Objective To introduce the causes of accidents and the diagnosis and treatment of two patients with radiation-induced skin injury admitted to our hospital in 2023, and to provide a reference for the clinical treatment of subsequent radiation-induced skin injury. Methods The clinical treatment process of two patients with acute skin injury caused by external radiation exposure were summarized and analyzed. Results The exposure history of the two patients was reconstructed, the flaw detection scenario was simulated, the biological dose and hand skin exposure dose were estimated, and the infrared thermal imaging device was used for dynamic monitoring. A comprehensive analysis was conducted based on clinical manifestations and other data. The diagnosis of “Xie” was excessive exposure combined with acute radiation-induced skin injury on both hands (Grade IV for the right hand palm, index finger, and middle finger and Grade II for the left hand little finger). The diagnosis of “Hao” was acute radiation-induced skin injury on both hands (Grade I). The two patients received different clinical treatment measures: “Xie” was treated with both local and systemic therapies, while “Hao” was mainly treated with systemic therapy. Conclusion After systematic and effective treatment, the radiation-induced skin injuries healed in both patients.

ObjectiveTo identify potential influencing factors of urate crystal deposition at ankle/foot in patients with hyperuricemia （HUA）， and to analyze the predictive value of inflammatory indicators for urate crystal deposition in patients with different traditional Chinese medicine （TCM） syndromes， so as to provide potential reference for clinical risk assessment and individualized TCM intervention. MethodsA retrospective study was carried out with the enrollment of 231 HUA patients from The Third Affiliated People's Hospital of Fujian University of Traditional Chinese Medicine between January 2021 and December 2024. The enrolled patients were further divided into a crystal deposition-positive group （143 cases） and a crystal deposition-negative group （88 cases） according to the results of dual-energy computed tomography （CT）. Sociodemographic data， living habits， serum uric acid levels， and inflammatory indicators of the enrolled patients were collcted， and TCM syndrome differentiation was performed. Furthermore， univariate analysis was used to compare inter-group differences in clinical characteristics. MMultivariate Logistic regression was applied to identify the influencing factors of urate crystal deposition. In addition， the receiver operating characteristic （ROC） curves were plotted to evaluate the predictive efficacy of inflammatory indicators for crystal deposition across different TCM syndromes. ResultsThere were statistically significant inter-group differences in the proportion of males， age， body mass index， proportion of mental labor， rate of low water intake， and rate of high-sugar beverage consumption （P<0.05），whereas no significant difference in low exercise intensity was found between the two groups. Furthermore， compared with the negative group， the positive group had higher serum uric acid level， neutrophil-to-lymphocyte ratio （NLR）， and platelet-to-lymphocyte ratio （PLR）， but lower systemic immune-inflammation index （SIRI） （P<0.05）. Regarding the distribution of TCM syndromes， the positive group was dominated by the dampness-heat accumulation syndrome （55/143，38.46%）， while the negative group was mainly characterized by the phlegm-turbidity obstruction syndrome （44/88，50.00%）. Multivariate Logistic regression analysis revealed that high-sugar beverage consumption， elevated NLR， and elevated PLR were risk factors for urate crystal deposition ［odd ratio （OR） = 8.002， 5.377， 1.034， respectively； 95% CI 1.572-40.732， 2.179-13.270， 1.013-1.054，all P<0.05］， while SIRI was a protective factor （OR = 0.869， 95% CI 0.778-0.971， P<0.05）. In the positive group， patients with the dampness-heat accumulation syndrome exhibited the highest NLR， while the lowest PLR and SIRI， showing statistically significant differences with those of other syndromes （all P<0.05）. In addition， ROC curve analysis indicated that for the dampness-heat accumulation syndrome， the combined "NLR + PLR" model had an area under the curve （AUC） of 0.901 （95% CI 0.850-0.951， P<0.01）， with a sensitivity of 89.1% and a specificity of 79.5%； for the blood stasis-heat obstruction syndrome， the combined "NLR + PLR" model had an AUC of 0.880 （95% CI 0.825-0.934， P<0.01）， with a sensitivity of 100.0% and a specificity of 67.3%； for the liver-kidney Yin-deficiency syndrome， the single PLR model had an AUC of 0.842 （95% CI 0.731-0.952， P<0.01）， with a sensitivity of 83.3% and a specificity of 84.0%. ConclusionUrate crystal deposition in HUA patients exhibits intimate associations with high-sugar beverage consumption as well as elevated NLR and PLR levels. Meanwhile， TCM syndrome differentiation has potential correlation with inflammatory characteristics. The inflammatory indicator-based prediction model constructed based on TCM syndromes exhibits good predictive value.

