BACKGROUND: T cell dysfunction, which includes exhaustion, anergy, and senescence, is a distinct T cell differentiation state that occurs after antigen exposure. Although T cell dysfunction has been a cornerstone of cancer immunotherapy, its potential in transplant research, while not yet as extensively explored, is attracting growing interest. Interferon regulatory factor 4 (IRF4) has been shown to play a pivotal role in inducing T cell dysfunction. METHODS: A novel ultra-low-dose combination of Trametinib and Rapamycin, targeting IRF4 inhibition, was employed to investigate T cell proliferation, apoptosis, cytokine secretion, expression of T-cell dysfunction-associated molecules, effects of mitogen-activated protein kinase (MAPK) and mammalian target of rapamycin (mTOR) signaling pathways, and allograft survival in both in vitro and BALB/c to C57BL/6 mouse cardiac transplantation models. RESULTS: In vitro , blockade of IRF4 in T cells effectively inhibited T cell proliferation, increased apoptosis, and significantly upregulated the expression of programmed cell death protein 1 (PD-1), Helios, CD160, and cytotoxic T lymphocyte-associated antigen (CTLA-4), markers of T cell dysfunction. Furthermore, it suppressed the secretion of pro-inflammatory cytokines interferon (IFN)-γ and interleukin (IL)-17. Combining ultra-low-dose Trametinib (0.1 mg·kg -1 ·day -1 ) and Rapamycin (0.1 mg·kg -1 ·day -1 ) demonstrably extended graft survival, with 4 out of 5 mice exceeding 100 days post-transplantation. Moreover, analysis of grafts at day 7 confirmed sustained IFN regulatory factor 4 (IRF4) inhibition, enhanced PD-1 expression, and suppressed IFN-γ secretion, reinforcing the in vivo efficacy of this IRF4-targeting approach. The combination of Trametinib and Rapamycin synergistically inhibited the MAPK and mTOR signaling network, leading to a more pronounced suppression of IRF4 expression. CONCLUSIONS Targeting IRF4, a key regulator of T cell dysfunction, presents a promising avenue for inducing transplant immune tolerance. In this study, we demonstrate that a novel ultra-low-dose combination of Trametinib and Rapamycin synergistically suppresses the MAPK and mTOR signaling network, leading to profound IRF4 inhibition, promoting allograft acceptance, and offering a potential new therapeutic strategy for improved transplant outcomes. However, further research is necessary to elucidate the underlying pharmacological mechanisms and facilitate translation to clinical practice.
Animals ; Mice ; Mice, Inbred BALB C ; Mice, Inbred C57BL ; Interferon Regulatory Factors/metabolism* ; Heart Transplantation/methods* ; T-Lymphocytes/immunology* ; Sirolimus/therapeutic use* ; Pyridones/therapeutic use* ; Graft Survival/drug effects* ; Pyrimidinones/therapeutic use* ; Cell Proliferation/drug effects* ; Apoptosis/drug effects* ; Male ; Signal Transduction/drug effects*

From the perspective of circular RNA forkhead box protein O3(circFOXO3) regulating glycolysis in osteoarthritis(OA) chondrocytes, this study investigated the mechanism by which Tougu Xiaotong Capsules(TGXTC) alleviated OA degeneration. In in vivo experiments, after randomized grouping and relevant interventions, morphological staining was used to observe structural changes in cartilage tissue. The mRNA level of circFOXO3 in cartilage tissue was detected by real-time quantitative PCR(RT-qPCR). Western blot analysis was used to detect changes in the expression of glucose transporter 1(GLUT1), hexokinase 2(HK2), pyruvate kinase M2(PKM2), lactate dehydrogenase A(LDHA), and matrix metalloproteinase 13(MMP13). In in vitro experiments, fluorescence