1.Analysis of the association between the use of oral progesterone drugs in early pregnancy and gestational diabetes mellitus
Yan QIN ; Jinhua GU ; Jing ZHU ; Lin LUO ; Peng PING ; Lingqi GU
China Pharmacy 2025;36(6):721-726
OBJECTIVE To explore the association between the use of oral progesterone drugs in early pregnancy and gestational diabetes mellitus (GDM). METHODS Through real-world retrospective cohort research method, pregnant women who underwent the oral glucose tolerance test (OGTT) at the Affiliated Maternal and Child Health Hospital of Nantong University between January 2022 and January 2023 were enrolled. Based on whether oral progesterone drugs were used in early pregnancy, they were divided into treatment group and control group; propensity score matching (PSM) with a 1∶1 ratio was employed to control for confounding factors; Logistic regression and linear regression were employed to analyze the association between drug factors (whether use of oral progesterone drug, duration of medication, dosage, and drug type) and outcome indicators (occurrence of GDM, fasting blood glucose levels, and OGTT 1 and 2 h blood glucose levels in late pregnancy). RESULTS A total of 709 pregnant women were enrolled in the two groups before PSM; after PSM, 256 cases were included in both the treatment group and the control group. The results of association analysis indicated that there was no significant association between the use of oral progesterone drugs and GDM (P>0.05); but a significant correlation was found with OGTT 1 h blood glucose levels [β=0.965, 95%CI (0.007,1.922), P<0.05], specifically with Dydrogesterone tablets [β=0.977, 95%CI (0.009, 1.944), P<0.05] and Progesterone soft capsules [β =1.089, 95%CI (0.077, 2.102), P<0.05]. There was no significant correlation between other drug factors and outcome indicators (P>0.05). CONCLUSIONS The use of oral progestogen drugs in early pregnancy is not significantly associated with GDM. The blood glucose levels in late pregnancy, especially OGTT 1 h blood glucose levels, have a certain correlation with Progesterone soft capsules and Dydrogesterone tablets.
2.An assessment model for efficacy of autologous CD19 chimeric antigen receptor T-cell therapy and relapse or refractory diffuse large B-cell lymphoma risk.
Bin XUE ; Yifan LIU ; Min ZHANG ; Gangfeng XIAO ; Xiu LUO ; Lili ZHOU ; Shiguang YE ; Yan LU ; Wenbin QIAN ; Li WANG ; Ping LI ; Aibin LIANG
Chinese Medical Journal 2025;138(1):108-110
3.Identification and expression analysis of seed dehydration tolerance and PLD gene family in Panax medicinal plants.
Chao-Lin LI ; Min HUANG ; Na GE ; Qing-Yan WANG ; Jin-Shan JIA ; Ting LUO ; Jin-Yan ZHANG ; Ping ZHOU ; Jun-Wen CHEN
China Journal of Chinese Materia Medica 2025;50(12):3307-3321
Panax species are mostly valuable medicinal plants. While some species' seeds are sensitive to dehydration, the dehydration tolerance of seeds from other Panax species remains unclear. The phospholipase D(PLD) gene plays an important role in plant responses to dehydration stress. However, the characteristics of the PLD gene family and their mechanisms of response to dehydration stress in seeds of Panax species with different dehydration tolerances are not well understood. This study used seeds from eight Panax species to measure the germination rates and PLD activity after dehydration and to analyze the correlation between dehydration tolerance and seed traits. Bioinformatics analysis was also conducted to characterize the PnPLD and PvPLD gene families and to evaluate their expression patterns under dehydration stress. The dehydration tolerance of Panax seeds was ranked from high to low as follows: P. ginseng, P. zingiberensis, P. quinquefolius, P. vietnamensis var. fuscidiscus, P. japonicus var. angustifolius, P. japonicus, P. notoginseng, and P. stipuleanatus. A significant negative correlation was found between dehydration tolerance and seed shape(three-dimensional variance), with flatter seeds exhibiting stronger dehydration tolerance(r=-0.792). Eighteen and nineteen PLD members were identified in P. notoginseng and P. vietnamensis var. fuscidiscus, respectively. These members were classified into five isoforms: α, β, γ, δ, and ζ. The gene structures, subcellular localization, physicochemical properties, and other characteristics of PnPLD and PvPLD were similar. Both promoters contained regulatory elements associated with plant growth and development, hormone responses, and both abiotic and biotic stress. During dehydration, the PLD enzyme activity in P. notoginseng seeds gradually increased as the water content decreased, whereas in P. vietnamensis var. fuscidiscus, PLD activity first decreased and then increased. The expression of PLDα and PLDδ in P. notoginseng seeds initially increased and then decreased, whereas in P. vietnamensis var. fuscidiscus, the expression of PLDα and PLDδ consistently decreased. In conclusion, the dehydration tolerance of Panax seeds showed a significant negative correlation with seed shape. The dehydration tolerance in P. vietnamensis var. fuscidiscus and dehydration sensitivity of P. notoginseng seeds may be related to differences in PLD enzyme activity and the expression of PLDα and PLDδ genes. This study provided the first systematic comparison of dehydration tolerance in Panax seeds and analyzed the causes of tolerance differences and the optimal water content for long-term storage at ultra-low temperatures, thus providing a theoretical basis for the short-term and ultra-low temperature long-term storage of medicinal plant seeds with varying dehydration tolerances.
