ObjectiveTo investigate the antiviral efficacy of pegylated interferon α-2b （PEG-IFN-α-2b） in patients with HBV-related liver cirrhosis， to assess the safety and tolerability of this regimen， and to provide evidence-based medical evidence for optimizing the treatment strategies for patients with HBV-related compensated liver cirrhosis. MethodsA prospective study was conducted among 115 patients with HBV-related compensated liver cirrhosis and 114 patients with CHB who attended Third People’s Hospital of Taiyuan from January 2023 to March 2024. Treatment-naïve patients received PEG-IFN-α-2b monotherapy， while the patients once treated with nucleos（t）ide analogues （NAs） received PEG-IFN-α-2b add-on therapy. The patients with HBV-related compensated liver cirrhosis were followed up at baseline and at 12， 24， 36， and 48 weeks of treatment. Samples were collected from CHB patients at baseline and at the end of follow-up to assess virological indicators， routine blood test results， and liver function. The chi-square test was used for comparison of categorical data between groups； the independent samples t-test was used for comparison of normally distributed continuous data between two groups， and the one-way repeated measures analysis of variance was used for comparison among different time ponts within the same group，and the Bonferroni was applied for post-hoc pairwise comparisons； the Mann-Whitney U test was used for comparison of non-normally distributed continuous data between two groups， and the Friedman test was used for comparison across different time points within the same group， and the Nemenyi test was utilized for subsequent pairwise comparisons. The multivariate stepwise Logistic regression analysis was used to investigate the influencing factors for clinical cure. ResultsCompared with the CHB group， the HBV-related compensated liver cirrhosis group had a significantly higher mean age （43.50±9.97 years vs 40.90±8.16 years， t=2.160， P=0.032）， a significantly higher proportion of patients with hepatitis B e antigen at baseline （28.70% vs 15.79%， χ²=4.788， P=0.029）， and a significantly lower platelet level ［（178.67±55.07）×10⁹/L vs （194.93±55.79）×10⁹/L， t=2.217， P=0.028］. Compared with the CHB group at the end of follow-up， the HBV-related compensated liver cirrhosis group had significantly lower HBV surface antigen （HBsAg） clearance rate （10.38% vs 33.04%， χ²=14.988， P<0.001） and HBV surface antibody positive rate （0.00% vs 19.64%， χ²=21.041， P<0.001）. Compared with the CHB group at the end of follow-up，the HBV-related compensated liver cirrhosis group had significantly lower aminotransferase levels ［ALT： 31.00（19.00～47.50） U/L vs 40.00（27.00～57.00） U/L， Z=2.433， P<0.05； AST： 31.00（23.00～45.50） U/L vs 37.00（25.00～52.00） U/L， Z=1.963， P<0.05］， but significantly higher level of white blood cells （WBC） ［（4.02±1.56）×10⁹/L vs （3.59±1.24）×10⁹/L， t=2.272， P<0.05］， neutrophils ［（2.39±1.17）×10⁹/L vs （1.87±0.94）×10⁹/L， t=3.284， P<0.05］， and platelets ［（143.93±68.10）×10⁹/L vs （121.88±49.72）×10⁹/L， t=2.588， P<0.05］. A lower level of HBsAg （OR=0.997， 95%CI： 0.996　—　0.999， P<0.001） and previous treatment with NAs （OR=5.889， 95%CI： 2.195　—　17.330， P<0.001） were positive predictive factors for clinical cure， while liver cirrhosis （OR=0.177， 95%CI： 0.063　—　0.470， P<0.001） was a negative predictive factor for clinical cure. During follow-up， no patients experienced acute decompensation or progression to hepatocellular carcinoma， and the main adverse events included fever， fatigue， reductions in WBC and platelets， weight loss， alopecia， and thyroid dysfunction. In the subgroup analysis of HBV-related compensated liver cirrhosis， in both the treatment-naïve patients and the patients previously treated with NAs， there was a significant reduction in HBsAg level from baseline to week 36 of treatment ［treatment-naïve： 99.25 （5.87　—　1 212.35） IU/mL vs 403.47 （36.94　—　2 569.02） IU/mL， P<0.05； previously treated with NAs： 205.94 （14.00　—　737.80） IU/mL vs 427.03 （65.64　—　1 552.65） IU/mL， P<0.05］ and week 48 of treatment ［treatment-naïve： 85.45 （0.58　—　827.56） IU/mL vs 403.47 （36.94　—　2 569.02） IU/mL， P<0.05； previously treated with NAs： 45.28 （0.16　—　267.27） IU/mL vs 427.03 （65.64　—　1 552.65） IU/mL， P<0.05］. There were significant increases in the levels of aminotransferases during treatment， as well as significant reductions in the levels of WBC， neutrophils， platelets， and hemoglobin （all P<0.05）. ConclusionAlthough a finite course of PEG-IFN-α-2b therapy has achieved a relatively low rate of clinical cure in the treatment of HBV-related compensated liver cirrhosis， it can still significantly reduce the level of HBsAg， and this treatment regimen has good safety and tolerability， without accelerating disease progression.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

