This article adopts Professor CHEN Chaozu′s " sanjiao composed by membrane-striae" theory as its foundation to explore the relationship between irritable bowel syndrome and functional/structural abnormalities of the membrane-striae. Sanjiao encompasses both the tangible membrane and the intangible striae. These striae permeate the entire body，and their pathological changes comprehensively reflect qi，body fluids，and fasciae. Based on the physiological function of the membrane-striae in regulating qi and fluids，the pathogenesis of irritable bowel syndrome is characterized by a disharmony of membrane-striae and an imbalance of the qi-fluid interactions. In the early stage，external pathogens，emotional factors，or dietary stimuli often cause membrane-striae constriction and disordered qi-fluid circulation. In the middle stage，stagnant fluids gradually transform into phlegm retention，leading to membrane-striae obstruction. In the late stage，deficiency of vital qi becomes predominant，manifesting as laxity of membrane-striae with impaired control or weakened conduction. The treatment of irritable bowel syndrome should adopt " unblocking" as the guiding principle. In the early stage，therapy should focus on eliminating pathogenic factors and soothing membrane-striae to promptly restore qi-fluid circulation，thereby attaining unblocking through spasm relief. In the middle stage，treatment should focus on resolving tangible obstructions in membrane-striae，achieving unblocking via dredging. In the late stage，the emphasis should shift to reinforcing healthy qi，particularly by strengthening spleen-kidney yang qi，and achieving unblocking through supplementation. Concurrently，throughout the entire treatment process，the regulation of mental state and easing of emotional tension should be integrated to alleviate patient′s anxiety，achieving the goal of holistic treatment of both body and mind.

Hepatic fibrosis is a pathological repair response of the liver to various chronic injuries, commonly seen in chronic liver diseases such as viral hepatitis, alcoholic liver disease, non-alcoholic fatty liver disease, etc. Hepatic fibrosis is a necessary stage for the development of chronic liver disease into cirrhosis or even hepatocellular carcinoma. Reversing or delaying the progression of hepatic fibrosis is crucial for the treatment of chronic liver disease, but there are currently no safe and effective therapeutic drugs in clinical practice. In recent years, research has found that many alkaloids in traditional Chinese medicine have anti-fibrotic activity, and their mechanisms involved multiple aspects such as cell autophagy, antioxidation, and anti-inflammation. The anti-fibrotic effects and mechanisms of alkaloids from traditional Chinese medicine were reviewed, which could provide reference for the application of alkaloids in the prevention and treatment of hepatic fibrosis.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objective: To explore the iodine nutrition status of children in Wuhan from 2019 to 2023, and to evaluate the effect of iodine deficiency disorders control in focus groups in Wuhan, so as to provide a basis for consolidating elimination of iodine deficiency disorders. Methods: A total of 13 000 non boarding primary school students aged 8-10 were selected from 13 districts of Wuhan by stratified random sampling method.Household salt samples were collected to measure salt iodine content, random urine samples were analyzed for urinary iodine concentration. And B ultrasound was used to measure thyroid volume in students. The median of salt iodine, coverage rate of iodized salt, consumption rate of qualified iodized salt, median of urinary iodine, and the goiter rate were calculated. And Mann-Whitney U- test, Kruskal-Wallis H- test and Chi-square test were applied to compare between groups. Chi-square trend test was used to analyze the changing trends of coverage rate of iodized salt, consumption rate of qualified iodized salt and goiter rate among children in Wuhan. Results: The median of iodine content of children s household salt was 23.8 (21.7, 26.1) mg/kg, and the coverage rate of iodized salt was 98.7%, and the consumption rate of qualified iodized salt was 94.5 %. The consumption rates of qualified iodized salt showed an overall upward trend from 2019 to 2023 ( χ 2 trend =5.57， P <0.05). The median of urinary iodine of children was 220.1 (136.7, 326.0) μg/L,and boys had higher median of urinary iodine than girls [228.3(143.2, 336.0),210.2(129.1, 315.7) μg/L] ( Z =6.60, P <0.01). The median of urinary iodine of children in suburbs was higher than those in urban areas [236.3 (150.7, 342.2) , 207.1 (124.5, 309.8) μg/L]( Z =11.00, P <0.01). A total of 4 600 children were examined for thyroid volume, and the range of goiter rates were 1.1% to 3.4%, with an average goiter rate of 2.5%, which showed an overall downward trend from 2019 to 2023 ( χ 2 trend =5.11, P <0.05). Conclusions The iodine nutrition is sufficient and iodine nutrition status is good among children in Wuhan. It should continue to carry out monitoring and evaluation of children s iodine nutrition, guide the public to supplement iodine scientifically,so as to maintain the appropriate level of iodine for children.