ObjectiveTo establish the fingerprints of 15 batches of Hengzhi Kechuan capsules， to quantitatively analyze 10 index components， and to evaluate the quality uniformity of samples from different batches. MethodsThe fingerprints and quantitative analysis of Hengzhi Kechuan capsules were established by a combination method of high performance liquid chromatography coupled with diode array detector and charged aerosol detector（HPLC-DAD-CAD）， adenosine， guanosine， vanillic acid， safflomin A， agarotetrol， naringin， hesperidin， militarine， ginsenoside Rb₁， and glycyrrhizic acid were selected as quality attribute indexes. A total of 15 batches of Hengzhi Kechuan capsules from 2022 to 2024（3 boxes per batch） were qualitatively and quantitatively analyzed， and the quality uniformity level of the manufacturers was characterized by parameters of intra-batch consistency（P_A） and inter-batch consistency（P_B）. The homogeneity and difference of quality attribute indexes of samples from different years were analyzed by heatmap clustering analysis. ResultsHPLC fingerprints and quantitative method of Hengzhi Kechuan capsules were established， and the methods could be used for qualitative and quantitative analysis of this preparation， which was found to be stable and reliable by method validation. The similarity of fingerprints of 15 batches of samples was 0.887-0.975， a total of 13 common peaks were calibrated， and 10 common peaks were designated， all of which were quality attribute index components. The results of quantitative analysis showed that the contents of the above 10 ingredients in the samples were 0.038-0.078， 0.115-0.251， 0.007-0.018， 0.291-0.673， 0.122-0.257， 0.887-1.905， 1.841-3.364， 1.412-2.450， 2.207-3.112， 0.650-1.161， respectively. And the contents of ginsenoside Rb₁ and glycyrrhizic acid met the limit requirements in the 2020 edition of Chinese Pharmacopoeia. For the samples from 15 batches， the P_A values of the 10 index components were all <10%， indicating good intra-batch homogeneity， and the P_B values ranged from 33.86% to 92.97%， suggesting that the inter-batch homogeneity was poor. Heatmap clustering analysis showed that the samples from different years were clustered into separate categories， and adenosine， guanosine， safflomin A， naringin， hesperidin and agarotetrol were the main differential components. ConclusionThe intra-annual quality uniformity of Hengzhi Kechuan capsules is good and the inter-annual quality uniformity is insufficient， which may be related to the quality difference of Pinellinae Rhizoma Praeparatum， Carthami Flos， Citri Sarcodactylis Fructus， Citri Reticulatae Pericarpium， Aquilariae Lignum Resinatum， Citri Fructus， etc. In this study， the fingerprint and multi-indicator determination method of Hengzhi Kechuan capsules was established， which can be used for more accurate and efficient quality control and standardization enhancement.

