Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

OBJECTIVE: To investigate the clinical effect of minimally invasive technique in the treatment of moderate and severe gluteal muscle contracture. METHODS: A retrospective study was conducted on 85 patients (170 sides) with bilateral gluteal muscle contracture admitted from January 2016 to December 2019. All patients were treated with minimally invasive release of tendon knife. There were 32 males and 53 females, ranging in age from 15 to 37 years old, with an average age of (22.3±6.3) years old. Operation time, intraoperative blood loss, incision length, first postoperative ambulation time, complication rate, recurrence rate, and Harris hip score (HHS) were analyzed and evaluated. RESULTS: The average follow-up time was (16.2±4.6) months, ranging from 12 to 30 months. The operation time ranged from 7 to 15 min, with an average of (10.2±3.1) min. Intraoperative blood loss ranged from 2 to 20 ml, with an average of (8.4±2.2) ml. The incision length ranged from 0.6 to 2.0 cm, with an average of (0.8±0.3) cm. The time to postoperative ambulation ranged from 12 to 28 h, with an average of (20.0±3.2) h. All patients achieved primary wound healing without sciatic nerve injury or recurrence. HHS hip function scores ranged from 90 to 98, with an average score of (96.2±1.4). Complications included intraoperative tendon blade tip fracture in two cases (removed under fluoroscopic guidance) and subcutaneous hematoma in three cases-two resolved with compression and one with open evacuation.. Twenty-nine patients exhibited transient swaying gait postoperatively, of which 24 patients returned to normal after 4 weeks and 5 patients returned to normal after 6 weeks. CONCLUSION Minimally invasive tendon blade release is a safe and effective technique for treating gluteal muscle contracture, offering minimal trauma, rapid recovery, and excellent cosmetic and functional outcomes. However, it exhibits a low risk of blade tip fracture and sciatic nerve injury, warranting experienced surgical handling.
Humans ; Male ; Female ; Adult ; Minimally Invasive Surgical Procedures/methods* ; Adolescent ; Retrospective Studies ; Buttocks/surgery* ; Young Adult ; Contracture/surgery* ; Tendons/surgery* ; Muscle, Skeletal/surgery*

According to the World Health Organization (WHO) manual, sperm concentration should be measured using an improved Neubauer hemocytometer, while sperm motility should be measured by manual assessment. However, in China, thousands of laboratories do not use the improved Neubauer hemocytometer or method; instead, the Makler counting chamber is one of the most widely used chambers. To study sources of error that could impact the measurement of the apparent concentration and motility of sperm using the Makler counting chamber and to verify its accuracy for clinical application, 67 semen samples from patients attending the Department of Andrology, West China Second University Hospital, Sichuan University (Chengdu, China) between 13 September 2023 and 27 September 2023, were included. Compared with applying the cover glass immediately, delaying the application of the cover glass for 5 s, 10 s, and 30 s resulted in average increases in the sperm concentration of 30.3%, 74.1%, and 107.5%, respectively (all P < 0.0001) and in the progressive motility (PR) of 17.7%, 30.8%, and 39.6%, respectively (all P < 0.0001). However, when the semen specimens were fixed with formaldehyde, a delay in the application of the cover glass for 5 s, 10 s, and 30 s resulted in an average increase in the sperm concentration of 6.7%, 10.8%, and 14.6%, respectively, compared with immediate application of the cover glass. The accumulation of motile sperm due to delays in the application of the cover glass is a significant source of error with the Makler counting chamber and should be avoided.
Humans ; Male ; Sperm Motility/physiology* ; Sperm Count ; Semen Analysis/methods* ; Spermatozoa/physiology* ; Time Factors

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

To guide clinical blood transfusion practices for pediatric patients, the National Health Commission has issued the health standard "Guideline for pediatric transfusion" (WS/T 795-2022). Blood transfusion is one of the most commonly used supportive treatments for children with hematological diseases. This guideline provides guidance and recommendations for blood transfusions in children with aplastic anemia, thalassemia, autoimmune hemolytic anemia, glucose-6-phosphate dehydrogenase deficiency, acute leukemia, myelodysplastic syndromes, immune thrombocytopenic purpura, and thrombotic thrombocytopenic purpura. This article presents the evidence and interpretation of the blood transfusion provisions for children with hematological diseases in the "Guideline for pediatric transfusion", aiming to assist in the understanding and implementing the blood transfusion section of this guideline.
Humans ; Child ; Hematologic Diseases/therapy* ; Blood Transfusion/standards* ; Practice Guidelines as Topic

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test