OBJECTIVE: To explore the molecular mechanism of Shenmai Injection (SMI) against doxorubicin (DOX) induced cardiomyocyte apoptosis. METHODS: A total of 40 specific pathogen-free (SPF) male Sprague Dawley (SD) male rats were divided into 5 groups based on the random number table, including the control group, the model group, miR-30a agomir group, SMI low-dose (SMI-L) group, and SMI high-dose (SMI-H) group, with 8 rats in each group. Except for the control group, the rats were injected weekly with DOX (2 mg/kg) in the tail vein for 4 weeks to induce myocardial injury, and were given different regimens of continuous intervention for 2 weeks. Cardiac function was detected by echocardiography and myocardial pathological changes were observed by Van Gieson (VG) staining. Myocardial injury serum markers, including creatine kinase (CK), lactate dehydrogenase (LDH), troponin T (cTnT), N-terminal pro-brain natriuretic peptide (NT-proBNP), soluble ST2 (sST2), and growth differentiation factor-15 (GDF-15) were detected by enzyme linked immunosorbent assay (ELISA). Cardiomyocyte apoptosis was observed by terminal deoxynucleotidyl transferase-mediated biotinylated dUTP triphosphate nick end labeling (TUNEL) and transmission electron microscopy, and the expressions of target proteins and mRNA were detected by Western blot and quantitative real time polymerase chain reaction (qRT-RCR), respectively. RESULTS: The treatment with different doses of SMI reduced rat heart mass index and left ventricular mass index (P<0.05), significantly improved the left ventricular ejection fraction (P<0.05), decreased the levels of serum CK, LDH, cTnT, and NT-proBNP (P<0.05 or P<0.01), reduced the levels of serum sST2 and GDF-15 (P<0.05 or P<0.01), decreased the collagen volume fraction, reduced the expressions of rat myocardial type I and type III collagen (P<0.05 or P<0.01), and effectively alleviated myocardial fibrosis. And the study found that SMI promoted the expression levels of miR-30a and Bcl-2 in myocardium, and down-regulated the expression of Bax, which inhibited the activation of Caspase-3 and Caspase-9 (P<0.05 or P<0.01), and improved myocardial cell apoptosis. CONCLUSIONS SMI can alleviate myocardial injury and apoptosis caused by DOX, and its mechanism possibly by promoting the targeted expression of myocardial Bcl-2 protein through miR-30a.
Animals ; Myocytes, Cardiac/metabolism* ; Apoptosis/drug effects* ; MicroRNAs/genetics* ; Rats, Sprague-Dawley ; Male ; Drugs, Chinese Herbal/administration & dosage* ; Doxorubicin/pharmacology* ; Proto-Oncogene Proteins c-bcl-2/genetics* ; Drug Combinations ; Injections ; Rats

OBJECTIVE: To evaluate the efficacy and safety of Shexiang Tongxin Dropping Pill (STDP) in treating stable angina patients with phlegm-heat and blood-stasis syndrome by exercise duration and metabolic equivalents. METHODS: This multicenter, randomized, double-blind, placebo-controlled clinical trial enrolled stable angina patients with phlegm-heat and blood-stasis syndrome from 22 hospitals. They were randomized 1:1 to STDP (35 mg/pill, 6 pills per day) or placebo for 56 days. The primary outcome was the exercise duration and metabolic equivalents (METs) assessed by the standard Bruce exercise treadmill test after 56 days of treatment. The secondary outcomes included the total angina symptom score, Chinese medicine (CM) symptom scores, Seattle Angina Questionnaire (SAQ) scores, changes in ST-T on electrocardiogram and adverse events (AEs). RESULTS: This trial enrolled 309 patients, including 155 and 154 in the STDP and placebo groups, respectively. STDP significantly prolonged exercise duration with an increase of 51.0 s, compared to a decrease of 12.0 s with placebo (change rate: -11.1% vs. 3.2%, P<0.01). The increase in METs was significantly greater in the STDP group than in the placebo group (change: -0.4 vs. 0.0, change rate: -5.0% vs. 0.0%, P<0.01). The improvement of total angina symptom scores (25.0% vs. 0.0%), CM symptom scores (38.7% vs. 11.8%), reduction of nitroglycerin consumption (100.0% vs. 11.3%), and all domains of SAQ, were significantly greater with STDP than placebo (all P<0.01). The changes in Q-T intervals at 28 and 56 days from baseline were similar between the two groups (both P>0.05). Twenty-five participants (16.3%) with STDP and 16 (10.5%) with placebo experienced AEs (P=0.131), with no serious AEs observed. CONCLUSION STDP could improve exercise tolerance in patients with stable angina and phlegm-heat and blood stasis syndrome, with a favorable safety profile. (Registration No. ChiCTR-IPR-15006020).
Humans ; Double-Blind Method ; Drugs, Chinese Herbal/adverse effects* ; Male ; Female ; Middle Aged ; Angina, Stable/physiopathology* ; Aged ; Syndrome ; Treatment Outcome ; Placebos ; Tablets

