OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

BACKGROUND: Based on the China-VHD database, this study sought to develop and validate a Valvular Heart Disease- specific Age-adjusted Comorbidity Index (VHD-ACI) for predicting mortality risk in patients with VHD. METHODS & RESULTS: The China-VHD study was a nationwide, multi-centre multi-centre cohort study enrolling 13,917 patients with moderate or severe VHD across 46 medical centres in China between April-June 2018. After excluding cases with missing key variables, 11,459 patients were retained for final analysis. The primary endpoint was 2-year all-cause mortality, with 941 deaths (10.0%) observed during follow-up. The VHD-ACI was derived after identifying 13 independent mortality predictors: cardiomyopathy, myocardial infarction, chronic obstructive pulmonary disease, pulmonary artery hypertension, low body weight, anaemia, hypoalbuminaemia, renal insufficiency, moderate/severe hepatic dysfunction, heart failure, cancer, NYHA functional class and age. The index exhibited good discrimination (AUC, 0.79) and calibration (Brier score, 0.062) in the total cohort, outperforming both EuroSCORE II and ACCI (P < 0.001 for comparison). Internal validation through 100 bootstrap iterations yielded a C statistic of 0.694 (95% CI: 0.665-0.723) for 2-year mortality prediction. VHD-ACI scores, as a continuous variable (VHD-ACI score: adjusted HR (95% CI): 1.263 (1.245-1.282), P < 0.001) or categorized using thresholds determined by the Yoden index (VHD-ACI ≥ 9 vs. < 9, adjusted HR (95% CI): 6.216 (5.378-7.184), P < 0.001), were independently associated with mortality. The prognostic performance remained consistent across all VHD subtypes (aortic stenosis, aortic regurgitation, mitral stenosis, mitral regurgitation, tricuspid valve disease, mixed aortic/mitral valve disease and multiple VHD), and clinical subgroups stratified by therapeutic strategy, LVEF status (preserved vs. reduced), disease severity and etiology. CONCLUSION The VHD-ACI is a simple 13-comorbidity algorithm for the prediction of mortality in VHD patients and providing a simple and rapid tool for risk stratification.

This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans ; Nasal Cavity/surgery* ; Nasal Surgical Procedures ; China ; Consensus ; Sinusitis/surgery* ; Dermal Fillers

In recent decades, the prevalence of hyperuricemia and gout has increased dramatically due to lifestyle changes. The drugs currently recommended for hyperuricemia are associated with adverse reactions that limit their clinical use. In this study, we report that berberine (BBR) is an effective drug candidate for the treatment of hyperuricemia, with its mechanism potentially involving the modulation of gut microbiota and its metabolite, succinic acid. BBR has demonstrated good therapeutic effects in both acute and chronic animal models of hyperuricemia. In a clinical trial, oral administration of BBR for 6 months reduced blood uric acid levels in 22 participants by modulating the gut microbiota, which led to an increase in the abundance of Bacteroides and a decrease in Clostridium sensu stricto_1. Furthermore, Bacteroides fragilis was transplanted into ICR mice, and the results showed that Bacteroides fragilis exerted a therapeutic effect on uric acid similar to that of BBR. Notably, succinic acid, a metabolite of Bacteroides, significantly reduced uric acid levels. Subsequent cell and animal experiments revealed that the intestinal metabolite, succinic acid, regulated the upstream uric acid synthesis pathway in the liver by inhibiting adenosine monophosphate deaminase 2 (AMPD2), an enzyme responsible for converting adenosine monophosphate (AMP) to inosine monophosphate (IMP). This inhibition resulted in a decrease in IMP levels and an increase in phosphate levels. The reduction in IMP led to a decreased downstream production of hypoxanthine, xanthine, and uric acid. BBR also demonstrated excellent renoprotective effects, improving nephropathy associated with hyperuricemia. In summary, BBR has the potential to be an effective treatment for hyperuricemia through the gut-liver axis.