in situ hybridization(FISH) was used to detect circFOXO3 expression in chondrocytes from each group. A lentiviral vector was used to construct circFOXO3-silenced(sh-circFOXO3) chondrocytes. RT-qPCR was used to analyze the changes in circFOXO3 levels after silencing, and Western blot was used to assess the regulatory effects of TGXTC on GLUT1, HK2, PKM2, LDHA, and MMP13 proteins in interleukin-1β(IL-1β)-induced chondrocytes under sh-circFOXO3 conditions. Masson staining and alcian blue staining results showed that the cartilage layer structure in the TGXTC and positive drug groups was improved compared with that in the model group. The mRNA level of circFOXO3 was significantly upregulated in both the TGXTC and positive drug groups, while the expression of the above-mentioned proteins was significantly reduced. FISH results showed that TGXTC upregulated the fluorescence intensity of circFOXO3 in IL-1β-induced chondrocytes. In the circFOXO3 silencing experiment, compared with the IL-1β group, circFOXO3 levels in the IL-1β + sh-circFOXO3 group were significantly decreased. Compared with the IL-1β + TGXTC group, circFOXO3 levels were significantly reduced in the IL-1β + sh-circFOXO3 + TGXTC group. Western blot results indicated that the elevated levels of GLUT1, HK2, PKM2, LDHA, and MMP13 proteins in chondrocytes of the IL-1β group were significantly inhibited by TGXTC intervention. However, this regulatory effect was attenuated after circFOXO3 silencing. In conclusion, TGXTC alleviate glycolytic metabolism disorder in OA chondrocytes and delay OA degeneration by regulating circFOXO3.
Chondrocytes/metabolism* ; Animals ; Drugs, Chinese Herbal/administration & dosage* ; RNA, Circular/metabolism* ; Osteoarthritis/genetics* ; Glycolysis/drug effects* ; Humans ; Forkhead Box Protein O3/metabolism* ; Male ; Capsules ; Matrix Metalloproteinase 13/genetics*

In recent years, the study of single-cell transcriptome sequencing technology in the heterogeneity of astrocytes (astrocytes) after spinal cord injury (SCI) has provided new perspectives on post-traumatic nerve regeneration and repair. To provide a review on the research progress of single-cell sequencing technology in astrocytes after spinal cord injury (SCI), and to more comprehensively and deeply elaborate the application of single-cell sequencing technology in the field of astrocytes after SCI. Single-cell sequencing technology can analyse the transcriptomes of individual cells in a high-throughput manner, thus revealing fine differences in cell types and states. By using single-cell sequencing technology, the heterogeneity of astrocytes after SCI and their association with nerve regeneration and repair were revealed. In conclusion, the application of single-cell sequencing technology provides an important tool to reveal the heterogeneity of astrocytes after SCI, to further explore the mechanisms of astrocytes in SCI, and to develop intervention strategies targeting their regulatory mechanisms in order to improve the therapeutic efficacy of SCI. The discovery of changes in astrocyte transcriptome dynamics has improved researchers' understanding of spinal cord injury lesion progression and provided new insights into the treatment of spinal cord injury at different time points. To date, all of these findings need to be validated by more basic research and sufficient clinical trials. In the future, single-cell sequencing technology, through interdisciplinary collaboration with bioinformatics, computer science, tissue engineering, and clinical medicine, is expected to open a new window for the treatment of spinal cord injury.