Ovarian tumor (OT) is the most lethal form of gynecologic malignancy, with minimal improvements in patient outcomes over the past several decades. Metastasis is the leading cause of ovarian cancer-related deaths, yet the underlying mechanisms remain poorly understood. Psychological stress is known to activate the glucocorticoid receptor (NR3C1), a factor associated with poor prognosis in OT patients. However, the precise mechanisms linking NR3C1 signaling and metastasis have yet to be fully elucidated. In this study, we demonstrate that chronic restraint stress accelerates epithelial-mesenchymal transition (EMT) and metastasis in OT through an NR3C1-dependent mechanism involving nuclear protein 1 (NUPR1). Mechanistically, NR3C1 directly regulates the transcription of NUPR1, which in turn increases the expression of snail family transcriptional repressor 2 (SNAI2), a key driver of EMT. Clinically, elevated NR3C1 positively correlates with NUPR1 expression in OT patients, and both are positively associated with poorer prognosis. Overall, our study identified the NR3C1/NUPR1 axis as a critical regulatory pathway in psychological stress-induced OT metastasis, suggesting a potential therapeutic target for intervention in OT metastasis.

Image 1.

OBJECTIVE: To investigate the clinical effect of minimally invasive technique in the treatment of moderate and severe gluteal muscle contracture. METHODS: A retrospective study was conducted on 85 patients (170 sides) with bilateral gluteal muscle contracture admitted from January 2016 to December 2019. All patients were treated with minimally invasive release of tendon knife. There were 32 males and 53 females, ranging in age from 15 to 37 years old, with an average age of (22.3±6.3) years old. Operation time, intraoperative blood loss, incision length, first postoperative ambulation time, complication rate, recurrence rate, and Harris hip score (HHS) were analyzed and evaluated. RESULTS: The average follow-up time was (16.2±4.6) months, ranging from 12 to 30 months. The operation time ranged from 7 to 15 min, with an average of (10.2±3.1) min. Intraoperative blood loss ranged from 2 to 20 ml, with an average of (8.4±2.2) ml. The incision length ranged from 0.6 to 2.0 cm, with an average of (0.8±0.3) cm. The time to postoperative ambulation ranged from 12 to 28 h, with an average of (20.0±3.2) h. All patients achieved primary wound healing without sciatic nerve injury or recurrence. HHS hip function scores ranged from 90 to 98, with an average score of (96.2±1.4). Complications included intraoperative tendon blade tip fracture in two cases (removed under fluoroscopic guidance) and subcutaneous hematoma in three cases-two resolved with compression and one with open evacuation.. Twenty-nine patients exhibited transient swaying gait postoperatively, of which 24 patients returned to normal after 4 weeks and 5 patients returned to normal after 6 weeks. CONCLUSION Minimally invasive tendon blade release is a safe and effective technique for treating gluteal muscle contracture, offering minimal trauma, rapid recovery, and excellent cosmetic and functional outcomes. However, it exhibits a low risk of blade tip fracture and sciatic nerve injury, warranting experienced surgical handling.
Humans ; Male ; Female ; Adult ; Minimally Invasive Surgical Procedures/methods* ; Adolescent ; Retrospective Studies ; Buttocks/surgery* ; Young Adult ; Contracture/surgery* ; Tendons/surgery* ; Muscle, Skeletal/surgery*

