1.Analysis of co-occurrence patterns of common mental health issues among college students
YAN Yulin, LUO Miyang, LUO Jiayou, MA Suiyi, LI Jia, CHEN Xi, WANG Feng, LIU Hao
Chinese Journal of School Health 2026;47(3):379-383
Objective:
The cross sectional study aimed to identify predominant co-occurrence patterns among six common mental health issues in college students, so as to provide empirical basis for designing targeted interventions.
Methods:
From October 2024, a total of 9 837 students from 4 universities in Xiangtan City, Hunan Province, participated in the current study by multistage random cluster sampling method. Participants completed self report measures, including the Patient Health Questionnaire-9 (PHQ-9), Generalized Anxiety Disorder 7 item Scale (GAD-7), Young s Internet Addiction Diagnostic Questionnaire, the Adolescent Insomnia Symptom Self rating Scale, the Ottawa Self injury Inventory, and the Brief Community Assessment of Psychic Experiences Questionnaire. Demographic and co-occurrence characteristics were first compared using Chi square or trend Chi-square tests, followed by application of the Apriori algorithm to mine association rules for primary co-occurrence patterns.
Results:
The detection rate of co-occuring the common mental health issues was 46.44%. The detection rate was significantly higher in female than in male students (50.42%, 43.61%; χ 2=44.46) and in students from rural versus urban areas (47.22%, 44.60%; χ 2=5.67) (both P <0.05). Significant differences were observed among freshmen, sophomores, juniors, and seniors (46.63%, 48.35%, 45.05% , 43.66%, respectively; χ 2=9.22, P <0.05), although no statistically significant trend was detected ( χ 2 trend =3.75, P = 0.05 ). Association rule mining identified “anxiety + depression” “anxiety + psychotic experiences + depression” and “anxiety + sleep disorder + depression” as the combinations with the highest support. In addition, “anxiety+depression+Internet addiction+psychotic experiences =>sleep disorder (>= refered to the occurrence of the latter item under the condition that the former item occurs)” and “anxiety + depression+Internet addiction=>sleep disorder” were combinations with relatively high confidence.
Conclusions
Co-occurrence of these mental health issues among college students is high and exhibits diverse patterns. Strategies to address this burden should prioritize integrated interventions that target these specific combinations of factors.
2.Expert consensus on the application of nasal cavity filling substances in nasal surgery patients(2025, Shanghai).
Keqing ZHAO ; Shaoqing YU ; Hongquan WEI ; Chenjie YU ; Guangke WANG ; Shijie QIU ; Yanjun WANG ; Hongtao ZHEN ; Yucheng YANG ; Yurong GU ; Tao GUO ; Feng LIU ; Meiping LU ; Bin SUN ; Yanli YANG ; Yuzhu WAN ; Cuida MENG ; Yanan SUN ; Yi ZHAO ; Qun LI ; An LI ; Luo BA ; Linli TIAN ; Guodong YU ; Xin FENG ; Wen LIU ; Yongtuan LI ; Jian WU ; De HUAI ; Dongsheng GU ; Hanqiang LU ; Xinyi SHI ; Huiping YE ; Yan JIANG ; Weitian ZHANG ; Yu XU ; Zhenxiao HUANG ; Huabin LI
Journal of Clinical Otorhinolaryngology Head and Neck Surgery 2025;39(4):285-291
This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans
;
Nasal Cavity/surgery*
;
Nasal Surgical Procedures
;
China
;
Consensus
;
Sinusitis/surgery*
;
Dermal Fillers
3.Effect of SLC7A11 Gene on Progression of Hepatocellular Carcinoma by Regualating Iron Death Pathway
Liuzheng LI ; Leisheng XU ; Kanghong LUO ; Mingting ZHANG ; Yan WANG ; Xuechang GAO ; Jiawei FENG ; Guocha GONG
Journal of Kunming Medical University 2025;46(10):32-43