Seeds/metabolism*
;
Panax/physiology*
;
Plant Proteins/metabolism*
;
Gene Expression Regulation, Plant
;
Phospholipase D/metabolism*
;
Plants, Medicinal/enzymology*
;
Germination
;
Multigene Family
;
Water/metabolism*
;
Dehydration
;
Phylogeny
4.Progress in investigating astrocyte heterogeneity after spinal cord injury based on single-cell sequencing technology.
Lei DU ; Yan-Jun ZHANG ; Tie-Feng GUO ; Lin-Zhao LUO ; Ping-Yi MA ; Jia-Ming LI ; Sheng TAN
China Journal of Orthopaedics and Traumatology 2025;38(5):544-548
In recent years, the study of single-cell transcriptome sequencing technology in the heterogeneity of astrocytes (astrocytes) after spinal cord injury (SCI) has provided new perspectives on post-traumatic nerve regeneration and repair. To provide a review on the research progress of single-cell sequencing technology in astrocytes after spinal cord injury (SCI), and to more comprehensively and deeply elaborate the application of single-cell sequencing technology in the field of astrocytes after SCI. Single-cell sequencing technology can analyse the transcriptomes of individual cells in a high-throughput manner, thus revealing fine differences in cell types and states. By using single-cell sequencing technology, the heterogeneity of astrocytes after SCI and their association with nerve regeneration and repair were revealed. In conclusion, the application of single-cell sequencing technology provides an important tool to reveal the heterogeneity of astrocytes after SCI, to further explore the mechanisms of astrocytes in SCI, and to develop intervention strategies targeting their regulatory mechanisms in order to improve the therapeutic efficacy of SCI. The discovery of changes in astrocyte transcriptome dynamics has improved researchers' understanding of spinal cord injury lesion progression and provided new insights into the treatment of spinal cord injury at different time points. To date, all of these findings need to be validated by more basic research and sufficient clinical trials. In the future, single-cell sequencing technology, through interdisciplinary collaboration with bioinformatics, computer science, tissue engineering, and clinical medicine, is expected to open a new window for the treatment of spinal cord injury.
Spinal Cord Injuries/metabolism*
;
Astrocytes/cytology*
;
Single-Cell Analysis/methods*
;
Humans
;
Animals
;
Transcriptome
;
Nerve Regeneration
5.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
6.Graph Neural Networks and Multimodal DTI Features for Schizophrenia Classification: Insights from Brain Network Analysis and Gene Expression.
Jingjing GAO ; Heping TANG ; Zhengning WANG ; Yanling LI ; Na LUO ; Ming SONG ; Sangma XIE ; Weiyang SHI ; Hao YAN ; Lin LU ; Jun YAN ; Peng LI ; Yuqing SONG ; Jun CHEN ; Yunchun CHEN ; Huaning WANG ; Wenming LIU ; Zhigang LI ; Hua GUO ; Ping WAN ; Luxian LV ; Yongfeng YANG ; Huiling WANG ; Hongxing ZHANG ; Huawang WU ; Yuping NING ; Dai ZHANG ; Tianzi JIANG
Neuroscience Bulletin 2025;41(6):933-950
Schizophrenia (SZ) stands as a severe psychiatric disorder. This study applied diffusion tensor imaging (DTI) data in conjunction with graph neural networks to distinguish SZ patients from normal controls (NCs) and showcases the superior performance of a graph neural network integrating combined fractional anisotropy and fiber number brain network features, achieving an accuracy of 73.79% in distinguishing SZ patients from NCs. Beyond mere discrimination, our study delved deeper into the advantages of utilizing white matter brain network features for identifying SZ patients through interpretable model analysis and gene expression analysis. These analyses uncovered intricate interrelationships between brain imaging markers and genetic biomarkers, providing novel insights into the neuropathological basis of SZ. In summary, our findings underscore the potential of graph neural networks applied to multimodal DTI data for enhancing SZ detection through an integrated analysis of neuroimaging and genetic features.