Spinal Cord Injuries/metabolism* ; Astrocytes/cytology* ; Single-Cell Analysis/methods* ; Humans ; Animals ; Transcriptome ; Nerve Regeneration

PURPOSE: To methodically assess the effectiveness of augmentative plating (AP) and exchange nailing (EN) in managing nonunion following intramedullary nailing for long bone fractures of the lower extremity. METHODS: PubMed, EMBASE, Web of Science, and the Cochrane Library were searched to gather clinical studies regarding the use of AP and EN techniques in the treatment of nonunion following intramedullary nailing of lower extremity long bones. The search was conducted up until May 2023. The original studies underwent an independent assessment of their quality, a process conducted utilizing the Newcastle-Ottawa scale. Data were retrieved from these studies, and meta-analysis was executed utilizing Review Manager 5.3. RESULTS: This meta-analysis included 8 studies involving 661 participants, with 305 in the AP group and 356 in the EN group. The results of the meta-analysis demonstrated that the AP group exhibited a higher rate of union (odds ratio: 8.61, 95% confidence intervals (CI): 4.12 - 17.99, p < 0.001), shorter union time (standardized mean difference (SMD): -1.08, 95% CI: -1.79 - -0.37, p = 0.003), reduced duration of the surgical procedure (SMD: -0.56, 95% CI: -0.93 - -0.19, p = 0.003), less bleeding (SMD: -1.5, 95% CI: -2.81 - -0.18, p = 0.03), and a lower incidence of complications (relative risk: -0.17, 95% CI: -0.27 - -0.06, p = 0.001). In the subgroup analysis, the time for union in the AP group in nonisthmal and isthmal nonunion of lower extremity long bones was shorter compared to the EN group (nonisthmal SMD: -1.94, 95% CI: -3.28 - -0.61, p < 0.001; isthmal SMD: -1.08, 95% CI: -1.64 - -0.52, p = 0.002). CONCLUSION In the treatment of nonunion in diaphyseal fractures of the long bones in the lower extremity, the AP approach is superior to EN, both intraoperatively (with reduced duration of the surgical procedure and diminished blood loss) and postoperatively (with an elevated union rate, shorter union time, and lower incidence of complications). Specifically, in the management of nonunion of lower extremity long bones with non-isthmal and isthmal intramedullary nails, AP demonstrated shorter union time in comparison to EN.
Humans ; Bone Nails/adverse effects* ; Bone Plates/adverse effects* ; Femoral Fractures/surgery* ; Fracture Fixation, Intramedullary/methods* ; Fractures, Ununited/surgery* ; Lower Extremity/injuries*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans ; Nasal Cavity/surgery* ; Nasal Surgical Procedures ; China ; Consensus ; Sinusitis/surgery* ; Dermal Fillers

OBJECTIVES: To investigate the molecular mechanism by which Lichong Xiaozheng Granules (LCXZ) sensitize ovarian cancer to cisplatin (DDP) treatment. METHODS: LC-MS analysis was used to identify the blood components of LCXZ after its administration in mice via gavage. In a BALB/c mouse model bearing subcutaneous ovarian cancer xenografts, the effects of daily gavage of distilled water (control group), intraperitoneal injection of DDP (5 mg/kg) once a week, or both DDP injection and daily LCXZK gavage (15 g/kg) on tumor growth were evaluated. Histopathological changes in the xenografts and kidneys were assessed with HE staining. RNA-seq was performed to identify the differentially expressed genes followed by KEGG pathway analysis. The changes in mitochondrial ultrastructure and expressions of mitochondrial apoptosis-related were examined with transmission electron microscopy and Western blotting. RESULTS: A total of 218 blood-borne components of LCXZ were detected by LC-MS. In the tumor-bearing mice, treatments with DDP and DDP combined with LCXZ redcued the tumor volume by 60.3% and 72.6% compared with that in the control group, respectively. Transcriptomic analysis revealed significantly upregulated ANT3 expression in both the two treatment groups. Molecular docking indicated that the main active components of LCXZ were capable of binding to adenine nucleotide translocator 3 (ANT3) with binding energies below -6 kcal/mol. Transmission electron microscopy showed obvious mitochondrial swelling and outer-membrane damage in the tumor cells in DDP-treated mice, and these changes were more pronounced in the combined treatment group. The expression levels of BAX, ANT3, cleaved caspase-3 and cleaved caspase-9 were increased, whereas BCL-2 expression was decreased significantly in the tumor cells in both the DDP and DDP+LCXZ groups. CONCLUSIONS LCXZ enhances the therapeutic efficacy of cisplatin against ovarian cancer xenografts in mice by promoting mitochondrial dysfunction and activating apoptotic signaling pathways via upregulating ANT3.