Occupational noise-induced hearing loss (NIHL) is an irreversible sensorineural hearing loss that severely endangers workers’ health, making early screening crucial. This article reviewed the research progress on early screening methods for occupational NIHL, introduced the testing mechanisms of three core screening methods—tympanometry, otoacoustic emissions, and extended high-frequency audiometry —and summarized their clinical application advantages and limitations. It is proposed that multimodal combined detection (e.g., the combination of tympanometry, otoacoustic emissions, and extended high-frequency audiometry) can significantly improve the accuracy and comprehensiveness of early screening. Meanwhile, future studies with prospective cohort design are encouraged to verify the long-term monitoring value of each method and to strengthen the joint development of screening technologies with cutting-edge approaches such as machine learning, in order to further improve screening efficiency and provide stronger protection for workers’ hearing health.

Objective To explore the effect of rotenone exposure on the metabolic homeostasis of nicotinamide adenine dinucleotide(NAD+)in dopaminergic neurons of the rat mid-brain striatum,and investigate the effect of exogenous NAD+intervention on the cellular damage response of dopaminergic neurons induced by rotenone.Methods Male SD rats(8 weeks old,200～250 g)were divided into a control group using a table of random numbers,a rotenone exposure group,an NAD+-intervention group,and an NAD+group.An intoxication model was established in the rotenone exposure group.NAD+(250 mg/kg)was administered simultaneously with rotenone exposure in the NAD+-intervention group.The NAD+group was only given NAD+,while the control group received no intervention.After modeling,open field test was performed to evaluate behavioral changes.After scarification,serum samples and mid-brain striatal tissues were collected.HE staining was used to observe the morphology of dopaminergic neurons in the striatum.The NAD+content in the tissues was detected with NAD+/NADH kit.Western blotting was employed to determine the contents of tyrosine hydroxylase(TH),nicotinamide phosphoribosyltransferase(NAMPT),nicotinamide mononucleotide adenylyltransferase(NMNAT),and solute carrier family 25 member A51(SLC25A51).ELISA was utilized to measure the content of dopamine in the striatal tissues.Immunohistochemical staining was applied to observe the distribution and contents of TH proteins in the striatal tissues of each group.Results Rotenone exposure significantly affected the vital signs and motor abilities of rats,induced disorderly-arranged,atrophy and deformed neurons in the striatal tissue,decreased the content of TH,rate-limiting enzyme for dopamine synthesis,by approximately 29%(P<0.01),the content of dopamine by about 42%,and that of NAD+by almost 50%(P<0.01),while increased the NADH/NAD+ratio(P<0.01).After exposure,the content of NAMPT,an enzyme related to NAD+synthesis,was decreased by 26%(P<0.05),the contents of NMNAT1-3 and SLC25A51,mitochondrial transporters of NAD+by approximately 21%,38%,43%,and 21%,respectively(P<0.01).Exogenous NAD+intervention improved the motor function of exposure rats and the morphology of dopaminergic neurons in the mid-brain striatal tissue,and restored the content of TH in the striatal tissue significantly by 12.8%(P<0.05),and the content of dopamine by 20.9%(P<0.05).Conclusion Rotenone disrupts the NAD+homeostasis in dopaminergic neurons by inhibiting the NAD+synthesis and transport pathways in the mid-brain striatal tissues,while exogenous NAD+intervention can effectively alleviate the dopaminergic neuron damage induced by rotenone exposure.

