OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

BACKGROUND: Based on the China-VHD database, this study sought to develop and validate a Valvular Heart Disease- specific Age-adjusted Comorbidity Index (VHD-ACI) for predicting mortality risk in patients with VHD. METHODS & RESULTS: The China-VHD study was a nationwide, multi-centre multi-centre cohort study enrolling 13,917 patients with moderate or severe VHD across 46 medical centres in China between April-June 2018. After excluding cases with missing key variables, 11,459 patients were retained for final analysis. The primary endpoint was 2-year all-cause mortality, with 941 deaths (10.0%) observed during follow-up. The VHD-ACI was derived after identifying 13 independent mortality predictors: cardiomyopathy, myocardial infarction, chronic obstructive pulmonary disease, pulmonary artery hypertension, low body weight, anaemia, hypoalbuminaemia, renal insufficiency, moderate/severe hepatic dysfunction, heart failure, cancer, NYHA functional class and age. The index exhibited good discrimination (AUC, 0.79) and calibration (Brier score, 0.062) in the total cohort, outperforming both EuroSCORE II and ACCI (P < 0.001 for comparison). Internal validation through 100 bootstrap iterations yielded a C statistic of 0.694 (95% CI: 0.665-0.723) for 2-year mortality prediction. VHD-ACI scores, as a continuous variable (VHD-ACI score: adjusted HR (95% CI): 1.263 (1.245-1.282), P < 0.001) or categorized using thresholds determined by the Yoden index (VHD-ACI ≥ 9 vs. < 9, adjusted HR (95% CI): 6.216 (5.378-7.184), P < 0.001), were independently associated with mortality. The prognostic performance remained consistent across all VHD subtypes (aortic stenosis, aortic regurgitation, mitral stenosis, mitral regurgitation, tricuspid valve disease, mixed aortic/mitral valve disease and multiple VHD), and clinical subgroups stratified by therapeutic strategy, LVEF status (preserved vs. reduced), disease severity and etiology. CONCLUSION The VHD-ACI is a simple 13-comorbidity algorithm for the prediction of mortality in VHD patients and providing a simple and rapid tool for risk stratification.

This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans ; Nasal Cavity/surgery* ; Nasal Surgical Procedures ; China ; Consensus ; Sinusitis/surgery* ; Dermal Fillers

In recent decades, the prevalence of hyperuricemia and gout has increased dramatically due to lifestyle changes. The drugs currently recommended for hyperuricemia are associated with adverse reactions that limit their clinical use. In this study, we report that berberine (BBR) is an effective drug candidate for the treatment of hyperuricemia, with its mechanism potentially involving the modulation of gut microbiota and its metabolite, succinic acid. BBR has demonstrated good therapeutic effects in both acute and chronic animal models of hyperuricemia. In a clinical trial, oral administration of BBR for 6 months reduced blood uric acid levels in 22 participants by modulating the gut microbiota, which led to an increase in the abundance of Bacteroides and a decrease in Clostridium sensu stricto_1. Furthermore, Bacteroides fragilis was transplanted into ICR mice, and the results showed that Bacteroides fragilis exerted a therapeutic effect on uric acid similar to that of BBR. Notably, succinic acid, a metabolite of Bacteroides, significantly reduced uric acid levels. Subsequent cell and animal experiments revealed that the intestinal metabolite, succinic acid, regulated the upstream uric acid synthesis pathway in the liver by inhibiting adenosine monophosphate deaminase 2 (AMPD2), an enzyme responsible for converting adenosine monophosphate (AMP) to inosine monophosphate (IMP). This inhibition resulted in a decrease in IMP levels and an increase in phosphate levels. The reduction in IMP led to a decreased downstream production of hypoxanthine, xanthine, and uric acid. BBR also demonstrated excellent renoprotective effects, improving nephropathy associated with hyperuricemia. In summary, BBR has the potential to be an effective treatment for hyperuricemia through the gut-liver axis.

Occupational noise-induced hearing loss (NIHL) is an irreversible sensorineural hearing loss that severely endangers workers’ health, making early screening crucial. This article reviewed the research progress on early screening methods for occupational NIHL, introduced the testing mechanisms of three core screening methods—tympanometry, otoacoustic emissions, and extended high-frequency audiometry —and summarized their clinical application advantages and limitations. It is proposed that multimodal combined detection (e.g., the combination of tympanometry, otoacoustic emissions, and extended high-frequency audiometry) can significantly improve the accuracy and comprehensiveness of early screening. Meanwhile, future studies with prospective cohort design are encouraged to verify the long-term monitoring value of each method and to strengthen the joint development of screening technologies with cutting-edge approaches such as machine learning, in order to further improve screening efficiency and provide stronger protection for workers’ hearing health.