Animals ; Female ; Cisplatin/pharmacology* ; Ovarian Neoplasms/metabolism* ; Apoptosis/drug effects* ; Mitochondria/metabolism* ; Drugs, Chinese Herbal/pharmacology* ; Mice, Inbred BALB C ; Mice ; Rats ; Xenograft Model Antitumor Assays ; Humans ; Cell Line, Tumor ; Antineoplastic Agents/pharmacology*

Oligodendrocyte lineage cells, including oligodendrocyte precursor cells (OPCs) and oligodendrocytes (OLs), are essential in establishing and maintaining brain circuits. Autophagy is a conserved process that keeps the quality of organelles and proteostasis. The role of autophagy in oligodendrocyte lineage cells remains unclear. The present study shows that autophagy is required to maintain the number of OPCs/OLs and myelin integrity during brain aging. Inactivation of autophagy in oligodendrocyte lineage cells increases the number of OPCs/OLs in the developing brain while exaggerating the loss of OPCs/OLs with brain aging. Inactivation of autophagy in oligodendrocyte lineage cells impairs the turnover of myelin basic protein (MBP). It causes MBP to accumulate in the cytoplasm as multimeric aggregates and fails to be incorporated into integral myelin, which is associated with attenuated endocytic recycling. Inactivation of autophagy in oligodendrocyte lineage cells impairs myelin integrity and causes demyelination. Thus, this study shows autophagy is required to maintain myelin quality during aging by controlling the turnover of myelin components.
Animals ; Autophagy/physiology* ; Oligodendroglia/metabolism* ; Myelin Sheath/physiology* ; Aging/pathology* ; Myelin Basic Protein/metabolism* ; Cell Lineage/physiology* ; Mice ; Oligodendrocyte Precursor Cells ; Mice, Inbred C57BL ; Brain/cytology* ; Cells, Cultured ; Cell Count

OBJECTIVE: This study aimed to evaluate the association between susceptibility genes and non-alcoholic fatty liver disease (NAFLD) in children with obesity. METHODS: We conducted a two-step case-control study. Ninety-three participants were subjected to whole-exome sequencing (exploratory set). Differential genes identified in the small sample were validated in 1,022 participants using multiplex polymerase chain reaction and high-throughput sequencing (validation set). RESULTS: In the exploratory set, 14 genes from the NAFLD-associated pathways were identified. In the validation set, after adjusting for sex, age, and body mass index, ECI2 rs2326408 (dominant model: OR = 1.33, 95% CI: 1.02-1.72; additive model: OR = 1.22, 95% CI: 1.01-1.47), C6orf201 rs659305 (dominant model: OR = 1.30, 95% CI: 1.01-1.69; additive model: OR = 1.21, 95% CI: 1.00-1.45), CALML5 rs10904516 (pre-ad dominant model: OR = 1.36, 95% CI: 1.01-1.83; adjusted dominant model: OR = 1.40, 95% CI: 1.03-1.91; and pre-ad additive model: OR = 1.26, 95% CI: 1.04-1.66) polymorphisms were significantly associated with NAFLD in children with obesity ( P < 0.05). Interaction analysis revealed that the gene-gene interaction model of CALML5 rs10904516, COX11 rs17209882, and SCD5 rs3733228 was optional ( P < 0.05), demonstrating a negative interaction between the three genes. CONCLUSION In the Chinese population, the CALML5 rs10904516, C6orf201 rs659305, and ECI2 rs2326408 variants could be genetic markers for NAFLD susceptibility.
Humans ; Non-alcoholic Fatty Liver Disease/genetics* ; Child ; Male ; Female ; Genetic Predisposition to Disease ; Case-Control Studies ; Exome Sequencing ; Adolescent ; Polymorphism, Single Nucleotide ; Obesity/complications* ; Pediatric Obesity/complications* ; China