Objective: To explore the nonlinear dynamic effects of social capital, adverse childhood experiences (ACEs) and depressive symptoms on suicidal behavior among vocational high school students, so as to provide theoretical basis and practical references for formulating suicide prevention strategies. Methods: A convenience sampling method was employed to include 668 students from a vocational high school from Wuhan in March 2023. Social capital was used as the asymmetry variable, while ACEs and depressive symptoms were used as bifurcation variables, a cusp catastrophe model was constructed to analyze the nonlinear changes in suicidal behavior among vocational high school students, and its fit was compared with linear and Logistic regression models. Results: Among students in the health vocational high school in Wuhan, only suicidal ideation accounted for 8.5%, only suicide attempt for 18.6%, neither accounted for 31.9%, and both for 41.0%. Gender, left behind experience, family economic status, parental parenting styles, depressive symptoms, social capital, and ACEs were all related factors influencing suicidal behavior among vocational high school students ( χ 2/H=19.03, 13.33, 21.11, 46.70, 144.38, 24.61, 118.77, all P <0.05). Violin plots showed a bimodal distribution of suicidal behavior, indicating nonlinear variation characteristics. The cusp catastrophe model results showed that social capital was negatively correlated with suicidal behavior, but the relationship was bifurcated by ACEs ( α social capital = -0.006 , β ACEs =0.075) and depressive symptoms ( α social capital =-0.013, β depressive =0.028) (all P <0.05). When both ACEs and depressive symptoms coexisted, the impact of ACEs was stronger ( β ACEs =0.077, β depressive =0.014) (both P <0.05). The cusp catastrophe model fitted ( R 2=0.886, 0.881, 0.882) better than the linear ( R 2=0.258, 0.219, 0.258) and Logistic regression models ( R 2= 0.242, 0.211 , 0.176). Gender stratified analysis results showed that bifurcation effect of ACEs was stronger in males than in females( β boys =0.224, β girls =0.086); in females, both ACEs and depressive symptoms had a bifurcation effect, with the former showing a stronger effect ( β ACEs =0.062, β depressive =0.015) (all P <0.05). Conclusions Suicidal behavior among vocational high school students exhibits nonlinear characteristics. Improving social capital to reducing ACEs and depressive symptoms may contribute to decreasing adolescent suicidal behaviors.

Objective To gain insights into the biological characteristics of different populations of Culex tritaeniorhynchus within and around the Yellow Sea wetland from the perspective of the occurrence of resistance, we investigated the levels of resistance to deltamethrin and kdr gene mutation in the wetland and its peripheral areas. Methods Specimens were collected from Cx. tritaeniorhynchus populations at two monitoring sites in the Rare Bird National Nature Reserve and Tiaozi Ni Wetland Scenic Area, and also from two populations in Yancheng City and the Liuhe District of Nanjing, and the resistance of these mosquitoes to deltamethrin was determined using the CDC biotest bottle method. For each concentration of deltamethrin assessed, a random subset of exposed specimens was selected for amplification of the kdr gene fragment, followed by Sanger sequencing to identify and analyze resistance-associated mutations. Results The LC50 levels of deltamethrin among mosquitoes from the four populations in Luhe, Yancheng, the Rare Bird National Nature Reserve and the Tiaozi Ni Wetland Scenic Area were 2.048 5, 7.798 2, 3.473 3, and 17.695 5 mg/mL, respectively, with corresponding concentrations of deltamethrin ranging from 0.005 to 5.000,0.050 to 50.000,0.050 to 25.000 and 0.050 to 50.000 mg/mL, respectively. Furthermore, the ranges of the KT50 values were 11.76-107.43, 67.05-216.30,29.77-107.43 and 28.40-329.51 min; the 1-h knockdown rates were 34.58%-99.15%, 9.52%-43.80%, 55.09%-73.01%, and 10.09%-68.07%; and the 24-h mortality rates were 12.15%-67.52%,9.52%-79.56%,13.17%-82.21%, and 11.01%-78.99%, respectively. With respect to kdr gene mutation, we assayed a total of 63,70,59, and 57 mosquitoes for the four populations, for which we detected L1014F mutation frequencies of 14.29%, 35.00%, 20.34%, and 31.58%, respectively, with a majority of these mutations being heterozygous for resistance. In addition, five adult mosquitoes were identified has having synonymous mutations at site 1011[i. e. , AAT(asparagine)mutation to AAC(asparagine)]. Conclusions Our findings revealed the clear resistance of Cx. tritaeniorhynchus to deltamethrin in the Yancheng region of the Yellow Sea wetland, and the resistance phenotype and kdr frequency of Cx. tritaeniorhynchus in the wetland environment were comparable to those of Cx. tritaeniorhynchus in the wetland environment, thereby indicating that the resistance of different populations of Cx. tritaeniorhynchus was homogeneous under the pressure of different insecticide selection within and around the wetland. However, the underlying mechanisms need to be further studied.

