OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

BACKGROUND: Based on the China-VHD database, this study sought to develop and validate a Valvular Heart Disease- specific Age-adjusted Comorbidity Index (VHD-ACI) for predicting mortality risk in patients with VHD. METHODS & RESULTS: The China-VHD study was a nationwide, multi-centre multi-centre cohort study enrolling 13,917 patients with moderate or severe VHD across 46 medical centres in China between April-June 2018. After excluding cases with missing key variables, 11,459 patients were retained for final analysis. The primary endpoint was 2-year all-cause mortality, with 941 deaths (10.0%) observed during follow-up. The VHD-ACI was derived after identifying 13 independent mortality predictors: cardiomyopathy, myocardial infarction, chronic obstructive pulmonary disease, pulmonary artery hypertension, low body weight, anaemia, hypoalbuminaemia, renal insufficiency, moderate/severe hepatic dysfunction, heart failure, cancer, NYHA functional class and age. The index exhibited good discrimination (AUC, 0.79) and calibration (Brier score, 0.062) in the total cohort, outperforming both EuroSCORE II and ACCI (P < 0.001 for comparison). Internal validation through 100 bootstrap iterations yielded a C statistic of 0.694 (95% CI: 0.665-0.723) for 2-year mortality prediction. VHD-ACI scores, as a continuous variable (VHD-ACI score: adjusted HR (95% CI): 1.263 (1.245-1.282), P < 0.001) or categorized using thresholds determined by the Yoden index (VHD-ACI ≥ 9 vs. < 9, adjusted HR (95% CI): 6.216 (5.378-7.184), P < 0.001), were independently associated with mortality. The prognostic performance remained consistent across all VHD subtypes (aortic stenosis, aortic regurgitation, mitral stenosis, mitral regurgitation, tricuspid valve disease, mixed aortic/mitral valve disease and multiple VHD), and clinical subgroups stratified by therapeutic strategy, LVEF status (preserved vs. reduced), disease severity and etiology. CONCLUSION The VHD-ACI is a simple 13-comorbidity algorithm for the prediction of mortality in VHD patients and providing a simple and rapid tool for risk stratification.

This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans ; Nasal Cavity/surgery* ; Nasal Surgical Procedures ; China ; Consensus ; Sinusitis/surgery* ; Dermal Fillers

In recent decades, the prevalence of hyperuricemia and gout has increased dramatically due to lifestyle changes. The drugs currently recommended for hyperuricemia are associated with adverse reactions that limit their clinical use. In this study, we report that berberine (BBR) is an effective drug candidate for the treatment of hyperuricemia, with its mechanism potentially involving the modulation of gut microbiota and its metabolite, succinic acid. BBR has demonstrated good therapeutic effects in both acute and chronic animal models of hyperuricemia. In a clinical trial, oral administration of BBR for 6 months reduced blood uric acid levels in 22 participants by modulating the gut microbiota, which led to an increase in the abundance of Bacteroides and a decrease in Clostridium sensu stricto_1. Furthermore, Bacteroides fragilis was transplanted into ICR mice, and the results showed that Bacteroides fragilis exerted a therapeutic effect on uric acid similar to that of BBR. Notably, succinic acid, a metabolite of Bacteroides, significantly reduced uric acid levels. Subsequent cell and animal experiments revealed that the intestinal metabolite, succinic acid, regulated the upstream uric acid synthesis pathway in the liver by inhibiting adenosine monophosphate deaminase 2 (AMPD2), an enzyme responsible for converting adenosine monophosphate (AMP) to inosine monophosphate (IMP). This inhibition resulted in a decrease in IMP levels and an increase in phosphate levels. The reduction in IMP led to a decreased downstream production of hypoxanthine, xanthine, and uric acid. BBR also demonstrated excellent renoprotective effects, improving nephropathy associated with hyperuricemia. In summary, BBR has the potential to be an effective treatment for hyperuricemia through the gut-liver axis.

