhancement.

The concept of holism is the core idea of traditional Chinese medicine （TCM）. Various organs and tissues coordinate with each other to maintain the body's life activities， with a close and mutual influence between the spleen， stomach， and the central nervous system （brain）. The gut-brain axis plays an important bridging role between the digestive system and the central nervous system， achieving bidirectional information exchange between the brain and the gastrointestinal tract through complex neuroendocrine and immune mechanisms. The theory of cross-organ interaction involves the mutual influence， coordination， and integration between different organs and systems； multimodality， on the other hand， utilizes multiple sensory modalities， such as vision， hearing， and touch， to convey information. By combining TCM theory with the gut-brain axis theory， a cross-organ multimodal characterization system is established to explore its mechanism and application value in refractory diseases such as functional gastrointestinal disorders， precancerous gastrointestinal diseases， Alzheimer's disease， Parkinson's syndrome， type 2 diabetes， and depression.

Approximately 10% of the global adult population has diabetes, with accumulating evidence linking suboptimal vitamin D levels to an increased risk of type 2 diabetes and its complications. Current clinical studies suggest that vitamin D supplementation may enhance insulin sensitivity and improve glycemic control, prompting significant interest in its potential as a therapeutic intervention. However, further high-quality, large-scale randomized controlled trials are required to validate its efficacy in glucose metabolism regulation and clarify the underlying molecular mechanisms. These investigations will provide critical evidence to inform precision medicine approaches for diabetes prevention and management.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.