Objective To investigate the mechanism by which the SLC7A11 gene regulates the development and progression of hepatocellular carcinoma(HCCLM3)through the ferroptosis pathway,and to evaluate its potential as a therapeutic target.Methods Differentially expressed ferroptosis-related genes in liver cancer were screened based on data from the TCGA and ICGC databases.Detection of mRNA expression levels of TERT,MIOX,MYCN,NOX4,and SLC7A11 in tumor and adjacent non-tumorous tissues from 32 clinical liver cancer samples using qRT-PCR.Further analysis of SLC7A11 and its downstream molecules SLC3A2,GSS,and GPX4 was performed through qRT-PCR,Western blot,and IHC to assess expression levels and tissue distribution.A stable SLC7A11-knockdown HCCLM3 cell line was constructed and used to establish a subcutaneous xenograft tumor model in nude mice to evaluate its effect on tumor growth.Mice were divided into two groups(n=6 per group):HCCLM3+sh-NC and HCCLM3+sh-SLC7A11.Serum levels of IL-6,IL-1β,and TNF-α were measured using ELISA.Histopathological changes in tumor tissues were examined by H&E staining,and the expression of key genes was validated through multiple approaches.Results Bioinformatics analysis showed high expression of SLC7A11 in hepatocellular carcinoma tissues(P<0.05),significantly associated with poor patient prognosis.Clinical sample validation revealed significantly higher expression of SLC7A11,SLC3A2,GSS,and GPX4 in cancer tissues compared to control groups(All P<0.05).SLC7A11 knockdown significantly inhibited tumor volume and wet weight(P<0.05),and H&E staining showed reduced vascular density in the sh-SLC7A11 group.ELISA results showed elevated serum levels of IL-1β,IL-6,and TNF-α in the sh-SLC7A11 group.qRT-PCR,Western blot,and IHC all showed significantly downregulated expression of SLC7A11,SLC3A2,GSS,and GPX4 in tumor tissues(All P<0.05).Conclusion SLC7A11 inhibits ferroptosis by regulating the GSH-GPX4 axis,promoting hepatocellular carcinoma cell growth.Targeted inhibition of SLC7A11 can induce tumor cell ferroptosis and suppress tumor progression,suggesting it may be an important therapeutic target for hepatocellular carcinoma.
4.Inhibitory effects of Shuyu Pills combined with everolimus on TGF-β1-induced epithelial-mesenchymal transition in triple-negative breast cancer cells
Xiao-shan LUO ; Su XIE ; Dou-dou FENG ; Yan-yun MENG ; Jing-zhe ZHAO ; Qing XIE ; Xiang-li LING
Chinese Traditional Patent Medicine 2025;47(7):2190-2197
AIM To investigate the effects of Shuyu Pills combined with evolimus on the epithelial mesenchymal transformation of triple negative breast cancer cells 4T1 and MDA-MB-231 induced by TGF-β1.METHODS The 4T1 and MDA-MB-231 cells were divided into the blank group and the induction group to induce the epithelial mesenchymal transformation with TGF-β1 cytokine treatment,followed by the assignment into the model group,the Shuyu Pills group,the everolimus group and the Shuyu Pills combined with everolimus group.CCK8 method,plate cloning method,cell scratch test and Transewll test were used to detect the proliferation,cloning formation,migration and invasion ability of the cells whose expressions of E-cadherin,N-cadherin,Vimentin,MMP9,MMP2 and pathway proteins PTEN,PI3K,Akt and mTOR were detected by Western blot.RESULTS Compared with the blank group,the induction group displayed a cell morphological change from epithelioid to stromal,decreased expression of E-cadherin protein(P<0.01);and increased protein expressions of N-cadherin and Vimentin(P<0.05).Compared with the model group,each group intervened with the medicine displayed decreased proliferation,clone formation,migration and invasion ability of both kinds of cells(P<0.01);increased protein expressions of PTEN and E-cadherin(P<0.05,P<0.01);and decreased protein expressions of PI3K,Akt,mTOR,N-cadherin,Vimentin,MMP9 and MMP2(P<0.05,P<0.01);and more significantly in the Shuyu Pills combined with evolimus group(P<0.05,P<0.01).CONCLUSION With a more ideal effect than the single uses in inhibiting the TGF-β1-induced epithelial mesenchymal transformation of triple-negative breast cancer cells,the combination use of Shuyu Pills and everolimus may work through the regulation of PI3K/Akt/mTOR signaling pathway.