Objective To explore the construction of α-1,3-galactosyltransferase (GGTA1) gene-knockout (GTKO) Diannan miniature pigs and the kidney xenotransplantation from pigs to rhesus macaques, and to assess the effectiveness of GTKO pigs. Methods The GTKO Diannan miniature pigs were constructed using the CRISPR/Cas9 gene-editing system and somatic cell cloning technology. The phenotype of GTKO pigs was verified through polymerase chain reaction, Sanger sequencing and immunofluorescence staining. Flow cytometry was used to detect antigen-antibody (IgM) binding and complement-dependent cytotoxicity. Kidney xenotransplantation was performed from GTKO pigs to rhesus macaques. The humoral immunity, cellular immunity, coagulation and physiological indicators of the recipient monkeys were monitored. The function and pathological changes of the transplanted kidneys were analyzed using ultrasonography, hematoxylin-eosin staining, immunohistochemical staining and immunofluorescence staining. Results Single-guide RNA (sgRNA) targeting exon 4 of the GGTA1 gene in Diannan miniature pigs was designed. The pGL3-GGTA1-sgRNA1-GFP vector was transfected into fetal fibroblasts of Diannan miniature pigs. After puromycin selection, two cell clones, C59# and C89#, were identified as GGTA1 gene-knockout clones. These clones were expanded to form cell lines, which were used as donor cells for somatic cell nuclear transfer. The reconstructed embryos were transferred into the oviducts of trihybrid surrogate sows, resulting in 13 fetal pigs. Among them, fetuses F04 and F11 exhibited biallelic mutations in the GGTA1 gene, and F04 had a normal karyotype. Using this GTKO fetal pig for recloning and transferring the reconstructed embryos into the oviducts of trihybrid surrogate sows, seven surviving piglets were obtained, all of which did not express α-Gal epitope. The binding of IgM from the serum of rhesus monkey 20# to GTKO pig PBMC was reduced, and the survival rate of GTKO pig PBMC in the complement-dependent cytotoxicity assay was higher than that of wild-type pig. GTKO pig kidneys were harvested and perfused until completely white. After the left kidney of the recipient monkey was removed, the pig kidney was heterotopically transplanted. Following vascular anastomosis and blood flow restoration, the pig kidney rapidly turned pink without hyperacute rejection (HAR). Urine appeared in the ureter 6 minutes later, indicating successful kidney transplantation. The right kidney of the recipient was then removed. Seven days after transplantation, the transplanted kidney had good blood flow, the recipient monkey's serum creatinine level was stable, and serum potassium and cystatin C levels were effectively controlled, although they increased 10 days after transplantation. Seven days after transplantation, the levels of white blood cells, lymphocytes, monocytes and eosinophils in the recipient monkey increased, while platelet count and fibrinogen levels decreased. The activated partial thromboplastin time, thrombin time and prothrombin time remained relatively stable but later showed an upward trend. The recipient monkey survived for 10 days. At autopsy, the transplanted kidney was found to be congested, swollen and necrotic, with a small amount of IgG deposition in the renal tissue, and a large amount of IgM, complement C3c and C4d deposition, as well as CD68⁺ macrophage infiltration. Conclusions The kidneys of GTKO Diannan miniature pigs may maintain normal renal function for a certain period in rhesus macaques and effectively overcome HAR, confirming the effectiveness of GTKO pigs for xenotransplantation.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objective: To explore the relationship between sleep quality and executive function among middle school students, so as to provide theoretical support for the promotion of adolescents physical and mental health development. Methods: From September to December 2023, 5 713 junior and senior high school students aged 13 to 18 were selected by stratified cluster random sampling method from Shanghai, Suzhou, Taiyuan, Wuyuan, Xingyi, and Urumqi. Pittsburgh Sleep Quality Index was used to conduct sleep quality survey. And conduct executive function was tested on middle school students, including inhibitory function, refresh function and conversion function tests. Spearman correlation and linear regression were used to analyze the relationship between sleep quality and executive function of middle school students. Results: The total Pittsburgh Sleep Quality Index (PSQI) score of boys was [4.0(2.0,6.0)] and that of girls was [5.0(3.0,6.0)], and the difference was statistically significant ( Z=-10.90, P < 0.01 ). The total PSQI score of boys was positively correlated with both 2-back reaction time and conversion function of executive function ( r =0.04, 0.04); the total PSQI score of girls was negatively correlated with 2-back reaction time ( r =-0.04) ( P <0.05). After controlling for variables such as mental health, physical activity and nutritional status,linear regression analyses showed that PSQI total score of middle school students was positively correlated with the inhibitory function and the conversion function response time [ B (95% CI )=1.28(0.21-2.34), 7.62(2.34-12.90), P <0.05]; the associations of total PSQI scores among middle school students with both 2-back and 1-back response time were not statistically significant [ B (95% CI )=-5.88(-16.14-4.37), 8.05( -3.39 -19.50), P >0.05]. Conclusion Positive correlations are observed on sleep quality with inhibitory and conversion functions of executive function among middle school students.

Astragalus membranaceus(A. membranaceus), a traditional tonic, contains flavonoids as one of its main bioactive components and key indicators for quality standard detection. These compounds predominantly exist in glycosylated forms after glycosylation modification within the plant. The catalytic products of flavonoid glycosyltransferases in A. membranaceus have been reported to be mostly monoglycosides, and only AmUGT28 catalyzes luteolin to form diglycosides. In this study, we cloned a glycosyltransferase gene, AmGT90, from A. membranaceus, with an ORF length of 1 335 bp, encoding 444 amino acids, and the protein had a relative molecular mass of 50.5 kDa. Phylogenetic tree analysis indicated that AmGT90 belongs to the UGT74 family. In vitro enzymatic reaction showed that AmGT90 had broad substrate specificity and could catalyze the glycosylation of various flavonoids, including isoflavones, flavones, flavanones, and chalcones. AmGT90 not only catalyzed the formation of monoglycosides but also diglycosides. In addition, the mechanism of AmGT90 catalyzing the formation of diglycosides from luteolin was preliminarily explored. The experimental results showed that AmGT90 may preferentially recognize C4'-OH of luteolin and then recognize C7-OH to form diglycosides. This study reported a glycosyltransferase from A. membranaceus capable of converting flavonoids into monoglycosides and diglycosides. This finding not only enhances our understanding of the biosynthetic pathways of flavonoid glycosides in A. membranaceus but also introduces a new component for glycoside production through synthetic biology.
Glycosyltransferases/chemistry* ; Flavonoids/chemistry* ; Astragalus propinquus/classification* ; Phylogeny ; Glycosylation ; Plant Proteins/chemistry* ; Substrate Specificity ; Cloning, Molecular ; Amino Acid Sequence