BACKGROUND: Based on the China-VHD database, this study sought to develop and validate a Valvular Heart Disease- specific Age-adjusted Comorbidity Index (VHD-ACI) for predicting mortality risk in patients with VHD. METHODS & RESULTS: The China-VHD study was a nationwide, multi-centre multi-centre cohort study enrolling 13,917 patients with moderate or severe VHD across 46 medical centres in China between April-June 2018. After excluding cases with missing key variables, 11,459 patients were retained for final analysis. The primary endpoint was 2-year all-cause mortality, with 941 deaths (10.0%) observed during follow-up. The VHD-ACI was derived after identifying 13 independent mortality predictors: cardiomyopathy, myocardial infarction, chronic obstructive pulmonary disease, pulmonary artery hypertension, low body weight, anaemia, hypoalbuminaemia, renal insufficiency, moderate/severe hepatic dysfunction, heart failure, cancer, NYHA functional class and age. The index exhibited good discrimination (AUC, 0.79) and calibration (Brier score, 0.062) in the total cohort, outperforming both EuroSCORE II and ACCI (P < 0.001 for comparison). Internal validation through 100 bootstrap iterations yielded a C statistic of 0.694 (95% CI: 0.665-0.723) for 2-year mortality prediction. VHD-ACI scores, as a continuous variable (VHD-ACI score: adjusted HR (95% CI): 1.263 (1.245-1.282), P < 0.001) or categorized using thresholds determined by the Yoden index (VHD-ACI ≥ 9 vs. < 9, adjusted HR (95% CI): 6.216 (5.378-7.184), P < 0.001), were independently associated with mortality. The prognostic performance remained consistent across all VHD subtypes (aortic stenosis, aortic regurgitation, mitral stenosis, mitral regurgitation, tricuspid valve disease, mixed aortic/mitral valve disease and multiple VHD), and clinical subgroups stratified by therapeutic strategy, LVEF status (preserved vs. reduced), disease severity and etiology. CONCLUSION The VHD-ACI is a simple 13-comorbidity algorithm for the prediction of mortality in VHD patients and providing a simple and rapid tool for risk stratification.

This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans ; Nasal Cavity/surgery* ; Nasal Surgical Procedures ; China ; Consensus ; Sinusitis/surgery* ; Dermal Fillers

In recent decades, the prevalence of hyperuricemia and gout has increased dramatically due to lifestyle changes. The drugs currently recommended for hyperuricemia are associated with adverse reactions that limit their clinical use. In this study, we report that berberine (BBR) is an effective drug candidate for the treatment of hyperuricemia, with its mechanism potentially involving the modulation of gut microbiota and its metabolite, succinic acid. BBR has demonstrated good therapeutic effects in both acute and chronic animal models of hyperuricemia. In a clinical trial, oral administration of BBR for 6 months reduced blood uric acid levels in 22 participants by modulating the gut microbiota, which led to an increase in the abundance of Bacteroides and a decrease in Clostridium sensu stricto_1. Furthermore, Bacteroides fragilis was transplanted into ICR mice, and the results showed that Bacteroides fragilis exerted a therapeutic effect on uric acid similar to that of BBR. Notably, succinic acid, a metabolite of Bacteroides, significantly reduced uric acid levels. Subsequent cell and animal experiments revealed that the intestinal metabolite, succinic acid, regulated the upstream uric acid synthesis pathway in the liver by inhibiting adenosine monophosphate deaminase 2 (AMPD2), an enzyme responsible for converting adenosine monophosphate (AMP) to inosine monophosphate (IMP). This inhibition resulted in a decrease in IMP levels and an increase in phosphate levels. The reduction in IMP led to a decreased downstream production of hypoxanthine, xanthine, and uric acid. BBR also demonstrated excellent renoprotective effects, improving nephropathy associated with hyperuricemia. In summary, BBR has the potential to be an effective treatment for hyperuricemia through the gut-liver axis.