5.Guideline for the diagnosis and treatment of vertebral refracture after percutaneous vertebral augmentation in elderly patients with osteoporotic thoracolumbar compression fractures (version 2025)
Yong YANG ; Xiaoguang ZHOU ; Qixin CHEN ; Jian CHEN ; Jian DONG ; Liangjie DU ; Shunwu FAN ; Jin FAN ; Zhong FANG ; Haoyu FENG ; Shiqing FENG ; Haishan GUAN ; Aiguo GAO ; Yanzheng GAO ; Yong HAI ; Da HE ; Dengwei HE ; Haiyi HE ; Dianming JIANG ; Xuewen KANG ; Bin LIN ; Baoge LIU ; Changqing LI ; Fang LI ; Li LI ; Fangcai LI ; Weishi LI ; Xiaoguang LIU ; Hongjian LIU ; Xinyu LIU ; Yong LIU ; Zhongjun LIU ; Shibao LU ; Xuhua LU ; Fei LUO ; Yuhai MA ; Keya MAO ; Xuexiao MA ; Bin MENG ; Xu NING ; Limin RONG ; Hongxun SANG ; Jun SHU ; Tiansheng SUN ; Dasheng TIAN ; Zheng WANG ; Bing WANG ; Linfeng WANG ; Qingde WANG ; Qinghe WANG ; Lan WEI ; Jigong WU ; Baoshan XU ; Youjia XU ; Guoyong YIN ; Jinglong YAN ; Feng YAN ; Cao YANG ; Huilin YANG ; Qiang YANG ; Bin ZHAO ; Jie ZHAO ; Yue ZHU ; Jianguo ZHANG ; Wenzhi ZHANG ; Zhongmin ZHANG ; Zhaomin ZHENG ; Yan ZENG ; Baorong HE ; Wei MEI
Chinese Journal of Trauma 2025;41(7):613-626
Vertebral refracture following percutaneous vertebral augmentation (PVA) is commonly seen in elderly patients with osteoporotic thoracolumbar compression fractures (OTLCF). It can lead to recurrent pain, loss of vertebral height, progression of kyphosis, and even neurological dysfunction, significantly impairing patients′ quality of life. Current diagnosis and treatment face multiple challenges, including high misdiagnosis rate, difficulty in choosing between surgical and non-surgical treatment options, lack of standardized surgical protocols, interference from intralesional bone cement during procedures, inadequate stability of internal fixation in osteoporotic bone, and suboptimal compliance of anti-osteoporotic therapy. Establishing a standardized diagnostic and therapeutic framework is urgently needed. To standardize the management process and improve outcomes for vertebral refractures after PVA in elderly OTLCF patients, Spinal Trauma Group of the Orthopedic Branch of Chinese Medical Doctor Association organized experts in the field to develop Guideline for the diagnosis and treatment of vertebral refracture after percutaneous vertebral augmentation in elderly patients with osteoporotic thoracolumbar compression fractures ( version 2025), based on current literature and clinical experience, and adhering to principles of scientific rigor and clinical applicability. A total of 11 recommendations were proposed, encompassing diagnosis, treatment, and rehabilitation of vertebral refracture after PVA in elderly patients with OTLCF, aiming to provide a foundation for a standardized management.
6.Inhibition of interferon regulatory factor 4 orchestrates T cell dysfunction, extending mouse cardiac allograft survival.