Objective To investigate the effect of final vowel types on the voice onset time(VOT)of differ-ent stops in children with hearing impairment,and to provide a basis for the acquisition and correction of stop sounds.Methods A total of 22 hearing-impaired children aged 3～6 and 22 children with normal hearing were ran-domly selected-18 consonant-vowel(CV)syllables composed of 6 stops and 3 single finals were recorded,using first tone.Using Praat 6.1.29 software to analyze and extract the stops VOT.Two-way ANOVA was used for each stop,the dependent variable was VOT,and the independent variables were hearing status and final type.Results Children in the hearing-impaired group had articulation errors in/t/,/g/,and/k/.Hearing status had significant effect on the main effect of plosives/g/,/p/,/t/,/k/(P＜0.05),and the VOT of slurs/g/,/p/,/t/,/k/in the normal hearing group significantly greater than the hearing-impaired group(P＜0.05).The main effect of finals on the VOT of the stops/b/,/p/and/t/was significant(P＜0.05).Hearing status and final type had an interac-tive effect on the stop/t/,and the simple main effect showed that the difference in VOT of/ti/between the hear-ing-impaired group and the normal hearing group was greater than that of/ta/and/tu/.Conclusion The stops/g/,/p//t/,/k/VOT of hearing-impaired children are smaller than those of with normal hearing.The difference in VOT of/ti/sound between the hearing impaired group and the normal hearing group is greater than that of/ta/sound and/tu/sound.In the teaching of the initial/t/sound for hearing-impaired children,we can start with/ta/and/tu/with less difference,and the/ti/sound is consolidated later.Pay attention to breathing and oral exercise training,to lay a good foundation for clear pronunciation.

BACKGROUND:There have been many studies on adjacent vertebral fractures in elderly female patients with osteoporotic vertebral compression fractures,but their related risk factors are still in debate.There are also few studies on how to intuitively present their risks for clinical application. OBJECTIVE:To analyze the risk factors of adjacent vertebral refracture in senile women with osteoporotic vertebral compression fracture and construct a Nomogram prediction model. METHODS:A total of 268 elderly female patients with osteoporotic vertebral compression fracture who came to Ganzhou People's Hospital for treatment from January 2018 to November 2022 were selected and divided into study group(adjacent vertebral refracture,n=31)and control group(no adjacent vertebral refracture,n=237)according to whether adjacent vertebral refracture occurred 3 months after percutaneous vertebroplasty.General clinical data were compared between the two groups.Multivariate Logistic regression analysis was conducted to analyze the independent risk factors of adjacent vertebral refracture in elderly women with osteoporotic vertebral compression fracture.A Nomogram prediction model was constructed by R software"rms"package. RESULTS AND CONCLUSION:(1)There were statistically significant differences in age,menopause age,body mass index,fracture history,number of fractured vertebra before surgery,bone cement leakage,bone density,postoperative kyphotic deformity angle,and preoperative Oswestry disability index between the two groups(P<0.05).(2)Multivariate logistic regression analysis results showed that age(>69 years old),menopause age(≤51 years old),body mass index(>24.7 kg/m2),fracture history(presence),number of fractured vertebra before surgery(≥2),and postoperative kyphotic deformity angle(>13°)were independent risk factors for adjacent vertebral refracture in elderly female osteoporotic vertebral compression fracture patients(P<0.05).(3)Nomogram prediction model decision curve results displayed that when the risk threshold was>0.09,this prediction model provided significant additional clinical net benefit.(4)These findings indicate that older age,lower menopause age,higher body mass index,history of fracture,more vertebra fractures before surgery,and larger kyphosis angle after surgery are independent factors for adjacent vertebral refracture in elderly women with osteoporotic vertebral compression fracture.This Nomogram prediction model will provide important strategic guidance for the prevention and treatment of adjacent vertebral refracture in elderly women with osteoporotic vertebral compression fracture.

Ankylosing spondylitis (AS) combined with lower cervical fracture is often categorized into unstable fracture, with a high incidence of neurological injury and a high rate of disability and morbidity. As factors such as shoulder occlusion may affect the accuracy of X-ray imaging diagnosis, it is often easily misdiagnosed at the primary diagnosis. Non-operative treatment has complications such as bone nonunion and the possibility of secondary neurological damage, while the timing, access and choice of surgical treatment are still controversial. Currently, there are no clinical practice guidelines for the treatment of AS combined with lower cervical fracture with or without dislocation. To this end, the Spinal Trauma Group of Orthopedics Branch of Chinese Medical Doctor Association organized experts to formulate Clinical guidelines for the treatment of ankylosing spondylitis combined with lower cervical fracture in adults ( version 2024) in accordance with the principles of evidence-based medicine, scientificity and practicality, in which 11 recommendations were put forward in terms of the diagnosis, imaging evaluation, typing and treatment, etc, to provide guidance for the diagnosis and treatment of AS combined with lower cervical fracture.