Occupational noise-induced hearing loss (NIHL) is an irreversible sensorineural hearing loss that severely endangers workers’ health, making early screening crucial. This article reviewed the research progress on early screening methods for occupational NIHL, introduced the testing mechanisms of three core screening methods—tympanometry, otoacoustic emissions, and extended high-frequency audiometry —and summarized their clinical application advantages and limitations. It is proposed that multimodal combined detection (e.g., the combination of tympanometry, otoacoustic emissions, and extended high-frequency audiometry) can significantly improve the accuracy and comprehensiveness of early screening. Meanwhile, future studies with prospective cohort design are encouraged to verify the long-term monitoring value of each method and to strengthen the joint development of screening technologies with cutting-edge approaches such as machine learning, in order to further improve screening efficiency and provide stronger protection for workers’ hearing health.

Objective To investigate the mechanism and protective effect of Humanin(HN)on rotenone(Rot)-induced toxic damage for dopamine neurons.Methods The Rot-poisened PC12 cell model was constructed,and the control group,the Rot poisening group,the HN pretreated Rot poisening group,and the HN treatment group were set up.ELISA was used to detect the content of HN inside and outside of Rot-infected cells,CCK-8 assay was used to detect cell viability,and ATP detection kit was used to detect the intracellular ATP content.Dichloro-dihydro-fluorescein diacetate(DCFH-DA)assay was used to detect the level of reactive oxygen species(ROS)in cells.Western blotting was performed to detect the expression level of mitochondrial autophagy regulatory proteins Pink1,Parkin,p62,LC3,mitochondrial biogenesis regulatory protein PGC1α,division/fusion regulatory proteins OPA1,MFN2,DRP1,p-DRP1 and antioxidant stress regulatory proteins Keap1 and Nrf2.HBAD-mcherry-EGFP-LC3 adenovirus transfected cells was used to observed the number of autophagosomes and autophagolysosomes.Results The results showed that the intracellular concentration of HN in PC12 in the Rot poisening group was significantly higher than that in the control group(P＜0.05);Compared with the control group,the Rot poisening group had significantly decreased activity of PC12 cells,decreased ATP content and increased production of ROS.After the poisen of Rot in PC12 cells,the expression of Pink1 and p-Parkin,the ratio of LC3Ⅱ/LC3Ⅰ and the expression of p-DRP1 in mitochondrial fusion protein was increased,while the expression of p62,the expression of mitochondrial biogenesis protein PGC1 α,mitochondrial fusion proteins MFN2 and OPA1,and antioxidant stress proteins Keap1 and Nrf2 were decreased(all P＜0.05).The number of autophagosomes and autophagolysosomes in PC12 cells in the Rot poisening group was higher than that in the control group(P＜0.05),and HN pretreatment(20 μmol/L)could significantly improve the changes mentioned above caused by Rot poisening(P＜0.05).Conclusion HN ameliorates Rot-induced toxic damage for dopamine neurons by inhibiting mitophagy and mitochondrial division and promoting mitochondrial biogenesis and fusion,and anti-oxidative stress.

The National Medical Products Administration have become an official applicant of the Pharmaceutical Inspection Co-operation Scheme(PIC/S)in 2023,and the good manufacturing practice appendix and inspection memorandum are key documents of PIC/S.Based on the analysis of the history,framework and main contents of the appendix and inspection memorandum of PIC/S investigational medicinal products,this paper discusses the key contents of the appendix and inspection memorandum of PIC/S clinical trial drugs,and provides reference for the inspection work.