Humans
;
Schizophrenia/pathology*
;
Diffusion Tensor Imaging/methods*
;
Male
;
Female
;
Adult
;
Brain/metabolism*
;
Young Adult
;
Middle Aged
;
White Matter/pathology*
;
Gene Expression
;
Nerve Net/diagnostic imaging*
;
Graph Neural Networks
7.Rapid Detection of p53 Gene Based on Rolling Circle Amplification and Berberine Hydrochloride
Jing-Yan ZHANG ; Yu-Ping ZHANG ; Lin-Hui XIE ; Hong ZHOU ; Si-Yao LUO ; Ying-Ping LUO
Chinese Journal of Analytical Chemistry 2025;53(5):785-793
In this work,a rapid and label-free sensing platform was designed for visual detection of p53 gene.The rolling circle amplification(RCA)process of the assay platform was activated by p53 gene to produce long DNA-wires,which could bound with berberine hydrochloride(BBH)and further enhanced its fluorescence.This method showed high sensitivity with a low detection limit of 5.63 pmol/L,and high specificity toward p53 gene over other interference materials,even for single-base mutation gene.The method could realize the visual detection of targets under the illumination of a UV lamp.In addition,the designed fluorescence detection platform was successfully applied to p53 gene analysis in 10% fetal bovine serum samples,and the relative standard deviation and the recoveries were 0.1% -1.2% and 99.5% -104.7%,respectively.This approach had satisfactory characteristics,such as low cost,label-free,rapidity,high sensitivity,good selectivity and anti-interference ability,and reliable detection capability for complex practical samples,demonstrating a promising prospect in the diagnosis and treatment of diseases,especially for cancer.
8.Regulatory effect of neutrophils in microglial polarization after permanent ischemic stroke
Min-Hua HUANG ; Xin-Yan YE ; Si-Yu WU ; Shao-Tong LUO ; Zhi-Shan WU ; Yuan CHEN ; Su-Ning PING
Acta Anatomica Sinica 2025;56(2):136-142
Objective To investigate the effects of peripheral blood neutrophil infiltration on the polarization regulation of cerebral resident microglia under a permanent ischemic stroke model.Methods Fifty-eight C57BL/6 mice were divided into two groups.One group was sham group,and the other group of mice was subjected to permanent middle cerebral artery occlusion surgery.Mice were euthanized 48 hours,7 days,14 days,and 30 days after surgery for tissue collection.Western blotting was used to detect expression levels of M1 microglia markers CD 16,M2 microglia marker arginase 1(Arg1),inflammatory cytokine interleukin-1 β(IL-1β),and neutrophil marker myeloperoxidase(MPO)in brain tissue.Immunofluorescence histochemical staining was used to assess neutrophil infiltration and M2 microglial distribution around the infarct area in brain sections.In vitro,purified neutrophils were co-cultured with BV2 microglial cells.After lipopolysaccharide stimulation,the phagocytosis of neutrophils by BV2 cells was observed,and the expression levels of CD16 and Arg1 proteins in BV2 cells were detected.Results Western blotting showed that the levels of CD16(P<0.05),IL-1β(P<0.001),and MPO(P<0.05)in brain tissue increased significantly 48 hours and 7 days after surgery,then decreased,with MPO expression returning to normal levels 30 days after surgery.Immunofluorescence showed a significant increase of MPO-positive cells around the infarct area of the mouse cerebral cortex 48 hours after surgery(P<0.001),followed by a decrease(P<0.05).The number of ionized calcium binding adapter molecule 1(Iba1)and MPO double-positive cells gradually increased after surgery,and reached their peak at 14 days(P<0.05).Iba1 and Arg1 double-positive cells also increased significantly 7 days(P<0.05)and 14 days(P<0.01)after surgery.In vitro,co-culture experiments showed that after BV2 phagocytosing neutrophils,CD 16(P<0.05)significantly decreased and Arg1 significantly upregulated(P<0.05).Conclusion In a permanent ischemic stroke model,microglia transition from M1 to M2 type after phagocytosing neutrophils,and the injured brain area changes from pro-inflammatory state to anti-inflammatory state.