BACKGROUND: Generalized pustular psoriasis (GPP), a rare and recurrent autoinflammatory disease, imposes a substantial burden on patients and society. Awareness of GPP in China remains limited. METHODS: This cross-sectional survey, conducted between September 2021 and May 2023 across 14 hospitals in China, included GPP patients of all ages and disease phases. Data collected encompassed demographics, clinical characteristics, economic impact, disease severity, quality of life, and treatment-related complications. Risk factors for GPP recurrence were analyzed. RESULTS: Among 127 patients (female/male ratio = 1.35:1), the mean age of disease onset was 25 years (1st quartile [Q1]-3rd quartile [Q3]: 11-44 years); 29.2% had experienced GPP for more than 10 years. Recurrence occurred in 75.6% of patients, and nearly half reported no identifiable triggers. Younger age at disease onset ( P  = 0.021) and transitioning to plaque psoriasis ( P  = 0.022) were associated with higher recurrence rates. The median diagnostic delay was 8 months (Q1-Q3: 2-41 months), and 32.3% of patients reported misdiagnoses. Comorbidities were present in 53.5% of patients, whereas 51.1% experienced systemic complications during treatment. Depression and anxiety affected 84.5% and 95.6% of patients, respectively. During GPP flares, the median Dermatology Life Quality Index score was 19.0 (Q1-Q3: 13.0-23.5). This score showed significant differences between patients with and without systemic symptoms; it demonstrated correlations with both depression and anxiety scores. Treatment costs caused financial hardship in 55.9% of patients, underscoring the burden associated with GPP. CONCLUSIONS The substantial disease and economic burdens among Chinese GPP patients warrant increased attention. Patients with early onset disease and those transitioning to plaque psoriasis require targeted interventions to mitigate the high recurrence risk.
Humans ; Male ; Female ; Psoriasis/pathology* ; Adult ; Cross-Sectional Studies ; Adolescent ; Child ; Young Adult ; Quality of Life ; Middle Aged ; China/epidemiology* ; Recurrence ; Risk Factors ; Surveys and Questionnaires ; East Asian People

BACKGROUND: This study aimed to investigate programmed death-ligand 1 tumor proportion score in predicting the safety and efficacy of PD-1/PD-L1 antibody-based therapy in treating patients with advanced non-small cell lung cancer (NSCLC) in a real-world setting. METHODS: This retrospective, multicenter, observational study enrolled adult patients who received PD-1/PD-L1 antibody-based therapy in China and met the following criteria: (1) had pathologically confirmed, unresectable stage III-IV NSCLC; (2) had a baseline PD-L1 tumor proportion score (TPS); and (3) had confirmed efficacy evaluation results after PD-1/PD-L1 treatment. Logistic regression, Kaplan-Meier analysis, and Cox regression were used to assess the progression-free survival (PFS), overall survival (OS), and immune-related adverse events (irAEs) as appropriate. RESULTS: A total of 409 patients, 65.0% ( n = 266) with a positive PD-L1 TPS (≥1%) and 32.8% ( n = 134) with PD-L1 TPS ≥50%, were included in this study. Cox regression confirmed that patients with a PD-L1 TPS ≥1% had significantly improved PFS (hazard ratio [HR] 0.747, 95% confidence interval [CI] 0.573-0.975, P = 0.032). A total of 160 (39.1%) patients experienced 206 irAEs, and 27 (6.6%) patients experienced 31 grade 3-5 irAEs. The organs most frequently associated with irAEs were the skin (52/409, 12.7%), thyroid (40/409, 9.8%), and lung (34/409, 8.3%). Multivariate logistic regression revealed that a PD-L1 TPS ≥1% (odds ratio [OR] 1.713, 95% CI 1.054-2.784, P = 0.030) was an independent risk factor for irAEs. Other risk factors for irAEs included pretreatment absolute lymphocyte count >2.5 × 10 9 /L (OR 3.772, 95% CI 1.377-10.329, P = 0.010) and pretreatment absolute eosinophil count >0.2 × 10 9 /L (OR 2.006, 95% CI 1.219-3.302, P = 0.006). Moreover, patients who developed irAEs demonstrated improved PFS (13.7 months vs. 8.4 months, P <0.001) and OS (28.0 months vs. 18.0 months, P = 0.007) compared with patients without irAEs. CONCLUSIONS A positive PD-L1 TPS (≥1%) was associated with improved PFS and an increased risk of irAEs in a real-world setting. The onset of irAEs was associated with improved PFS and OS in patients with advanced NSCLC receiving PD-1/PD-L1-based therapy.
Humans ; Carcinoma, Non-Small-Cell Lung/metabolism* ; Male ; Female ; Retrospective Studies ; Middle Aged ; Lung Neoplasms/metabolism* ; Aged ; B7-H1 Antigen/metabolism* ; Programmed Cell Death 1 Receptor/metabolism* ; Adult ; Aged, 80 and over ; Immune Checkpoint Inhibitors/therapeutic use*

This study systematically reviewed the randomized controlled trial(RCT) of traditional Chinese medicine(TCM) treatment of post-stroke depression(PSD) and analyzed the clinical study characteristics and outcome indicators, aiming to optimize the design and establish the core outcome set in the future clinical trials of the TCM treatment of PSD. PubMed, Web of Science, Cochrane Library, EMbase, CNKI, VIP, Wanfang, and SinoMed were searched for the relevant RCT published in recent 3 years. The basic characteristics, intervention measures, and outcome indicators of the included RCT were extracted, and the descriptive analysis was carried out. A total of 76 RCTs were eventually included, with the sample size concentrated in 80-100 cases. The most frequent TCM syndromes were liver depression and Qi stagnation(15 times, 31.91%) and phlegm combined with stasis(5 times, 10.63%). The frequency of intervention methods followed a descending trend of TCM decoction(35 times, 46.05%) and TCM decoction + acupuncture(4 times, 5.26%), Chinese patent medicine(3 times, 3.94%), and the intervention mainly lasted for 1 to 3 months(43 times, 60.56%). The adverse reactions of patients were mainly digestive system reaction(150 patients, 39.37%) and nervous system reaction(112 patients, 29.39%). Most of the included studies had unclear risk of bias, involving 84 outcome indicators, which belonged to 8 indicator domains. The RCTs of TCM treatment of PSD showed a variety of problems, such as non-standard TCM syndrome differentiation, inconsistent names of TCM syndrome scores and measurement tools, low quality, unclear risk of bias, neglect of endpoint indicators, unreasonable selection of substitute indicators, lack of differentiation between primary and secondary outcome indicators, non-standard reporting of safety indicators, insufficient attention to economic indicators, and lack of long-term prognosis evaluation. It is suggested that the future research should improve the quality of methodology and build a standardized core outcome set to promote the development of high-quality clinical research in this field.
Humans ; Randomized Controlled Trials as Topic ; Drugs, Chinese Herbal/administration & dosage* ; Stroke/psychology* ; Depression/etiology* ; Treatment Outcome ; Medicine, Chinese Traditional