Wenjia YUAN ; Hedong ZHANG ; Longkai PENG ; Chao CHEN ; Chen FENG ; Zhouqi TANG ; Pengcheng CUI ; Yaguang LI ; Tengfang LI ; Xia QIU ; Yan CUI ; Yinqi ZENG ; Jiadi LUO ; Xubiao XIE ; Yong GUO ; Xin JIANG ; Helong DAI
Chinese Medical Journal 2025;138(10):1202-1212
BACKGROUND:
T cell dysfunction, which includes exhaustion, anergy, and senescence, is a distinct T cell differentiation state that occurs after antigen exposure. Although T cell dysfunction has been a cornerstone of cancer immunotherapy, its potential in transplant research, while not yet as extensively explored, is attracting growing interest. Interferon regulatory factor 4 (IRF4) has been shown to play a pivotal role in inducing T cell dysfunction.
METHODS:
A novel ultra-low-dose combination of Trametinib and Rapamycin, targeting IRF4 inhibition, was employed to investigate T cell proliferation, apoptosis, cytokine secretion, expression of T-cell dysfunction-associated molecules, effects of mitogen-activated protein kinase (MAPK) and mammalian target of rapamycin (mTOR) signaling pathways, and allograft survival in both in vitro and BALB/c to C57BL/6 mouse cardiac transplantation models.
RESULTS:
In vitro , blockade of IRF4 in T cells effectively inhibited T cell proliferation, increased apoptosis, and significantly upregulated the expression of programmed cell death protein 1 (PD-1), Helios, CD160, and cytotoxic T lymphocyte-associated antigen (CTLA-4), markers of T cell dysfunction. Furthermore, it suppressed the secretion of pro-inflammatory cytokines interferon (IFN)-γ and interleukin (IL)-17. Combining ultra-low-dose Trametinib (0.1 mg·kg -1 ·day -1 ) and Rapamycin (0.1 mg·kg -1 ·day -1 ) demonstrably extended graft survival, with 4 out of 5 mice exceeding 100 days post-transplantation. Moreover, analysis of grafts at day 7 confirmed sustained IFN regulatory factor 4 (IRF4) inhibition, enhanced PD-1 expression, and suppressed IFN-γ secretion, reinforcing the in vivo efficacy of this IRF4-targeting approach. The combination of Trametinib and Rapamycin synergistically inhibited the MAPK and mTOR signaling network, leading to a more pronounced suppression of IRF4 expression.
CONCLUSIONS
Targeting IRF4, a key regulator of T cell dysfunction, presents a promising avenue for inducing transplant immune tolerance. In this study, we demonstrate that a novel ultra-low-dose combination of Trametinib and Rapamycin synergistically suppresses the MAPK and mTOR signaling network, leading to profound IRF4 inhibition, promoting allograft acceptance, and offering a potential new therapeutic strategy for improved transplant outcomes. However, further research is necessary to elucidate the underlying pharmacological mechanisms and facilitate translation to clinical practice.
Animals
;
Mice
;
Mice, Inbred BALB C
;
Mice, Inbred C57BL
;
Interferon Regulatory Factors/metabolism*
;
Heart Transplantation/methods*
;
T-Lymphocytes/immunology*
;
Sirolimus/therapeutic use*
;
Pyridones/therapeutic use*
;
Graft Survival/drug effects*
;
Pyrimidinones/therapeutic use*
;
Cell Proliferation/drug effects*
;
Apoptosis/drug effects*
;
Male
;
Signal Transduction/drug effects*
7.Mechanism of Tougu Xiaotong Capsules in alleviating glycolytic metabolism disorder of chondrocytes in osteoarthritis by modulating circFOXO3.
