OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

BACKGROUND: Based on the China-VHD database, this study sought to develop and validate a Valvular Heart Disease- specific Age-adjusted Comorbidity Index (VHD-ACI) for predicting mortality risk in patients with VHD. METHODS & RESULTS: The China-VHD study was a nationwide, multi-centre multi-centre cohort study enrolling 13,917 patients with moderate or severe VHD across 46 medical centres in China between April-June 2018. After excluding cases with missing key variables, 11,459 patients were retained for final analysis. The primary endpoint was 2-year all-cause mortality, with 941 deaths (10.0%) observed during follow-up. The VHD-ACI was derived after identifying 13 independent mortality predictors: cardiomyopathy, myocardial infarction, chronic obstructive pulmonary disease, pulmonary artery hypertension, low body weight, anaemia, hypoalbuminaemia, renal insufficiency, moderate/severe hepatic dysfunction, heart failure, cancer, NYHA functional class and age. The index exhibited good discrimination (AUC, 0.79) and calibration (Brier score, 0.062) in the total cohort, outperforming both EuroSCORE II and ACCI (P < 0.001 for comparison). Internal validation through 100 bootstrap iterations yielded a C statistic of 0.694 (95% CI: 0.665-0.723) for 2-year mortality prediction. VHD-ACI scores, as a continuous variable (VHD-ACI score: adjusted HR (95% CI): 1.263 (1.245-1.282), P < 0.001) or categorized using thresholds determined by the Yoden index (VHD-ACI ≥ 9 vs. < 9, adjusted HR (95% CI): 6.216 (5.378-7.184), P < 0.001), were independently associated with mortality. The prognostic performance remained consistent across all VHD subtypes (aortic stenosis, aortic regurgitation, mitral stenosis, mitral regurgitation, tricuspid valve disease, mixed aortic/mitral valve disease and multiple VHD), and clinical subgroups stratified by therapeutic strategy, LVEF status (preserved vs. reduced), disease severity and etiology. CONCLUSION The VHD-ACI is a simple 13-comorbidity algorithm for the prediction of mortality in VHD patients and providing a simple and rapid tool for risk stratification.

This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans ; Nasal Cavity/surgery* ; Nasal Surgical Procedures ; China ; Consensus ; Sinusitis/surgery* ; Dermal Fillers

In recent decades, the prevalence of hyperuricemia and gout has increased dramatically due to lifestyle changes. The drugs currently recommended for hyperuricemia are associated with adverse reactions that limit their clinical use. In this study, we report that berberine (BBR) is an effective drug candidate for the treatment of hyperuricemia, with its mechanism potentially involving the modulation of gut microbiota and its metabolite, succinic acid. BBR has demonstrated good therapeutic effects in both acute and chronic animal models of hyperuricemia. In a clinical trial, oral administration of BBR for 6 months reduced blood uric acid levels in 22 participants by modulating the gut microbiota, which led to an increase in the abundance of Bacteroides and a decrease in Clostridium sensu stricto_1. Furthermore, Bacteroides fragilis was transplanted into ICR mice, and the results showed that Bacteroides fragilis exerted a therapeutic effect on uric acid similar to that of BBR. Notably, succinic acid, a metabolite of Bacteroides, significantly reduced uric acid levels. Subsequent cell and animal experiments revealed that the intestinal metabolite, succinic acid, regulated the upstream uric acid synthesis pathway in the liver by inhibiting adenosine monophosphate deaminase 2 (AMPD2), an enzyme responsible for converting adenosine monophosphate (AMP) to inosine monophosphate (IMP). This inhibition resulted in a decrease in IMP levels and an increase in phosphate levels. The reduction in IMP led to a decreased downstream production of hypoxanthine, xanthine, and uric acid. BBR also demonstrated excellent renoprotective effects, improving nephropathy associated with hyperuricemia. In summary, BBR has the potential to be an effective treatment for hyperuricemia through the gut-liver axis.

Occupational noise-induced hearing loss (NIHL) is an irreversible sensorineural hearing loss that severely endangers workers’ health, making early screening crucial. This article reviewed the research progress on early screening methods for occupational NIHL, introduced the testing mechanisms of three core screening methods—tympanometry, otoacoustic emissions, and extended high-frequency audiometry —and summarized their clinical application advantages and limitations. It is proposed that multimodal combined detection (e.g., the combination of tympanometry, otoacoustic emissions, and extended high-frequency audiometry) can significantly improve the accuracy and comprehensiveness of early screening. Meanwhile, future studies with prospective cohort design are encouraged to verify the long-term monitoring value of each method and to strengthen the joint development of screening technologies with cutting-edge approaches such as machine learning, in order to further improve screening efficiency and provide stronger protection for workers’ hearing health.

