OBJECTIVE To explore the association between the use of oral progesterone drugs in early pregnancy and gestational diabetes mellitus （GDM）. METHODS Through real-world retrospective cohort research method， pregnant women who underwent the oral glucose tolerance test （OGTT） at the Affiliated Maternal and Child Health Hospital of Nantong University between January 2022 and January 2023 were enrolled. Based on whether oral progesterone drugs were used in early pregnancy， they were divided into treatment group and control group； propensity score matching （PSM） with a 1∶1 ratio was employed to control for confounding factors； Logistic regression and linear regression were employed to analyze the association between drug factors （whether use of oral progesterone drug， duration of medication， dosage， and drug type） and outcome indicators （occurrence of GDM， fasting blood glucose levels， and OGTT 1 and 2 h blood glucose levels in late pregnancy）. RESULTS A total of 709 pregnant women were enrolled in the two groups before PSM； after PSM， 256 cases were included in both the treatment group and the control group. The results of association analysis indicated that there was no significant association between the use of oral progesterone drugs and GDM （P＞0.05）； but a significant correlation was found with OGTT 1 h blood glucose levels [β＝0.965， 95%CI （0.007，1.922）， P＜0.05]， specifically with Dydrogesterone tablets [β＝0.977， 95%CI （0.009， 1.944）， P＜0.05] and Progesterone soft capsules [β ＝1.089， 95%CI （0.077， 2.102）， P＜0.05]. There was no significant correlation between other drug factors and outcome indicators （P＞0.05）. CONCLUSIONS The use of oral progestogen drugs in early pregnancy is not significantly associated with GDM. The blood glucose levels in late pregnancy， especially OGTT 1 h blood glucose levels， have a certain correlation with Progesterone soft capsules and Dydrogesterone tablets.

Schizophrenia (SZ) stands as a severe psychiatric disorder. This study applied diffusion tensor imaging (DTI) data in conjunction with graph neural networks to distinguish SZ patients from normal controls (NCs) and showcases the superior performance of a graph neural network integrating combined fractional anisotropy and fiber number brain network features, achieving an accuracy of 73.79% in distinguishing SZ patients from NCs. Beyond mere discrimination, our study delved deeper into the advantages of utilizing white matter brain network features for identifying SZ patients through interpretable model analysis and gene expression analysis. These analyses uncovered intricate interrelationships between brain imaging markers and genetic biomarkers, providing novel insights into the neuropathological basis of SZ. In summary, our findings underscore the potential of graph neural networks applied to multimodal DTI data for enhancing SZ detection through an integrated analysis of neuroimaging and genetic features.
Humans ; Schizophrenia/pathology* ; Diffusion Tensor Imaging/methods* ; Male ; Female ; Adult ; Brain/metabolism* ; Young Adult ; Middle Aged ; White Matter/pathology* ; Gene Expression ; Nerve Net/diagnostic imaging* ; Graph Neural Networks

Panax species are mostly valuable medicinal plants. While some species' seeds are sensitive to dehydration, the dehydration tolerance of seeds from other Panax species remains unclear. The phospholipase D(PLD) gene plays an important role in plant responses to dehydration stress. However, the characteristics of the PLD gene family and their mechanisms of response to dehydration stress in seeds of Panax species with different dehydration tolerances are not well understood. This study used seeds from eight Panax species to measure the germination rates and PLD activity after dehydration and to analyze the correlation between dehydration tolerance and seed traits. Bioinformatics analysis was also conducted to characterize the PnPLD and PvPLD gene families and to evaluate their expression patterns under dehydration stress. The dehydration tolerance of Panax seeds was ranked from high to low as follows: P. ginseng, P. zingiberensis, P. quinquefolius, P. vietnamensis var. fuscidiscus, P. japonicus var. angustifolius, P. japonicus, P. notoginseng, and P. stipuleanatus. A significant negative correlation was found between dehydration tolerance and seed shape(three-dimensional variance), with flatter seeds exhibiting stronger dehydration tolerance(r=-0.792). Eighteen and nineteen PLD members were identified in P. notoginseng and P. vietnamensis var. fuscidiscus, respectively. These members were classified into five isoforms: α, β, γ, δ, and ζ. The gene structures, subcellular localization, physicochemical properties, and other characteristics of PnPLD and PvPLD were similar. Both promoters contained regulatory elements associated with plant growth and development, hormone responses, and both abiotic and biotic stress. During dehydration, the PLD enzyme activity in P. notoginseng seeds gradually increased as the water content decreased, whereas in P. vietnamensis var. fuscidiscus, PLD activity first decreased and then increased. The expression of PLDα and PLDδ in P. notoginseng seeds initially increased and then decreased, whereas in P. vietnamensis var. fuscidiscus, the expression of PLDα and PLDδ consistently decreased. In conclusion, the dehydration tolerance of Panax seeds showed a significant negative correlation with seed shape. The dehydration tolerance in P. vietnamensis var. fuscidiscus and dehydration sensitivity of P. notoginseng seeds may be related to differences in PLD enzyme activity and the expression of PLDα and PLDδ genes. This study provided the first systematic comparison of dehydration tolerance in Panax seeds and analyzed the causes of tolerance differences and the optimal water content for long-term storage at ultra-low temperatures, thus providing a theoretical basis for the short-term and ultra-low temperature long-term storage of medicinal plant seeds with varying dehydration tolerances.
Seeds/metabolism* ; Panax/physiology* ; Plant Proteins/metabolism* ; Gene Expression Regulation, Plant ; Phospholipase D/metabolism* ; Plants, Medicinal/enzymology* ; Germination ; Multigene Family ; Water/metabolism* ; Dehydration ; Phylogeny