Objective To design a VR-based air evacuation training system for simulating the on-board medical treatment process during air evacuation.Methods A VR-based air evacuation training system was developed which used 3D modeling technology to construct models of the medical aircraft cabin,medical devices and virtual characters to achieve scene interaction.The hardware part of the system included server computers,training terminal computers,VR equipment,3D fusion projection equipment,motion capture equipment,etc.The software of the system was developed using C++,UE4 Blueprint and C# programming languages,including two modules for medical treatment unit and medical treatment training process evaluation.The efficacy of the system was verified by the trials in air evacuation.Results The system developed successfully simulated the scenarios of tracheal tube dislodgement and increased intracranial pressure in the scenario model of open severe craniocerebral injury.The expert evaluation showed that the system gained advantages in training efficiency,low cost,safety,sense of immersion and recorded the operation data in real time to optimize the follow-up training.Conclusion The system developed delivers a virtual training environment with high-fidelity replication of real-mission conditions,enabling whole-course and immersive air evacuation drills.[Chinese Medical Equipment Journal,2025,46(3):15-20]

Occupational noise-induced hearing loss (NIHL) is an irreversible sensorineural hearing loss that severely endangers workers’ health, making early screening crucial. This article reviewed the research progress on early screening methods for occupational NIHL, introduced the testing mechanisms of three core screening methods—tympanometry, otoacoustic emissions, and extended high-frequency audiometry —and summarized their clinical application advantages and limitations. It is proposed that multimodal combined detection (e.g., the combination of tympanometry, otoacoustic emissions, and extended high-frequency audiometry) can significantly improve the accuracy and comprehensiveness of early screening. Meanwhile, future studies with prospective cohort design are encouraged to verify the long-term monitoring value of each method and to strengthen the joint development of screening technologies with cutting-edge approaches such as machine learning, in order to further improve screening efficiency and provide stronger protection for workers’ hearing health.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Turning to critical illness is a common stage of various diseases and injuries before death. Patients usually have complex health conditions, while the treatment process involves a wide range of content, along with high requirements for doctor′s professionalism and multi-specialty teamwork, as well as a great demand for time-sensitive treatments. However, this is not matched with critical care professionals and the current state of medical care in China. Telemedicine, which shortens the distance of medical professionals and the gap of disease diagnosis and treatments in various regions through electronic information, can effectively solve the current problem. Therefore, there is an urgent need to develop a standardized, high-quality visualization telemedicine round system .Therefore, experts have been organized to search domestic and foreign literature on telemedicine round for critically ill patients and to form this consensus based on clinical experiences so as to further improve the level of critical care treatments in regions.

Objective:To analyze the influencing factors for special interests in rheumatology diseases in residents after their completion of standardized residency training.Methods:A questionnaire survey was conducted among general practitioners who participated in residential training in the base from September 1, 2011 to June 30, 2024, and the possible influencing factors were collected and analyzed.Results:Eighty-six cases (63.2%) of general practitioners expressed interest in rheumatology. A higher proportion of physicians showed interest in rheumatology when they engaged in the following activities: taking rheumatology as a subspecialty in practice on rheumtic diseases [16.3% (14/86) vs. 0 (0/50), χ2=15.93, P<0.001], taking night shifts during rheumatology rotation [57.0%(49/86) vs. 20% (10/50), χ2=17.60, P<0.001], studying with mentors of rheumatogy[89.5%(77/86) vs. 54.0%(27/50), χ2=22.19, P<0.001], participating in research on rheamatic diseases[16.3% (14/86) vs. 2.0% (1/50), χ2=6.57, P=0.010], involved in rheumatology outpatient teaching sessions [33.7%(29/86) vs. 8.0% (4/50), χ2=11.38, P<0.001], and receiving career guidance on mentors of rheumatology[39.5%(34/86) vs. 18.0% (9/50), χ2=6.78, P=0.012]. Multivariate logistic analysis revealed that the following were independent promoting factors for developing interest in rheumatology: taking rheumatology as a subspecialty in practice [ OR(95% CI) =3.82 (1.5,9.7), P=0.005], taking night shifts during rheumatology rotation [ OR(95% CI) =3.41 (1.25,9.28), P=0.017], and studying with mentors of rheumatology[ OR(95% CI) =6.44 (2.18,19.08), P<0.001]. Conclusion:Most residents expressed interest in rheumatology. Taking rheumatology as a practice sub-specialty, taking night shifts and during rotation and learning from mentors have a positive impact on residents interest in rheumatology after their completion of residency.