Objective To explore the distribution of traditional Chinese medicine(TCM)syndrome elements in patients with multi-drug resistant bacteria-infected pneumonia.Methods Clinical data of 126 patients with multi-drug resistant bacteria-infected pneumonia admitted to the intensive care unit of Lung Disease Centre of Qingdao Hospital of Traditional Chinese Medicine from May 2020 to July 2022 were retrospectively collected.The clinical data included the patients'gender,age,underlying diseases,history of bad additions of smoking and alcohol,multi-drug resistant bacteria,and the information of four diagnostic methods of TCM,etc.The disease-nature syndrome elements in patients with drug-resistance to various strains of drug-resistant bacteria were extracted,and then deficiency-excess syndrome differentiation was carried out.Results(1)A total of 201 strains of multi-drug resistant bacteria were detected in 126 patients with multi-drug resistant bacterial pneumonia.The main pathogenic species were Gram-negative bacteria,and the proportion accounted for 95.52%(192/201),which was significantly higher than that of Gram-positive bacteria[4.48%(9/201)],with a statistically significant difference(χ2 = 166.612,P＜0.001).Klebsiella pneumoniae accounted for the highest percentage of 23.38%in the gram-negative bacterium.(2)A total of 12 syndrome elements were extracted from the 126 patients.The excess syndrome elements were predominated by phlegm and heat,and the deficiency syndrome elements were predominated by yin deficiency.There was no statistically significant difference in the distribution of yin deficiency,blood deficiency,heat,phlegm,fluid-retention and damp syndrome elements among patients with different strains of drug-resistant bacterial infection(P＞0.05).(3)Of the 126 patients,62 cases(49.21%)had simple excess syndrome,one case(0.79%)had simple deficiency syndrome,and 63 cases(50.00%)had concurrent deficiency-excess syndrome.Among the 126 patients,there were 19 cases of single syndrome element,41 cases of concurrent two-syndrome element,49 cases of concurrent three-syndrome element,16 cases of concurrent four-syndrome element,and one case of concurrent five-syndrome element.And the combined syndrome element of phlegm-heat-yin deficiency occurred most frequently for 26 times.Conclusion Gram-negative bacteria are the primary infectious pathogens for the patients with multi-drug resistant bacterial infections,and the TCM syndrome elements of the patients are characterized by the concurrence of deficiency and excess and simple excess syndrome,mainly manifesting as phlegm,heat,and yin deficiency.

Objective To make an epidemiological investigation on traditional Chinese medicine(TCM)dampness syndrome manifestations in the population at risk of cerebrovascular diseases in Guangdong area.Methods A cross-sectional study was conducted to analyze the clinical data related to the risk of cerebrovascular diseases in 330 Guangdong permanent residents.The diagnosis of dampness syndrome,quantitative scoring of dampness syndrome and rating of the risk of stroke were performed for the investigation of the distribution pattern of dampness syndrome and its influencing factors.Results(1)A total of 306(92.73%)study subjects were diagnosed as dampness syndrome.The percentage of dampness syndrome in the risk group was 93.82%(258/275),which was slightly higher than that of the healthy group(48/55,87.27%),but the difference was not statistically significant(χ2 = 2.91,P = 0.112).The quantitative score of dampness syndrome in the risk group was higher than that of the healthy group,and the difference was statistically significance(Z =-2.24,P = 0.025).(2)Among the study subjects at risk of cerebrovascular disease,evaluation time(χ2 = 26.11,P = 0.001),stroke risk grading(χ2= 8.85,P = 0.031),and history of stroke or transient ischemic attack(TIA)(χ2 = 9.28,P = 0.015)were the factors influencing the grading of dampness syndrome in the population at risk of cerebrovascular disease.Conclusion Dampness syndrome is the common TCM syndrome in the population of Guangdong area.The manifestations of dampness syndrome are more obvious in the population with risk factors of cerebrovascular disease,especially in the population at high risk of stroke,and in the population with a history of stroke or TIA.The assessment and intervention of dampness syndrome should be taken into account for future project of stroke prevention in Guangdong.