9.Clinical effect of levosimendan combined with recombinant human brain natriuretic peptide in the treatment of acute heart failure
Bo ZHOU ; Changqing YU ; Qingkai YAN ; Ping ZHANG ; Wenping LUO
Chongqing Medicine 2024;53(5):700-706
Objective To study the clinical effect of levosimendan combined with recombinant human brain natriuretic peptide(rhBNP)on patients with acute heart failure.Methods A total of 100 patients with acute heart failure in the hospital from December 2019 to December 2021 were selected as the research sub-jects.According to different treatment options,the subjects were divided into the control group,levosimendan group,rhBNP group and combined treatment group,with 25 cases in each group.The control group received traditional conventional diuretic,tube expansion and other treatment;the levosimendan group was treated with levosimendan on the basis of the control group;the rhBNP group was treated with rhBNP on the basis of the control group;the combined treatment group was treated with levosimendan and rhBNP on the basis of the control group.The improvement of New York Heart Association(NYHA)classification,death,rehospitaliza-tion rate,6-minute walking distance,improvement of serological indicators and adverse reactions were recor-ded in each group.Results Before treatment,there was no significant difference in baseline data between the groups(P>0.05).On the 1 st and 3 rd day after treatment,the improvement of NYHA classification in the combined treatment group was better than that in the other groups(P<0.05),and the improvement of NY-HA classification in the levosimendan group and rhBNP group was better than that in the control group(P<0.05).The readmission rate within 6 months after treatment in the combined treatment group was lower than that in the other groups(P<0.05).At 5 and 9 days after treatment,the 6-minute walking distance in the combined treatment group was longer than that in the other groups(P<0.05).At 9 days after treatment,the left ventricular ejection fraction(LVEF)in the combined treatment group was higher than that in the other groups(P<0.05),and the level of N-terminal B-type natriuretic peptide(NT-proBNP)in the combined treatment group was lower than that in the other groups(P<0.05).No significant difference was found in the comparison of the occurrence of adverse reactions among the four groups(P>0.05).Conclusion The combina-tion of levosimendan and rhBNP in the treatment of patients with acute heart failure is superior to traditional treatment and monotherapy in early clinical improvement,and dose not increase the incidence of adverse reactions.
10.Metabonomic study of blood of mice with high-voltage electrical injury
Si-Yu CHEN ; Hui WANG ; Yan LUO ; Jia-Wen TAO ; Wen-Juan ZHANG ; Yang YUE ; Zheng-Ping YU ; Hui-Feng PI
Journal of Regional Anatomy and Operative Surgery 2024;33(2):100-106
Objective To explore the changes of metabonomics in blood of mice after high-voltage electric shock,then screen out the significantly changed differential metabolites and metabolic pathways.Methods The head of C57BL/6J mice was subjected to high-voltage electric shock(electric shock group)or exposed to acoustic and optical stimulation of high-voltage electric(control group),then the whole blood from mice were collected to separate serum.The dual platform combined metabonomic analysis based on gas chromatography-mass spectrometer(GC-MS)and liquid chromatography-mass spectrometer(LC-MS)was performed and orthogonal partial least squares discriminant analysis(OPLS-DA)was used to screen the differential metabolites and related metabolic pathways.Results A total of 415 differential metabolites were screened out in metabonomics in blood of mice after high-voltage electric shock,including 187 up-regulated and 228 down-regulated metabolites.These differentially metabolites were significantly enriched in metabolic pathways including central carbon metabolism in cancer,glucagon signaling pathway,etc.Conclusion By establishing the model of high-voltage electrical injury on experimental mice,this study reveals the significant change of metabolite content and metabolic pathway in blood by high-voltage electrical injury.Which provides a basis for the damage of blood metabolic activity by high-voltage electrical injury,and suggests the potential harm of high-voltage electrical injury to blood metabolic activity in the whole body.

Result Analysis
Print
Save
E-mail