Objective: To explore the application method and clinical efficacy of endoscopic and computerized navigation technology in maxillofacial foreign body removal surgery, and to provide a reference for the clinical application of this technology. Methods: This study, which was approved by the Medical Ethics Committee of the hospital, retrospectively analyzed the data of five patients with maxillofacial foreign bodies who were admitted to Sun Yat-sen Memorial Hospital, Sun Yat-sen University from January 2018 to December 2024. All patients underwent preoperative CT scanning. Intraoperatively, endoscopic and computer navigation techniques were used in combination or separately according to the location, size, and adjacency of the foreign body to important neurovascular vessels. The foreign body was precisely localized by endoscopic magnification and direct visualization, and the optimal surgical path was designed and verified under the real-time guidance of computerized navigation to accurately remove the foreign body. The type of foreign body, location, length and diameter, duration of surgery, length of incision, success rate of foreign body removal, postoperative complications, and follow-up were recorded and analyzed. Results: The foreign body was successfully removed in all five patients with a success rate of 100%. The intraoperative computerized navigation system was accurate in positioning, and the alignment stability was not significantly affected by mandibular movement; the endoscope provided good illumination and exposure of the operative field. All surgical incisions were small, and no serious complications, such as foreign body residue, important neurovascular injury, or infection, occurred after surgery. One month after the operation, the patients were followed up and recovered well. Conclusion The combination of endoscopy and computer navigation or separately assisted technology can provide a clear field and real-time positioning for maxillofacial foreign body removal, effectively avoiding important anatomical structures, thus realizing safe and complete foreign body removal with minimized trauma. This assistive technology significantly improves the accuracy and safety of the operation and has clinical promotion value.

ObjectiveThis study employs a special conformational engineering (CE) technology to construct an α-chymotrypsin-like active center, which includes a catalytic triad, an oxyanion hole, and a substrate-binding site, on silver nanoparticles (AgNPs), thereby creating an AgNP-based artificial hydrolase with high catalytic activity. This study provides a new approach for the design of highly efficient artificial enzymes and enzyme-mimicking. MethodsAgNPs were chosen as the scaffold to build the an α-chymotrypsin-like active center. A special CE procedure enables the designed peptide, Triad5, to adopt an α‑helical conformation on AgNPs, with the key catalytic residues located on one side of the α-helix forming a catalytic active center with a catalytic triad, an oxyanion hole, and a substrate-binding site. The CE procedure consists of three steps, including conformation induction via trifluoroethanol (TFE), conformation stabilization on AgNPs via Ag-S bonds, and TFE removal via lyophilization. Circular dichroism (CD) spectra were used to confirm the formation and stabilization of the α-helix conformation. Mutations of the key residues combined with stopped-flow kinetic experiments were used to demonstrate the indispensability of each key residue and the synergistic effects among the catalytic triad, the oxyanion hole, and the substrate-binding site. ResultsCD spectra show that the designed Triad5 alone is in random coil conformation; when conjugated on AgNPs, Triad5 still remains largely unstructured; but after the CE treatment, Triad5 adopts a typical α-helical conformation on AgNPs as designed, thus produces an AgNP-based artificial hydrolase, Silverzyme. Silverzyme exhibits extremely high hydrolytic activity towards p-nitrophenyl acetate (p-NPA), with an extremely high catalytic turnover number per active site of 3.5 s^-1, which is even higher than that of α-chymotrypsin. As a comparison, the AgNP-Triad5 conjugate without CE treatment shows much lower catalytic activity than Silverzyme, highlighting the important role of the right conformation of the active center for the catalytic activity and the power of the CE treatment. When the key residues of the catalytic triad of Silverzyme were mutated to alanine, the overall catalytic efficiency of this mutant dropped by about 2 orders of magnitude, unambiguously demonstrating the key role of the designed catalytic triad. Similarly, when the residues for the oxyanion hole were deleted, the mutant with the intact catalytic triad also showed significantly decreased catalytic activity, highlighting the indispensable role of the oxyanion hole for the catalytic activity. Unexpectedly, when both the catalytic triad and the oxyanion hole were kept intact, a slight change of the binding site also resulted in significantly decreased catalytic activity, indicating that the designed binding site is at the right position to align the substrate in the right orientation in the active center for catalytic hydrolysis. These results confirm the synergy among the catalytic triad, the oxyanion hole, and the substrate-binding site, indicating successful mimicking of the active center of α-chymotrypsin. Moreover, Silverzyme shows better thermal stability than α-chymotrypsin, and can even hydrolyze the tough non-activated ester diethyl phthalate, a priority pollutant by the United States Environmental Protection Agency (USEPA). ConclusionThis study successfully mimicked the complex catalytic active center of α-chymotrypsin using a conformational engineering strategy, and produced a highly active artificial hydrolase with a well-defined structure and catalytic mechanism. The findings highlight the significant potential of conformational engineering.