OBJECTIVE: To construct a prediction model for fracture reduction fixator therapy using the multi-modal multi-label classification (MMC) method. METHODS: Medical record data of 818 orthopedic patients from 2019 to 2023 were collected. Medical image features were extracted using the VGG19 network, text features of TCM four diagnostic methods (Inspection, Auscultation & Olfaction, Inquiry, Palpation) were extracted via the MiniLM model, and clinical case features were extracted through a fully connected neural network. After fusing the multi-modal information, multi-label therapy prediction was achieved using a linear layer. RESULTS: Experimental results on the clinical multi-modal dataset showed that the MMC method performed excellently in terms of subset accuracy(SA), accuracy(Acc), precision, and F₁-score, reaching 0.661, 0.856, 0.897, and 0.899 respectively. When the image modality and text modality were removed, the model performance decreased by an average of 8.1% and 2.4% respectively, while the hamming loss(HL) increased by 21.1% and 5.6% respectively. CONCLUSION The fracture reduction fixator therapy prediction model constructed in this study can effectively fuse multi-modal data, accurately predict personalized treatment plans for patients, and significantly improve the accuracy and reliability of treatment decisions. It provides a new solution for the digitalization and intellectualization of Traditional Chinese Medicine(TCM) in fracture treatment and has important clinical application prospects.
Humans ; Female ; Male ; Middle Aged ; Fracture Fixation/methods* ; Adult ; Fractures, Bone/surgery* ; Neural Networks, Computer ; Medicine, Chinese Traditional ; Aged

To guide clinical blood transfusion practices for pediatric patients, the National Health Commission has issued the health standard "Guideline for pediatric transfusion" (WS/T 795-2022). Blood transfusion is one of the most commonly used supportive treatments for children with hematological diseases. This guideline provides guidance and recommendations for blood transfusions in children with aplastic anemia, thalassemia, autoimmune hemolytic anemia, glucose-6-phosphate dehydrogenase deficiency, acute leukemia, myelodysplastic syndromes, immune thrombocytopenic purpura, and thrombotic thrombocytopenic purpura. This article presents the evidence and interpretation of the blood transfusion provisions for children with hematological diseases in the "Guideline for pediatric transfusion", aiming to assist in the understanding and implementing the blood transfusion section of this guideline.
Humans ; Child ; Hematologic Diseases/therapy* ; Blood Transfusion/standards* ; Practice Guidelines as Topic

OBJECTIVES: To investigate the clinical sub-phenotype (SP) of pediatric acute kidney injury (AKI) and their association with clinical outcomes. METHODS: General status and initial values of laboratory markers within 24 hours after admission to the pediatric intensive care unit (PICU) were recorded for children with AKI in the derivation cohort (n=650) and the validation cohort (n=177). In the derivation cohort, a least absolute shrinkage and selection operator (LASSO) regression analysis was used to identify death-related indicators, and a two-step cluster analysis was employed to obtain the clinical SP of AKI. A logistic regression analysis was used to develop a parsimonious classifier model with simplified metrics, and the area under the curve (AUC) was used to assess the value of this model. This model was then applied to the validation cohort and the combined derivation and validation cohort. The association between SPs and clinical outcomes was analyzed with all children with AKI as subjects. RESULTS: In the derivation cohort, two clinical SPs of AKI (SP1 and SP2) were identified by the two-step cluster analysis using the 20 variables screened by LASSO regression, namely SP_d1 group (n=536) and SP_d2 group (n=114). The simplified classifier model containing eight variables (P<0.05) had an AUC of 0.965 in identifying the two clinical SPs of AKI (P<0.001). The validation cohort was clustered into SP_v1 group (n=156) and SP_v2 group (n=21), and the combined derivation and validation cohort was clustered into SP1 group (n=694) and SP2 group (n=133). After adjustment for confounding factors, compared with the SP1 group, the SP2 group had significantly higher incidence rates of multiple organ dysfunction syndrome and death during the PICU stay (P<0.001), and SP2 was significantly associated with the risk of death within 28 days after admission to the PICU (P<0.001). CONCLUSIONS This study establishes a parsimonious classifier model and identifies two clinical SPs of AKI with different clinical features and outcomes.The SP2 group has more severe disease and worse clinical prognosis.
Humans ; Acute Kidney Injury/diagnosis* ; Prognosis ; Male ; Female ; Child ; Child, Preschool ; Phenotype ; Infant ; Logistic Models ; Adolescent

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test