Objective To investigate the effect of varying blood pressure stratification on renal function in the diabetic population.Methods A prospective cohort study was conducted,enrolling 9 489 diabetic patients from a total of 101 510 Kailuan Group employees who underwent health examinations between July 2006 and October 2007.The follow-up period was(8.6±4.0)years.Participants were categorized into four groups based on their baseline blood pressure levels:normal blood pressure(systolic blood pressure<120 mmHg and diastolic blood pressure<80 mmHg),elevated blood pressure(systolic blood pressure 120-130 mmHg and diastolic blood pressure<80 mmHg),stage 1 hypertension(systolic blood pressure 130-140 mmHg and/or diastolic blood pressure 80-90 mmHg),and stage 2 hypertension(systolic blood pressure≥140 mmHg and/or diastolic blood pressure≥90 mmHg).The incidence density of chronic kidney disease(CKD)was compared among these groups.A multivariate Cox proportional hazards regression model was employed to assess the effects of different blood pressure levels on renal function in diabetic patients,with the stability of the results confirmed using a multivariate time-dependent Cox proportional hazards model.Sensitivity analysis was conducted after excluding cases of cardiovascular disease(CVD)during follow-up,and cases using antihypertensive and antidiabetic medications at baseline.Results(1)At baseline,stage 1 hypertension patients demonstrated statistically significant higher differences with age and body mass index(BMI)compared to normal blood pressure group(P<0.05).(2)By the end of the follow-up,2 294 cases of CKD were identified,including 1 117 cases of estimated glomerular filtration rate(eGFR)decline and 1 575 cases of urinary protein.The incidences density of CKD,eGFR decline and urinary protein for stage 1 hypertension group were 39.4,16.3 and 25.5 per thousand person-years,respectively,all of which were statistically significant different from normal blood pressure group(log-rank test,P<0.01).(3)Multivariate Cox regression analysis revealed that,compared to the normal blood pressure group,stage 1 hypertension was associated with a 29%increased risk of CKD(HR=1.29,95%CI 1.09-1.52)and a 40%increased risk of eGFR decline(HR=1.40,95%CI 1.08-1.80)in diabetic individuals.Conclusion Stage 1 hypertension significantly increases the risk of CKD and eGFR decline in diabetic individuals,with a particularly notable effect on the risk of eGFR decline.

Refractory prolactinoma is the most common pituitary neuroendocrine tumor.Dopamine receptor agonists(DA)are the primary choice for drug treatment.Most patients with prolactinomas respond well to DA.However,a minority of prolactinomas patients still show resistance to DA.Although drug-resistant and refractory prolactinomas are rare in clinical practice,their treatment is extremely challenging.Even a combination of drug therapy,multiple surgeries,and radiotherapy may not yield satisfactory outcomes.Therefore,standardizing the diagnosis and treatment process and pathway for refractory prolactionmas and exploring more effective multidisciplinary collaborative treatment strategies are urgent problems to be solved.In the clinical management of refractory prolactinomas,it is often necessary to consider the patient's condition comprehensively,replace other types of DA,or consider surgery,radiotherapy,and immunotherapy,which requires multidisciplinary diagnosis and treatment.This review synthesizes the latest literature at home and abroad to systematically discuss the latest advances in drug therapy,surgery,and radiotherapy treatments for refractory prolactionmas,aiming to provide new ideas for basic research,clinical diagnosis and treatment.

Objective To investigate disease characteristics and hospitalization costs of children with Mycoplasma Pneumoniae pneumonia(MPP)admitted to Shanghai municipal medical hospitals from 2019 to 2023.Methods Depending on the Shanghai Municipal Hospital Pediatric Alliance,we retrospectively investigated community acquired MPP pediatric patients hospitalized in 22 municipal hospitals with pediatric qualifications(including 4 children's hospitals)in Shanghai from Jan 2019 to Dec 2023.We collected the patients'diagnosis codes,gender,age,length of hospital stay,hospitalization costs,and whether they progressed to severe Mycoplasma pneumoniae pneumonia(SMPP).Results From 2019 to 2023,a total of 29 045 hospitalized children with MPP were treated,with 6 035 cases(20.8%)identified as SMPP in the 22 hospitals.Trend analysis revealed a rising trend with years in the proportion of SMPP patients(χ2trend=365.498,P<0.001).Among the 4 children's hospitals,there were 18 710 cases with MPP,including 4 078 cases(21.8%)of SMPP.The proportion of SMPP patients also showed an increasing trend with years(χ2trend=14.548,P<0.001),and the proportion in 2023(23.0%)was higher than that in previous years with statistical significance.There were statistical differences in the seasonal distribution of MPP cases between different years,with higher proportions in summer and autumn overall.The age distribution of hospitalized MPP children varied among different years,with school-age children accounting for the majority(56.8%)in 2023.There was no difference in the distribution of severe cases between different genders,but there were differences in the proportion of severe cases among different age groups in different years,with a gradual increase in severe cases among children aged 1 to 3 years(χ2trend=191.567,P<0.001).The average length of hospital stay for MPP during the epidemic was higher than that during non-epidemic periods,and there were statistically significant differences in the average length of hospital stay between different years(P<0.001).The individual hospitalization costs during the epidemic were higher than in other years,and there were statistically significant differences in individual hospitalization costs between different years(P<0.001).The total hospitalization costs were still higher in 2019 and 2023.The individual hospitalization costs for SMPP were higher than for non-SMPP cases.Conclusion MPP outbreaks occurred in Shanghai in 2019 and 2023,with the higher proportions in summer and autumn overall.Compared to previous years,the number of hospitalized MPP children in Shanghai was higher in 2023,with a higher proportion of SMPP cases,especially among children under 3 years old.The individual per capita hospitalization expenses for SMPP cases were higher than for non-SMPP cases.