Chang-Long FU ; Yan LUO ; Jia-Jia XU ; Yan-Ming LIN ; Qing LIN ; Yan-Feng HUANG
China Journal of Chinese Materia Medica 2025;50(16):4641-4648
From the perspective of circular RNA forkhead box protein O3(circFOXO3) regulating glycolysis in osteoarthritis(OA) chondrocytes, this study investigated the mechanism by which Tougu Xiaotong Capsules(TGXTC) alleviated OA degeneration. In in vivo experiments, after randomized grouping and relevant interventions, morphological staining was used to observe structural changes in cartilage tissue. The mRNA level of circFOXO3 in cartilage tissue was detected by real-time quantitative PCR(RT-qPCR). Western blot analysis was used to detect changes in the expression of glucose transporter 1(GLUT1), hexokinase 2(HK2), pyruvate kinase M2(PKM2), lactate dehydrogenase A(LDHA), and matrix metalloproteinase 13(MMP13). In in vitro experiments, fluorescence in situ hybridization(FISH) was used to detect circFOXO3 expression in chondrocytes from each group. A lentiviral vector was used to construct circFOXO3-silenced(sh-circFOXO3) chondrocytes. RT-qPCR was used to analyze the changes in circFOXO3 levels after silencing, and Western blot was used to assess the regulatory effects of TGXTC on GLUT1, HK2, PKM2, LDHA, and MMP13 proteins in interleukin-1β(IL-1β)-induced chondrocytes under sh-circFOXO3 conditions. Masson staining and alcian blue staining results showed that the cartilage layer structure in the TGXTC and positive drug groups was improved compared with that in the model group. The mRNA level of circFOXO3 was significantly upregulated in both the TGXTC and positive drug groups, while the expression of the above-mentioned proteins was significantly reduced. FISH results showed that TGXTC upregulated the fluorescence intensity of circFOXO3 in IL-1β-induced chondrocytes. In the circFOXO3 silencing experiment, compared with the IL-1β group, circFOXO3 levels in the IL-1β + sh-circFOXO3 group were significantly decreased. Compared with the IL-1β + TGXTC group, circFOXO3 levels were significantly reduced in the IL-1β + sh-circFOXO3 + TGXTC group. Western blot results indicated that the elevated levels of GLUT1, HK2, PKM2, LDHA, and MMP13 proteins in chondrocytes of the IL-1β group were significantly inhibited by TGXTC intervention. However, this regulatory effect was attenuated after circFOXO3 silencing. In conclusion, TGXTC alleviate glycolytic metabolism disorder in OA chondrocytes and delay OA degeneration by regulating circFOXO3.
Chondrocytes/metabolism*
;
Animals
;
Drugs, Chinese Herbal/administration & dosage*
;
RNA, Circular/metabolism*
;
Osteoarthritis/genetics*
;
Glycolysis/drug effects*
;
Humans
;
Forkhead Box Protein O3/metabolism*
;
Male
;
Capsules
;
Matrix Metalloproteinase 13/genetics*
8.Progress in investigating astrocyte heterogeneity after spinal cord injury based on single-cell sequencing technology.
Lei DU ; Yan-Jun ZHANG ; Tie-Feng GUO ; Lin-Zhao LUO ; Ping-Yi MA ; Jia-Ming LI ; Sheng TAN
China Journal of Orthopaedics and Traumatology 2025;38(5):544-548
In recent years, the study of single-cell transcriptome sequencing technology in the heterogeneity of astrocytes (astrocytes) after spinal cord injury (SCI) has provided new perspectives on post-traumatic nerve regeneration and repair. To provide a review on the research progress of single-cell sequencing technology in astrocytes after spinal cord injury (SCI), and to more comprehensively and deeply elaborate the application of single-cell sequencing technology in the field of astrocytes after SCI. Single-cell sequencing technology can analyse the transcriptomes of individual cells in a high-throughput manner, thus revealing fine differences in cell types and states. By using single-cell sequencing technology, the heterogeneity of astrocytes after SCI and their association with nerve regeneration and repair were revealed. In conclusion, the application of single-cell sequencing technology provides an important tool to reveal the heterogeneity of astrocytes after SCI, to further explore the mechanisms of astrocytes in SCI, and to develop intervention strategies targeting their regulatory mechanisms in order to improve the therapeutic efficacy of SCI. The discovery of changes in astrocyte transcriptome dynamics has improved researchers' understanding of spinal cord injury lesion progression and provided new insights into the treatment of spinal cord injury at different time points. To date, all of these findings need to be validated by more basic research and sufficient clinical trials. In the future, single-cell sequencing technology, through interdisciplinary collaboration with bioinformatics, computer science, tissue engineering, and clinical medicine, is expected to open a new window for the treatment of spinal cord injury.