Objective To compare the efficacy and safety of different courses of caffeine citrate injection in the treatment of very low birth weight infants.Methods Very low birth weight infants were divided into long course group and routine course according to cohort method.2 groups of children were given intravenous infusion of caffeine citrate injection loading dose(20 mg·kg-1)within 3 days after birth,and the dose was maintained at 5 mg·kg-1 after 24 hours(qd).In the long course group,caffeine citrate injection was used to correct gestational age＞34 weeks,and in the routine course,caffeine citrate injection was used to correct gestational age 33-34 weeks.The use of caffeine citrate injection,clinical efficacy,neonatal behavioral neurological scale(NBNA)score and the occurrence of adverse drug reactions were compared between the two groups.Results 116 cases were included in this study,64 cases in the long course group and 52 cases in the routine course.After treatment,the total clinical effective rate of the long course group and the routine course was 92.19％and 94.23％,respectively,with no statistical significance(P＞0.05).The total duration of caffeine citrate injection were(60.53±8.92)and(48.17±5.24)days,respectively;the corrected gestational age at withdrawal were(36.02±1.56)and(33.18±1.27)weeks,respectively.The corrected gestational age were(34.31±0.48)and(32.06±0.51)weeks;the milk volume were(32.69±2.14)and(23.85±1.69)mL,respectively,with statistical significance(all P＜0.05).The starting age of caffeine citrate injection were(59.65±3.42)and(58.35±3.11)h in the long course group and the routine course,respectively,with no statistical significance(P＞0.05).Before treatment,the NBNA score of the long course and routine courses were 36.49±6.78 and 35.58±4.22,respectively;the NBNA score of long course and conventional course after treatment were 43.25±6.88 and 44.12±7.42,respectively.Compared with before treatment,NBNA score in both groups were higher after treatment,with statistical significance(all P＜0.05).There was no significant difference in NBNA score between the long course group and the routine course(P＞0.05).The incidence of bronchopulmonary dysplasia(84.38％vs 51.92％)and decreased hemoglobin concentration(17.75％vs 5.77％)in the long course group were significantly higher than those in the routine course(all P＜0.05).Conclusion Long-term use of caffeine citrate injection to correct gestational age＞34 weeks has no significant effect on clinical treatment,neurological function and intellectual development of very low birth weight infants.

Objective To explore the changes of plasma metabolites in Uygur and Kazak patients with type 2 diabetes mellitus(T2DM)and people with normal glucose tolerance(NGT),construct the profile of different metabolites and analyze different metabolic pathways.Methods Plasma samples of T2DM and NGT from Uygur and Kazak were collected for detection.Ultra-high performance liquid chromatography tandem quadrupole time-of-flight mass spectrometry was used for detection.MetaboAnalyst 5.0 was used to analyze the data,and the screening conditions were P＜0.05 and fold change(FC)＜0.90 or FC＞1.10.We used The Kyoto Encyclopedia of Genes and Genomes database to enrich and explore the metabolic pathways of different metabolites.Results Compared with the Uighur NGT group,there are 109 differential metabolites in the T2DM group,and 43 unique differential metabolites are mainly concentrated in five pathways,such as phenylalanine biosynthesis,tyrosine biosynthesis,and tryptophan metabolism.Compared with the NGT group,Kazak T2DM has 86 differential metabolites,and 28 unique differential metabolites are mainly enriched in the urea cycle,arginine,and proline metabolism(impact＞0.10,P＜0.05).Conclusion In this study,the plasma metabolic profile of T2DM patients was constructed,and the unique metabolites of T2DM in Uygur and Kazak were screened out,which provided potential biomarkers for early prevention of T2DM.

Ankylosing spondylitis (AS) combined with lower cervical fracture is often categorized into unstable fracture, with a high incidence of neurological injury and a high rate of disability and morbidity. As factors such as shoulder occlusion may affect the accuracy of X-ray imaging diagnosis, it is often easily misdiagnosed at the primary diagnosis. Non-operative treatment has complications such as bone nonunion and the possibility of secondary neurological damage, while the timing, access and choice of surgical treatment are still controversial. Currently, there are no clinical practice guidelines for the treatment of AS combined with lower cervical fracture with or without dislocation. To this end, the Spinal Trauma Group of Orthopedics Branch of Chinese Medical Doctor Association organized experts to formulate Clinical guidelines for the treatment of ankylosing spondylitis combined with lower cervical fracture in adults ( version 2024) in accordance with the principles of evidence-based medicine, scientificity and practicality, in which 11 recommendations were put forward in terms of the diagnosis, imaging evaluation, typing and treatment, etc, to provide guidance for the diagnosis and treatment of AS combined with lower cervical fracture.