Objective To investigate the effects of a 100 mT static magnetic field(SMF)on emotional behavior and brain damage-related molecules in mice.Methods Fifty-eight C57BL/6N mice were randomly divided into control group(n=25)and observation group(n=33).Mice in observation group were exposed to a 100 mT SMF for 0.5 h/d over 14 consecutive days,while mice in control group underwent pseudo-exposure.On the 7 and 14 days of exposure,anxiety-like behavior was assessed using open field and elevated plus maze tests.Cerebral blood flow was monitored using laser speckle imaging,and the levels of tumor necrosis factor-α(TNF-α),interleukin(IL)-1β,IL-4,central nervous system specific protein β(S100β),neuron-specific enolase(NSE),and brain-derived neurotrophic factor(BDNF)were measured by radioimmunoassay.BDNF expression in the brain was detected by immunofluorescence.Results On the 7 and 14 days of SMF exposure,the open field and elevated plus maze tests showed no statistically significant differences between observation and control groups in the frequencies,durations,and distance entering the central area of the open field and the open arm of the elevated plus maze(P>0.05).Laser speckle imaging revealed no significant difference in cerebral cortical perfusion compared with pre-exposure period(P>0.05).The results of radioimmunoassay showed that compared with control group,on the 7 d of SMF exposure,the serum IL-1β,NSE and S100β levels were significantly increased(P<0.05),the serum BDNF level was significantly decreased(P<0.05),and the IL-1β and TNF-α contents in brain tissues were significantly increased in observation group(P<0.01).On the 14 d of SMF exposure,serum IL-1β,TNF-α,NSE,and S100β levels were significantly increased(P<0.05,P<0.0001),and the brain IL-1β and TNF-α levels were significantly increased(P<0.01)in observation group.No statistically significant differences were found in anti-inflammatory cytokine IL-4 level of serum and brain tissue or BDNF content of brain tissue between the two groups(P>0.05).Conclusion Continuous exposure to a 100 mT SMF for 14 d at 0.5 h/d induces neuroinflammation and brain damage in mice,without inducing anxiety-like behavior.

Objective To investigate the mechanism and protective effect of Humanin(HN)on rotenone(Rot)-induced toxic damage for dopamine neurons.Methods The Rot-poisened PC12 cell model was constructed,and the control group,the Rot poisening group,the HN pretreated Rot poisening group,and the HN treatment group were set up.ELISA was used to detect the content of HN inside and outside of Rot-infected cells,CCK-8 assay was used to detect cell viability,and ATP detection kit was used to detect the intracellular ATP content.Dichloro-dihydro-fluorescein diacetate(DCFH-DA)assay was used to detect the level of reactive oxygen species(ROS)in cells.Western blotting was performed to detect the expression level of mitochondrial autophagy regulatory proteins Pink1,Parkin,p62,LC3,mitochondrial biogenesis regulatory protein PGC1α,division/fusion regulatory proteins OPA1,MFN2,DRP1,p-DRP1 and antioxidant stress regulatory proteins Keap1 and Nrf2.HBAD-mcherry-EGFP-LC3 adenovirus transfected cells was used to observed the number of autophagosomes and autophagolysosomes.Results The results showed that the intracellular concentration of HN in PC12 in the Rot poisening group was significantly higher than that in the control group(P＜0.05);Compared with the control group,the Rot poisening group had significantly decreased activity of PC12 cells,decreased ATP content and increased production of ROS.After the poisen of Rot in PC12 cells,the expression of Pink1 and p-Parkin,the ratio of LC3Ⅱ/LC3Ⅰ and the expression of p-DRP1 in mitochondrial fusion protein was increased,while the expression of p62,the expression of mitochondrial biogenesis protein PGC1 α,mitochondrial fusion proteins MFN2 and OPA1,and antioxidant stress proteins Keap1 and Nrf2 were decreased(all P＜0.05).The number of autophagosomes and autophagolysosomes in PC12 cells in the Rot poisening group was higher than that in the control group(P＜0.05),and HN pretreatment(20 μmol/L)could significantly improve the changes mentioned above caused by Rot poisening(P＜0.05).Conclusion HN ameliorates Rot-induced toxic damage for dopamine neurons by inhibiting mitophagy and mitochondrial division and promoting mitochondrial biogenesis and fusion,and anti-oxidative stress.