Objective: To investigate the incidence and influencing factors of new onset suicidal behaviors among junior and senior high school students, so as to provide evidence for early warning and intervention. Methods: Using a cluster sampling method, baseline data were collected from September to November 2023 among 2 379 adolescents selected from 2 junior high schools, 2 general senior high schools and 2 vocational senior high schools in Wuhan, Hubei Province, with follow up carried out from September to November 2024. Data were collected using the School Adaptation Scale, the Essential Resilience Scale, the Personal Social Support Scale, the Adverse Childhood Experiences Questionnaire, the Adolescent Life Events Scale, the Pittsburgh Sleep Quality Index, the Center for Epidemiologic Studies Depression Scale, and the Columbia-Suicide Severity Rating Scale. Multivariate Logistic regression analysis was used to identify factors influencing new onset suicidal behavior among junior and senior high school students. Results: Among junior and senior high school students without suicide risk at baseline, 53.55% remained stable risk free during follow up, while 13.28% developed new suicidal behavior during follow up, of which suicidal ideation, suicide plan and suicide attempts accounted for 11.69%, 8.83% and 6.52%, respectively. Multivariate Logistic regression revealed that increased depressive symptoms at follow up elevated the risk of overall new onset suicidal behaviors ( OR =4.14), ideation ( OR = 4.59), plans ( OR =4.24), and attempts ( OR =4.09); poor sleep quality also increased the risk of overall new onset suicidal behaviors ( OR =2.23), plans ( OR =2.03), and attempts ( OR =2.65) (all P <0.05). Non boarding junior and senior high school students had lower risks of overall new onset suicidal behaviors and ideation ( OR=0.70 and 0.49, respectively); secondary school students with academic performance ranking in the top 20%-30% of their class had a lower risk of new onset ideation ( OR =0.27); and those whose place of origin was outside the city had a lower risk of new onset plans ( OR =0.49) (all P <0.05). Conclusions New onset suicidal behaviors among junior and senior high school students exhibit dynamic and stage specific differences. Depressive symptoms serve as a common core risk factor across all stages, whereas sleep quality, academic performance, boarding status, and place of origin exert differential influences at distinct stages.