In recent years, the study of single-cell transcriptome sequencing technology in the heterogeneity of astrocytes (astrocytes) after spinal cord injury (SCI) has provided new perspectives on post-traumatic nerve regeneration and repair. To provide a review on the research progress of single-cell sequencing technology in astrocytes after spinal cord injury (SCI), and to more comprehensively and deeply elaborate the application of single-cell sequencing technology in the field of astrocytes after SCI. Single-cell sequencing technology can analyse the transcriptomes of individual cells in a high-throughput manner, thus revealing fine differences in cell types and states. By using single-cell sequencing technology, the heterogeneity of astrocytes after SCI and their association with nerve regeneration and repair were revealed. In conclusion, the application of single-cell sequencing technology provides an important tool to reveal the heterogeneity of astrocytes after SCI, to further explore the mechanisms of astrocytes in SCI, and to develop intervention strategies targeting their regulatory mechanisms in order to improve the therapeutic efficacy of SCI. The discovery of changes in astrocyte transcriptome dynamics has improved researchers' understanding of spinal cord injury lesion progression and provided new insights into the treatment of spinal cord injury at different time points. To date, all of these findings need to be validated by more basic research and sufficient clinical trials. In the future, single-cell sequencing technology, through interdisciplinary collaboration with bioinformatics, computer science, tissue engineering, and clinical medicine, is expected to open a new window for the treatment of spinal cord injury.
Spinal Cord Injuries/metabolism* ; Astrocytes/cytology* ; Single-Cell Analysis/methods* ; Humans ; Animals ; Transcriptome ; Nerve Regeneration

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

In this work,a rapid and label-free sensing platform was designed for visual detection of p53 gene.The rolling circle amplification(RCA)process of the assay platform was activated by p53 gene to produce long DNA-wires,which could bound with berberine hydrochloride(BBH)and further enhanced its fluorescence.This method showed high sensitivity with a low detection limit of 5.63 pmol/L,and high specificity toward p53 gene over other interference materials,even for single-base mutation gene.The method could realize the visual detection of targets under the illumination of a UV lamp.In addition,the designed fluorescence detection platform was successfully applied to p53 gene analysis in 10% fetal bovine serum samples,and the relative standard deviation and the recoveries were 0.1% -1.2% and 99.5% -104.7%,respectively.This approach had satisfactory characteristics,such as low cost,label-free,rapidity,high sensitivity,good selectivity and anti-interference ability,and reliable detection capability for complex practical samples,demonstrating a promising prospect in the diagnosis and treatment of diseases,especially for cancer.

Objective To investigate the effects of peripheral blood neutrophil infiltration on the polarization regulation of cerebral resident microglia under a permanent ischemic stroke model.Methods Fifty-eight C57BL/6 mice were divided into two groups.One group was sham group,and the other group of mice was subjected to permanent middle cerebral artery occlusion surgery.Mice were euthanized 48 hours,7 days,14 days,and 30 days after surgery for tissue collection.Western blotting was used to detect expression levels of M1 microglia markers CD 16,M2 microglia marker arginase 1(Arg1),inflammatory cytokine interleukin-1 β(IL-1β),and neutrophil marker myeloperoxidase(MPO)in brain tissue.Immunofluorescence histochemical staining was used to assess neutrophil infiltration and M2 microglial distribution around the infarct area in brain sections.In vitro,purified neutrophils were co-cultured with BV2 microglial cells.After lipopolysaccharide stimulation,the phagocytosis of neutrophils by BV2 cells was observed,and the expression levels of CD16 and Arg1 proteins in BV2 cells were detected.Results Western blotting showed that the levels of CD16(P＜0.05),IL-1β(P＜0.001),and MPO(P＜0.05)in brain tissue increased significantly 48 hours and 7 days after surgery,then decreased,with MPO expression returning to normal levels 30 days after surgery.Immunofluorescence showed a significant increase of MPO-positive cells around the infarct area of the mouse cerebral cortex 48 hours after surgery(P＜0.001),followed by a decrease(P＜0.05).The number of ionized calcium binding adapter molecule 1(Iba1)and MPO double-positive cells gradually increased after surgery,and reached their peak at 14 days(P＜0.05).Iba1 and Arg1 double-positive cells also increased significantly 7 days(P＜0.05)and 14 days(P＜0.01)after surgery.In vitro,co-culture experiments showed that after BV2 phagocytosing neutrophils,CD 16(P＜0.05)significantly decreased and Arg1 significantly upregulated(P＜0.05).Conclusion In a permanent ischemic stroke model,microglia transition from M1 to M2 type after phagocytosing neutrophils,and the injured brain area changes from pro-inflammatory state to anti-inflammatory state.