Spinal Cord Injuries/metabolism*
;
Astrocytes/cytology*
;
Single-Cell Analysis/methods*
;
Humans
;
Animals
;
Transcriptome
;
Nerve Regeneration
9.Effectiveness and safety of augmentative plating technique in managing nonunion following intramedullary nailing of long bones in the lower extremity: A systematic review and meta-analysis.
Cong-Xiao FU ; Hao GAO ; Jun REN ; Hu WANG ; Shuai-Kun LU ; Guo-Liang WANG ; Zhen-Feng ZHU ; Yun-Yan LIU ; Wen LUO ; Yong ZHANG ; Yun-Fei ZHANG
Chinese Journal of Traumatology 2025;28(3):164-174
PURPOSE:
To methodically assess the effectiveness of augmentative plating (AP) and exchange nailing (EN) in managing nonunion following intramedullary nailing for long bone fractures of the lower extremity.
METHODS:
PubMed, EMBASE, Web of Science, and the Cochrane Library were searched to gather clinical studies regarding the use of AP and EN techniques in the treatment of nonunion following intramedullary nailing of lower extremity long bones. The search was conducted up until May 2023. The original studies underwent an independent assessment of their quality, a process conducted utilizing the Newcastle-Ottawa scale. Data were retrieved from these studies, and meta-analysis was executed utilizing Review Manager 5.3.
RESULTS:
This meta-analysis included 8 studies involving 661 participants, with 305 in the AP group and 356 in the EN group. The results of the meta-analysis demonstrated that the AP group exhibited a higher rate of union (odds ratio: 8.61, 95% confidence intervals (CI): 4.12 - 17.99, p < 0.001), shorter union time (standardized mean difference (SMD): -1.08, 95% CI: -1.79 - -0.37, p = 0.003), reduced duration of the surgical procedure (SMD: -0.56, 95% CI: -0.93 - -0.19, p = 0.003), less bleeding (SMD: -1.5, 95% CI: -2.81 - -0.18, p = 0.03), and a lower incidence of complications (relative risk: -0.17, 95% CI: -0.27 - -0.06, p = 0.001). In the subgroup analysis, the time for union in the AP group in nonisthmal and isthmal nonunion of lower extremity long bones was shorter compared to the EN group (nonisthmal SMD: -1.94, 95% CI: -3.28 - -0.61, p < 0.001; isthmal SMD: -1.08, 95% CI: -1.64 - -0.52, p = 0.002).
CONCLUSION
In the treatment of nonunion in diaphyseal fractures of the long bones in the lower extremity, the AP approach is superior to EN, both intraoperatively (with reduced duration of the surgical procedure and diminished blood loss) and postoperatively (with an elevated union rate, shorter union time, and lower incidence of complications). Specifically, in the management of nonunion of lower extremity long bones with non-isthmal and isthmal intramedullary nails, AP demonstrated shorter union time in comparison to EN.
Humans
;
Bone Nails/adverse effects*
;
Bone Plates/adverse effects*
;
Femoral Fractures/surgery*
;
Fracture Fixation, Intramedullary/methods*
;
Fractures, Ununited/surgery*
;
Lower Extremity/injuries*
10.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test


Result Analysis
Print
Save
E-mail