Objective To explore the distribution of traditional Chinese medicine(TCM)syndrome elements in patients with multi-drug resistant bacteria-infected pneumonia.Methods Clinical data of 126 patients with multi-drug resistant bacteria-infected pneumonia admitted to the intensive care unit of Lung Disease Centre of Qingdao Hospital of Traditional Chinese Medicine from May 2020 to July 2022 were retrospectively collected.The clinical data included the patients'gender,age,underlying diseases,history of bad additions of smoking and alcohol,multi-drug resistant bacteria,and the information of four diagnostic methods of TCM,etc.The disease-nature syndrome elements in patients with drug-resistance to various strains of drug-resistant bacteria were extracted,and then deficiency-excess syndrome differentiation was carried out.Results(1)A total of 201 strains of multi-drug resistant bacteria were detected in 126 patients with multi-drug resistant bacterial pneumonia.The main pathogenic species were Gram-negative bacteria,and the proportion accounted for 95.52%(192/201),which was significantly higher than that of Gram-positive bacteria[4.48%(9/201)],with a statistically significant difference(χ2 = 166.612,P＜0.001).Klebsiella pneumoniae accounted for the highest percentage of 23.38%in the gram-negative bacterium.(2)A total of 12 syndrome elements were extracted from the 126 patients.The excess syndrome elements were predominated by phlegm and heat,and the deficiency syndrome elements were predominated by yin deficiency.There was no statistically significant difference in the distribution of yin deficiency,blood deficiency,heat,phlegm,fluid-retention and damp syndrome elements among patients with different strains of drug-resistant bacterial infection(P＞0.05).(3)Of the 126 patients,62 cases(49.21%)had simple excess syndrome,one case(0.79%)had simple deficiency syndrome,and 63 cases(50.00%)had concurrent deficiency-excess syndrome.Among the 126 patients,there were 19 cases of single syndrome element,41 cases of concurrent two-syndrome element,49 cases of concurrent three-syndrome element,16 cases of concurrent four-syndrome element,and one case of concurrent five-syndrome element.And the combined syndrome element of phlegm-heat-yin deficiency occurred most frequently for 26 times.Conclusion Gram-negative bacteria are the primary infectious pathogens for the patients with multi-drug resistant bacterial infections,and the TCM syndrome elements of the patients are characterized by the concurrence of deficiency and excess and simple excess syndrome,mainly manifesting as phlegm,heat,and yin deficiency.

Objective To make an epidemiological investigation on traditional Chinese medicine(TCM)dampness syndrome manifestations in the population at risk of cerebrovascular diseases in Guangdong area.Methods A cross-sectional study was conducted to analyze the clinical data related to the risk of cerebrovascular diseases in 330 Guangdong permanent residents.The diagnosis of dampness syndrome,quantitative scoring of dampness syndrome and rating of the risk of stroke were performed for the investigation of the distribution pattern of dampness syndrome and its influencing factors.Results(1)A total of 306(92.73%)study subjects were diagnosed as dampness syndrome.The percentage of dampness syndrome in the risk group was 93.82%(258/275),which was slightly higher than that of the healthy group(48/55,87.27%),but the difference was not statistically significant(χ2 = 2.91,P = 0.112).The quantitative score of dampness syndrome in the risk group was higher than that of the healthy group,and the difference was statistically significance(Z =-2.24,P = 0.025).(2)Among the study subjects at risk of cerebrovascular disease,evaluation time(χ2 = 26.11,P = 0.001),stroke risk grading(χ2= 8.85,P = 0.031),and history of stroke or transient ischemic attack(TIA)(χ2 = 9.28,P = 0.015)were the factors influencing the grading of dampness syndrome in the population at risk of cerebrovascular disease.Conclusion Dampness syndrome is the common TCM syndrome in the population of Guangdong area.The manifestations of dampness syndrome are more obvious in the population with risk factors of cerebrovascular disease,especially in the population at high risk of stroke,and in the population with a history of stroke or TIA.The assessment and intervention of dampness syndrome should be taken into account for future project of stroke prevention in Guangdong.