Objective:To explore potential predictors of refractory Mycoplasma pneumoniae pneumonia (RMPP) in early stage. Methods:The prospective multicenter study was conducted in Zhejiang, China from May 1 st, 2019 to January 31 st, 2020. A total of 1 428 patients with fever >48 hours to <120 hours were studied. Their clinical data and oral pharyngeal swab samples were collected; Mycoplasma pneumoniae DNA in pharyngeal swab specimens was detected. Patients with positive Mycoplasma pneumoniae DNA results underwent a series of tests, including chest X-ray, complete blood count, C-reactive protein, lactate dehydrogenase (LDH), and procalcitonin. According to the occurrence of RMPP, the patients were divided into two groups, RMPP group and general Mycoplasma pneumoniae pneumonia (GMPP) group. Measurement data between the 2 groups were compared using Mann-Whitney U test. Logistic regression analyses were used to examine the associations between clinical data and RMPP. Receiver operating characteristic (ROC) curves were used to analyse the power of the markers for predicting RMPP. Results:A total of 1 428 patients finished the study, with 801 boys and 627 girls, aged 4.3 (2.7, 6.3) years. Mycoplasma pneumoniae DNA was positive in 534 cases (37.4%), of whom 446 cases (83.5%) were diagnosed with Mycoplasma pneumoniae pneumonia, including 251 boys and 195 girls, aged 5.2 (3.3, 6.9) years. Macrolides-resistant variation was positive in 410 cases (91.9%). Fifty-five cases were with RMPP, 391 cases with GMPP. The peak body temperature before the first visit and LDH levels in RMPP patients were higher than that in GMPP patients (39.6 (39.1, 40.0) vs. 39.2 (38.9, 39.7) ℃, 333 (279, 392) vs. 311 (259, 359) U/L, both P<0.05). Logistic regression showed the prediction probability π=exp (-29.7+0.667×Peak body temperature (℃)+0.004×LDH (U/L))/(1+exp (-29.7+0.667×Peak body temperature (℃)+0.004 × LDH (U/L))), the cut-off value to predict RMPP was 0.12, with a consensus of probability forecast of 0.89, sensitivity of 0.89, and specificity of 0.67; and the area under ROC curve was 0.682 (95% CI 0.593-0.771, P<0.01). Conclusion:In MPP patients with fever over 48 to <120 hours, a prediction probability π of RMPP can be calculated based on the peak body temperature and LDH level before the first visit, which can facilitate early identification of RMPP.

Objective To investigate the mechanism and protective effect of Humanin(HN)on rotenone(Rot)-induced toxic damage for dopamine neurons.Methods The Rot-poisened PC12 cell model was constructed,and the control group,the Rot poisening group,the HN pretreated Rot poisening group,and the HN treatment group were set up.ELISA was used to detect the content of HN inside and outside of Rot-infected cells,CCK-8 assay was used to detect cell viability,and ATP detection kit was used to detect the intracellular ATP content.Dichloro-dihydro-fluorescein diacetate(DCFH-DA)assay was used to detect the level of reactive oxygen species(ROS)in cells.Western blotting was performed to detect the expression level of mitochondrial autophagy regulatory proteins Pink1,Parkin,p62,LC3,mitochondrial biogenesis regulatory protein PGC1α,division/fusion regulatory proteins OPA1,MFN2,DRP1,p-DRP1 and antioxidant stress regulatory proteins Keap1 and Nrf2.HBAD-mcherry-EGFP-LC3 adenovirus transfected cells was used to observed the number of autophagosomes and autophagolysosomes.Results The results showed that the intracellular concentration of HN in PC12 in the Rot poisening group was significantly higher than that in the control group(P＜0.05);Compared with the control group,the Rot poisening group had significantly decreased activity of PC12 cells,decreased ATP content and increased production of ROS.After the poisen of Rot in PC12 cells,the expression of Pink1 and p-Parkin,the ratio of LC3Ⅱ/LC3Ⅰ and the expression of p-DRP1 in mitochondrial fusion protein was increased,while the expression of p62,the expression of mitochondrial biogenesis protein PGC1 α,mitochondrial fusion proteins MFN2 and OPA1,and antioxidant stress proteins Keap1 and Nrf2 were decreased(all P＜0.05).The number of autophagosomes and autophagolysosomes in PC12 cells in the Rot poisening group was higher than that in the control group(P＜0.05),and HN pretreatment(20 μmol/L)could significantly improve the changes mentioned above caused by Rot poisening(P＜0.05).Conclusion HN ameliorates Rot-induced toxic damage for dopamine neurons by inhibiting mitophagy and mitochondrial division and promoting mitochondrial biogenesis and fusion,and anti-oxidative stress.