OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

BACKGROUND: Based on the China-VHD database, this study sought to develop and validate a Valvular Heart Disease- specific Age-adjusted Comorbidity Index (VHD-ACI) for predicting mortality risk in patients with VHD. METHODS & RESULTS: The China-VHD study was a nationwide, multi-centre multi-centre cohort study enrolling 13,917 patients with moderate or severe VHD across 46 medical centres in China between April-June 2018. After excluding cases with missing key variables, 11,459 patients were retained for final analysis. The primary endpoint was 2-year all-cause mortality, with 941 deaths (10.0%) observed during follow-up. The VHD-ACI was derived after identifying 13 independent mortality predictors: cardiomyopathy, myocardial infarction, chronic obstructive pulmonary disease, pulmonary artery hypertension, low body weight, anaemia, hypoalbuminaemia, renal insufficiency, moderate/severe hepatic dysfunction, heart failure, cancer, NYHA functional class and age. The index exhibited good discrimination (AUC, 0.79) and calibration (Brier score, 0.062) in the total cohort, outperforming both EuroSCORE II and ACCI (P < 0.001 for comparison). Internal validation through 100 bootstrap iterations yielded a C statistic of 0.694 (95% CI: 0.665-0.723) for 2-year mortality prediction. VHD-ACI scores, as a continuous variable (VHD-ACI score: adjusted HR (95% CI): 1.263 (1.245-1.282), P < 0.001) or categorized using thresholds determined by the Yoden index (VHD-ACI ≥ 9 vs. < 9, adjusted HR (95% CI): 6.216 (5.378-7.184), P < 0.001), were independently associated with mortality. The prognostic performance remained consistent across all VHD subtypes (aortic stenosis, aortic regurgitation, mitral stenosis, mitral regurgitation, tricuspid valve disease, mixed aortic/mitral valve disease and multiple VHD), and clinical subgroups stratified by therapeutic strategy, LVEF status (preserved vs. reduced), disease severity and etiology. CONCLUSION The VHD-ACI is a simple 13-comorbidity algorithm for the prediction of mortality in VHD patients and providing a simple and rapid tool for risk stratification.

This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans ; Nasal Cavity/surgery* ; Nasal Surgical Procedures ; China ; Consensus ; Sinusitis/surgery* ; Dermal Fillers

In recent decades, the prevalence of hyperuricemia and gout has increased dramatically due to lifestyle changes. The drugs currently recommended for hyperuricemia are associated with adverse reactions that limit their clinical use. In this study, we report that berberine (BBR) is an effective drug candidate for the treatment of hyperuricemia, with its mechanism potentially involving the modulation of gut microbiota and its metabolite, succinic acid. BBR has demonstrated good therapeutic effects in both acute and chronic animal models of hyperuricemia. In a clinical trial, oral administration of BBR for 6 months reduced blood uric acid levels in 22 participants by modulating the gut microbiota, which led to an increase in the abundance of Bacteroides and a decrease in Clostridium sensu stricto_1. Furthermore, Bacteroides fragilis was transplanted into ICR mice, and the results showed that Bacteroides fragilis exerted a therapeutic effect on uric acid similar to that of BBR. Notably, succinic acid, a metabolite of Bacteroides, significantly reduced uric acid levels. Subsequent cell and animal experiments revealed that the intestinal metabolite, succinic acid, regulated the upstream uric acid synthesis pathway in the liver by inhibiting adenosine monophosphate deaminase 2 (AMPD2), an enzyme responsible for converting adenosine monophosphate (AMP) to inosine monophosphate (IMP). This inhibition resulted in a decrease in IMP levels and an increase in phosphate levels. The reduction in IMP led to a decreased downstream production of hypoxanthine, xanthine, and uric acid. BBR also demonstrated excellent renoprotective effects, improving nephropathy associated with hyperuricemia. In summary, BBR has the potential to be an effective treatment for hyperuricemia through the gut-liver axis.

Objective:To develop an artificial intelligence (AI)-based automatic scoring model for magnetic resonance imaging-detected extramural vascular invasion (AI-mrEMVI) and evaluate its performance and prognostic value in patients with rectal cancer.Methods:In this multicenter retrospective cohort study, a total of 2 501 rectal cancer patients from seven centers between November 2012 and December 2020 were included and divided into completely independent training ( n=1 830) and validation ( n=671) cohorts. A nnUNet-based AI-mrEMVI scoring model was constructed. Manual mrEMVI scores assigned by two radiologists served as the reference standard for accessing the accuracy of the AI-mrEMVI scoring. Kaplan-Meier survival analysis and Cox regression were used to evaluate the prognostic stratification ability of the AI-mrEMVI scores. The concordance index (C-index) was calculated to evaluate prognostic performance. Results:In the validation cohort, the manual mrEMVI scores were 0-2 in 425 patients (63.3%), 3 in 89 (13.4%), and 4 in 157 (23.4%). The AI-mrEMVI model identified 0-2 in 375 patients (55.9%), 3 in 95 (14.2%), and 4 in 201 (30.0%), with an overall accuracy of 81.1% (544/671, 95% CI 77.9%-84.0%). The 3-year disease-free survival (DFS) rates for patients with AI-mrEMVI scores of 0-2, 3, and 4 were 85.2%, 70.0%, and 58.2%, respectively, and the 5-year overall survival (OS) rates were 87.2%, 81.6%, and 62.6%, respectively (DFS: χ2=48.74, P<0.001; OS: χ2=30.04, P<0.001). Multivariable Cox regression showed that for DFS, AI-mrEMVI scores of 3 and 4 were associated with hazard ratios ( HR) of 1.75 (95% CI 1.11-2.77, P=0.016) and 2.65 (95% CI 1.86-3.78, P<0.001), respectively. For OS, an AI-mrEMVI score of 4 was associated with an HR of 2.56 (95% CI 1.62-4.03, P<0.001). The C-index values of the AI-mrEMVI scoring model for predicting DFS and OS were 0.647 (95% CI 0.608-0.686) and 0.650 (95% CI 0.598-0.702), respectively. Conclusion:The proposed AI-mrEMVI automatic scoring model demonstrated high diagnostic accuracy and performed favorably in predicting DFS and OS prognostic risk in patients with rectal cancer.