Cinnabar(HgS) was widely used in ancient times for medicinal purposes, religious rituals, and pigments. A group of bright red powdery clumps was excavated from Mawangdui Tomb No.3 of the Han Dynasty. Early studies considered the clumps as evidence of cinnabar's medicinal use during the Qin-Han period. This study employed a range of archaeometric techniques, including extended-depth-of-field stereo imaging, micro-CT, scanning electron microscopy-energy dispersive spectroscopy, Raman spectroscopy, and Fourier transform infrared spectrometry FTIR, to systematically analyze the material composition and structural characteristics of these remains. The results revealed that the cinnabar particles were granular, finely ground, and tightly bound to silk matrix, with no detectable excipients typically associated with medicinal formulations. Micro-CT imaging indicated a well-preserved textile structure, with clear signs of sedimentary accumulation and mechanical damage. Based on historical and archaeological studies, this study suggested that these remains were more likely degraded accumulations of cinnabar-colored silk textiles rather than medicinal cinnabar. By clarifying the diversity of ancient cinnabar applications and preservation states, this study provides new insights for the archaeological identification of mineral medicinal materials and contributes to the standardized study of Chinese medicinal materials and understanding of the historical use of cinnabar.
History, Ancient ; China ; Humans ; Medicine, Chinese Traditional/history* ; Archaeology ; Drugs, Chinese Herbal/history* ; Spectroscopy, Fourier Transform Infrared ; Spectrum Analysis, Raman ; Mercury Compounds

Eight amide alkaloids(1-8) were isolated from the 70% ethanol extract of Cannabis Fructus using silica gel column chromatography, MCI column chromatography, and semi-preparative high-performance liquid chromatography(HPLC). Their structures were identified as hempspiramide A(1), N-[(4-hydroxyphenyl)ethyl]formamide(2), N-acetyltyramide(3), N-trans-p-coumaroyltyramine(4), N-trans-caffeoyltyramine(5), N-trans-feruloyltyramine(6), N-cis-p-coumaroyltyramine(7), N-cis-feruloyltyramine(8) by using spectroscopic methods such as NMR and MS. Among these compounds, compound 1 was a new amide alkaloid, while compounds 2 and 3 were isolated from Cannabis Fructus for the first time. Some of the isolates were assayed for their α-glucosidase inhibitory activity. Compounds 5-7 displayed significant inhibitory activity against α-glucosidase with IC_(50) values ranging from 1.07 to 4.63 μmol·L~(-1).
Cannabis/chemistry* ; Alkaloids/pharmacology* ; Amides/isolation & purification* ; Drugs, Chinese Herbal/isolation & purification* ; Fruit/chemistry* ; Molecular Structure ; alpha-Glucosidases/chemistry* ; Chromatography, High Pressure Liquid

The quality of traditional Chinese medicine(TCM) is a critical foundation for ensuring the stability of its efficacy, as well as the safety and effectiveness of its clinical use. The identification of critical quality attributes(CQAs) is one of the core components of TCM preparation quality control. This study focuses on Jianwei Xiaoshi Tablets and explores their CQAs related to property and flavor from the perspective of taste receptor proteins. Three taste receptor proteins, T1R2, T1R3, and TRPV1, were selected, and a biosensor based on high-electron-mobility transistor(HEMT) was constructed to detect the interactions between Jianwei Xiaoshi Tablets and taste receptor proteins. Simultaneously, liquid chromatography-mass spectrometry(LC-MS) technology was used to analyze the chemical composition of Jianwei Xiaoshi Tablets. In examining the interaction strength, the results indicated that the interaction between Jianwei Xiaoshi Tablets and TRPV1 protein was the strongest, followed by T1R3, with the interaction with T1R2 being relatively weaker. By combining biosensing technology with LC-MS, 16 chemical components were identified from Jianwei Xiaoshi Tablets, among which six were selected as CQAs for sweetness and seven for pungency. Further validation experiments demonstrated that CQAs such as hesperidin and hesperetin had strong interactions with their corresponding taste receptor proteins. Through the combined use of multiple technological approaches, this study successfully determined the property and flavor-related CQAs of Jianwei Xiaoshi Tablets. It provides novel ideas and approach for the identification of CQAs in TCM preparations and offers comprehensive theoretical support for TCM quality control, contributing to the improvement and development of TCM preparation quality control systems.
Drugs, Chinese Herbal/chemistry* ; Biosensing Techniques/methods* ; TRPV Cation Channels/chemistry* ; Tablets/chemistry* ; Receptors, G-Protein-Coupled/genetics* ; Quality Control ; Taste ; Humans ; Mass Spectrometry