AIM To evaluate the quality of Tibetan medicine"Sangdi"based on HPLC fingerprints combined with chemometrics.METHODS The analysis was performed on a 30 ℃ thermostatic Welch Ultimate AQ-C18 column(250 mm × 4.6 mm,5 μm),with the mobile phase comprising of acetonitrile-0.2％phosphoric acid flowing at 1 mL/min in a gradient elution manner,and the detection wavelength was set at 245 nm,after which cluster analysis,principal component analysis and orthogonal partial least squares discriminant analysis were performed,the contents of gentiopicroside,sweroside,mangiferin,isoorientin,8-hydroxy-1,3,5-trimethoxyxanthone(R2)and 1,8-dihydroxy-3,7-dimethoxyxanthone(R3)were determined.RESULTS There were 18 common peaks in the fingerprints for 15 batches of samples with the similarities of more than 0.90.Six constituents showed good linear relationships within their own ranges(R 2 ≥ 0.999 2),whose average recoveries were 96.93％-103.58％with the RSDs of 0.82％-2.9％.Various batches of samples were clustered into 2 categories,4 principal components demonstrated the accumulative variance contribution rate of 86.404％,mangiferin,gentiopicroside and isoorientin were taken as quality difference markers.CONCLUSION This stable,reliable and reproducibe method can provide a reference for the comprehensive quality evaluation of"Sangdi".

AIM To explore the effects of Dahuang Lingxian Recipe on Th1/Th2 cell immune imbalance in a rat model of cholestatic liver fibrosis(CLF).METHODS 20 SD rats were randomly divided into the normal group,the model group,the ursodeoxycholic acid group(0.063 g/kg)and the Dahuang Lingxian Recipe group(4.8 g/kg),with 5 rats in each group.Except for those of the normal group,the rats of all other groups had open surgery of common bile duct ligation,followed by the gavage of corresponding drug two days later,and the procurement of the samples after gavage in the third week.The rats had their degree of liver fibrosis observed by HE and Masson stainings;their levels of serum total bile acid(TBA),alkaline phosphatase(AKP),γ-glutamyltransferase(γ-GT),alanine aminotransferase(ALT),aspartate aminotransferase(AST)and total bilirubin(TBil)measured by the kit;their hepatic percentage of TGF-β1,p-Smad2 and p-Smad3 positive cells detected by immunofluorescence and immunohistochemical staining;their.hepatic expressions of TGF-β1,Smad4,NF-κB p65,Collagen Ⅰ and Collagen Ⅲ protein and mRNA detected by Western blot and RT-qPCR;their levels of helper T cell 1(Th1)and helper T cell 2(Th2)in peripheral blood detected by flow cytometry,and their ratio of Th1/Th2 calculated as well.RESULTS Compared with the model group,the groups intervened with either ursodeoxycholic acid or Dahuang Lingxian Recipe displayed well-ordered liver cells,hepatic lobules and hepatic cords;a small amount of fatty degeneration;significantly reduced connective hyperplasia of hepatic fibers;significantly narrowed fibrous cords;a small amount of blue fibrous septa;greatly improved pathological injuries including inflammatory infiltration of central vein and portal area;decreased levels of serum TBA,TBil,AKP,γ-GT,ALT and AST(P＜0.05);decreased hepatic expressions of TGF-β1,p-Smad2 and p-Smad3(P＜0.05);decreased hepatic expressions of TGF-β1,Smad4,NF-κB p65,Collagen Ⅰ and Collagen Ⅲ protein and mRNA(P＜0.05);and increased counts of Th1 cells in peripheral blood,decreased counts of Th2 cells,resultsing increased Th1/Th2 ratio(P＜0.05).And an even better effect was observed in the Dahuang Lingxian Recipe group.CONCLUSION Dahuang Lingxian Recipe can reduce or reverse CLF by inhibiting hepatic stellate cell activation through maintaining Th1/Th2 cell immune balance via the NF-κB/TGF-β1 signaling pathway.