This report evaluates the preliminary outcomes of a "six-in-one" integrated cough and asthma center developed under a dual-contract physician model at the Changfeng Community Health Service Center in Putuo District, Shanghai. By combining the efforts of family doctors and medical specialists, the center integrated six core functions-clinical treatment, prevention, nursing, rehabilitation, pharmacy, and nutrition-into a seamless management system covering screening, diagnosis, therapy, and follow-up. Supported by specialist guidance and teaching clinics, the model significantly enhanced comprehensive respiratory disease management capabilities within the community setting. The initiative not only improved patient health outcomes but also strengthened multidisciplinary collaboration and resource efficiency, offering a replicable example for improving chronic disease management in primary care through integrated and coordinated service delivery.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Turning to critical illness is a common stage of various diseases and injuries before death. Patients usually have complex health conditions, while the treatment process involves a wide range of content, along with high requirements for doctor′s professionalism and multi-specialty teamwork, as well as a great demand for time-sensitive treatments. However, this is not matched with critical care professionals and the current state of medical care in China. Telemedicine, which shortens the distance of medical professionals and the gap of disease diagnosis and treatments in various regions through electronic information, can effectively solve the current problem. Therefore, there is an urgent need to develop a standardized, high-quality visualization telemedicine round system .Therefore, experts have been organized to search domestic and foreign literature on telemedicine round for critically ill patients and to form this consensus based on clinical experiences so as to further improve the level of critical care treatments in regions.

Objective:To investigate the follow-up colonoscopy of patients after colorectal adenoma (CRA) resection, so as to improve colonoscopy quality and reduce missed CRA diagnosis.Methods:A total of 189 patients after CRA resection who underwent follow-up colonoscopy from October 2020 to October 2021 were consecutively recruited. The effect of bowel preparation was evaluated by the Boston bowel preparation scale (BBPS). The location, the number, and gross morphology of adenomas during CRA resection and two colonoscopies during 1 year follow-up after the resection were recorded, and their correlation with major clinicopathologic features were analyzed, and the missed CRA in follow-up colonoscopy were also analyzed.Results:The BBPS scores of the right colon, transverse colon, left colon and total colon in 189 patients who underwent CRA resection were 1.93±0.42, 2.53±0.52, 2.77±0.45, and 7.22±1.03 points at the 1-year follow-up colonoscopy and 2.08±0.35, 2.70±0.46, 2.81±0.40, and 7.57±0.84 points at the time of CRA resection. Except for the left colon segment ( χ 2=0.98, P>0.05), the differences in other colon segments were significantly different ( P<0.05). At the time of CRA resection, 62, 66, 210 and 338 CRAs were detected in the right colon, transverse colon, left colon and total colon segments, respectively. At the 1-year follow-up colonoscopy, 21, 38, 49 and 108 CRAs were missed in the corresponding colon segments and total colon, respectively. CRA missed diagnosis was related to patient age (≥60 years accounting for 54.2%), gender (males accounting for 81.9%), adenoma location (predominantly in the left colon comprising 36.2%) and gross morphology (flat types representing 72.3%) ( P<0.05), but not related to being vegetarian, history of cholecystectomy or appendectomy, smoking or alcohol consumption, number of adenomas or pathological type ( P>0.05). Conclusion:The missed diagnosis of CRA in patients after CRA resection primarily involves the flat type adenomas, which is associated with the age, gender, adenoma location within the colon and the gross morphology.

Objective To design a VR-based air evacuation training system for simulating the on-board medical treatment process during air evacuation.Methods A VR-based air evacuation training system was developed which used 3D modeling technology to construct models of the medical aircraft cabin,medical devices and virtual characters to achieve scene interaction.The hardware part of the system included server computers,training terminal computers,VR equipment,3D fusion projection equipment,motion capture equipment,etc.The software of the system was developed using C++,UE4 Blueprint and C# programming languages,including two modules for medical treatment unit and medical treatment training process evaluation.The efficacy of the system was verified by the trials in air evacuation.Results The system developed successfully simulated the scenarios of tracheal tube dislodgement and increased intracranial pressure in the scenario model of open severe craniocerebral injury.The expert evaluation showed that the system gained advantages in training efficiency,low cost,safety,sense of immersion and recorded the operation data in real time to optimize the follow-up training.Conclusion The system developed delivers a virtual training environment with high-fidelity replication of real-mission conditions,enabling whole-course and immersive air evacuation drills.[Chinese Medical Equipment Journal,2025,46(3):15-20]