Purpose: To investigate the therapeutic potential of eliminating insulin-like growth factor-binding protein 5 (IGFBP5) expression in improving erectile function in mice with cavernous nerve injury (CNI)-induced erectile dysfunction (ED). Materials and Methods: Eight-week-old male C57BL/6 mice were divided into four groups: a sham-operated group and three CNI-induced ED groups. The CNI-induced ED groups were treated with intracavernous injections 3 days before the CNI procedure.These injections included phosphate-buffered saline, scrambled control short hairpin RNA (shRNA), or shRNA targeting mouse IGFBP5 lentiviral particles. One week after CNI, erectile function was evaluated and the penile tissue was then harvested for histological examination and western blot analysis. Additionally, the major pelvic ganglia (MPG) and dorsal root ganglia (DRG) were cultured for ex vivo neurite outgrowth assays. Results: Following CNI, IGFBP5 expression in the cavernous tissues significantly increased, reaching its peak at day 7. First, ablation of IGFBP5 expression promotes neurite sprouting in MPG and DRG when exposed to lipopolysaccharide. Second, ablating IGFBP5 expression in CNI-induced ED mice improved erectile function, likely owing to increased neurovascular contents, including endothelial cells, pericytes, and neuronal processes. Third, ablating IGFBP5 expression in CNI-induced ED mice promoted neurovascular regeneration by increasing cell proliferation, reducing apoptosis, and decreasing Reactive oxygen species production. Finally, western blot analysis demonstrated that IGFBP5 ablation attenuated the JNK/c-Jun signaling pathway, activated the PI3K/AKT signaling pathway, and increased vascular endothelial growth factor and neurotrophic factor expression. Conclusions Ablating IGFBP5 expression enhanced neurovascular regeneration and ultimately improved erectile function in CNI-induced ED mice.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objective: To explore the association between the Internet usage characteristics and suicidal ideation among vocational high school students, so as to provide a theoretical basis for precise intervention of suicide among vocational high school students. Methods: A total of 1 781 students were recruited from three vocational high schools in Wuhan and Xianning in March 2023 by using the cluster random sampling method. The Columbia-Suicide Severity Rating Scale and Revised Chen Internet Addiction Scale were used to measure suicidal ideation and Internet addiction, respectively. LASSO regression model was used to select influential factors related to suicidal ideation, and the gradient boosting decision tree algorithm XGBoost was used to develop prediction models and evaluate predictive performance. By calculating the SHAP values, the contribution of each influential factor was quantified. Results: The prevalence of suicidal ideation among vocational high school students was 42.22% and prevalence of Internet addiction was 26.39%. LASSO regression results indicated that age, gender, experience of being left behind, parental relationship, holding a class cadre position, using the Internet for learning, Internet use during dawn, morning and late night, Internet addiction, and depressive symptoms were all the influential factors of suicidal ideation among vocational high school students ( β= -0.05 , 0.29, 0.09, 0.27, 0.10, -0.01, 0.09, 0.05, 0.24, 0.28, 0.78, all P <0.05). The AUC of the prediction model was 0.75. The results based on SHAP values indicated that all influential factors identified through multivariate analysis contributed positively to the model predictions ( SHAP >0). Among these, depressive symptoms and parental relationship had the greatest impact on suicidal ideation ( SHAP =0.77, 0.26), and the joint effect of features with higher contribution could improve the prediction probability. Conclusions Depressive symptoms, parental relationships, Internet addiction, and time of Internet use are most important risk factors of suicidal behaviors for vocational high school students. Thus, effective interventions should be conducted to reduce their suicidal ideation.

BACKGROUND: Generalized pustular psoriasis (GPP), a rare and recurrent autoinflammatory disease, imposes a substantial burden on patients and society. Awareness of GPP in China remains limited. METHODS: This cross-sectional survey, conducted between September 2021 and May 2023 across 14 hospitals in China, included GPP patients of all ages and disease phases. Data collected encompassed demographics, clinical characteristics, economic impact, disease severity, quality of life, and treatment-related complications. Risk factors for GPP recurrence were analyzed. RESULTS: Among 127 patients (female/male ratio = 1.35:1), the mean age of disease onset was 25 years (1st quartile [Q1]-3rd quartile [Q3]: 11-44 years); 29.2% had experienced GPP for more than 10 years. Recurrence occurred in 75.6% of patients, and nearly half reported no identifiable triggers. Younger age at disease onset ( P  = 0.021) and transitioning to plaque psoriasis ( P  = 0.022) were associated with higher recurrence rates. The median diagnostic delay was 8 months (Q1-Q3: 2-41 months), and 32.3% of patients reported misdiagnoses. Comorbidities were present in 53.5% of patients, whereas 51.1% experienced systemic complications during treatment. Depression and anxiety affected 84.5% and 95.6% of patients, respectively. During GPP flares, the median Dermatology Life Quality Index score was 19.0 (Q1-Q3: 13.0-23.5). This score showed significant differences between patients with and without systemic symptoms; it demonstrated correlations with both depression and anxiety scores. Treatment costs caused financial hardship in 55.9% of patients, underscoring the burden associated with GPP. CONCLUSIONS The substantial disease and economic burdens among Chinese GPP patients warrant increased attention. Patients with early onset disease and those transitioning to plaque psoriasis require targeted interventions to mitigate the high recurrence risk.
Humans ; Male ; Female ; Psoriasis/pathology* ; Adult ; Cross-Sectional Studies ; Adolescent ; Child ; Young Adult ; Quality of Life ; Middle Aged ; China/epidemiology* ; Recurrence ; Risk Factors ; Surveys and Questionnaires ; East Asian People