This study explores whether the current external quality assessment (EQA) level and acceptable bias for basic semen analysis in China are clinically useful. We collected data of semen EQA from Andrology laboratories in the Hunan Province (China) in 2022 and searched for data in the published literature from January 2000 to December 2023 in China. On the basis of these data, we analyzed the coefficients of variation and acceptable biases of different quality control materials for basic semen analysis through robust statistics. We compared these findings with quality specifications based on biological variation from optimal, desirable, and minimum levels of bias to seek a unified and more suitable semen EQA bias evaluation standard for China's national conditions. Different sources of semen quality control material exhibited considerable variation in acceptable biases among laboratories, ranging from 8.2% to 56.9%. A total of 50.0% of the laboratories met the minimum quality specifications for progressive motility (PR), whereas 100.0% and 75.0% of laboratories met only the minimum quality specifications for sperm concentration and total motility (nonprogressive [NP] + PR), respectively. The Z value for sperm concentration and PR+NP was equivalent to the desirable performance specification, whereas the Z value for PR was equivalent only to the minimum performance specification. This study highlights the feasibility of operating external quality assessment schemes for basic semen analysis using quality specifications based on biological variation. These specifications should be unified among external quality control (EQC) centers based on biological variation.
Semen Analysis/standards* ; Humans ; China ; Male ; Quality Control ; Sperm Motility ; Sperm Count/standards*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To investigate the molecular epidemiology of children with phenylketonuria (PKU) in Gansu, China, providing foundational data for intervention strategies. METHODS: A retrospective analysis was conducted on 1 159 PKU families who attended Gansu Provincial Maternity and Child Care Hospital from January 2012 to December 2024. Sanger sequencing, multiplex ligation-dependent probe amplification, whole exome sequencing, and deep intronic variant analysis were used to analyze the PAH gene. RESULTS: For the 1 159 children with PKU, 2 295 variants were identified in 2 318 alleles, resulting in a detection rate of 99.01%. The detection rates were 100% (914/914) in 457 classic PKU families, 99.45% (907/912) in 456 mild PKU families, and 96.34% (474/492) in 246 mild hyperphenylalaninemia families. The 2 295 variants detected comprised 208 distinct mutation types, among which c.728G>A (14.95%, 343/2 295) had the highest frequency, followed by c.611A>G (4.88%, 112/2 295) and c.721C>T (4.79%, 110/2 295). The cumulative frequency of the top 23 hotspot variants reached 70.28% (1 613/2 295), and most variant alleles were detected in exon 7 (29.19%, 670/2 295). CONCLUSIONS Deep intronic variant analysis of the PAH gene can improve the genetic diagnostic rate of PKU. The development of targeted detection kits for PAH hotspot variants may enable precision screening programs and enhance preventive strategies for PKU.
Humans ; Phenylketonurias/epidemiology* ; Female ; Male ; Retrospective Studies ; Phenylalanine Hydroxylase/genetics* ; Mutation ; Child, Preschool ; China/epidemiology* ; Child ; Infant

OBJECTIVE: To explore the clinical significance of circulating tumor DNA (ctDNA) in response evaluation and relapse monitoring for patients with primary mediastinal large B-cell lymphoma (PMBCL). METHODS: The clinical characteristics, efficacy and survival of 38 PMBCL patients in our hospital from January 2010 to April 2020 were retrospectively analyzed. The ctDNA monitoring was conducted by targeted next-generation sequencing (NGS). RESULTS: Among the 38 patients, 26 cases were female, and 32 cases were diagnosed with Ann Arbor stage I-II. The 5-year overall survival (OS) rate and progression-free survival (PFS) rate were 74.7% and 61.7%, respectively. Males and those with high aaIPI scores (3 points) had a relatively poor prognosis. The NGS results of 23 patients showed that STAT6 (65.2%), SOCS1 (56.5%), and TNFAIP3 (56.5%) were the most common mutated genes. Patients with stable disease (SD)/progressive disease (PD) exhibited enrichment in cell cycle, FoxO, and TNF signaling pathways. A total of 29 patients underwent end-of-treatment PET/CT (EOT PET/CT), and 16 of them received ctDNA monitoring with 12 negative. Among 6 patients with EOT PET/CT positive (Deauville 4), 4 underwent ctDNA monitoring, and 3 of them were negative, being still in continuous remission without any subsequent anti-tumor therapy. CONCLUSION CtDNA may be combined with PET/CT to assess efficacy, monitor relapse, and guide treatment of PMBCL.
Humans ; Circulating Tumor DNA/blood* ; Female ; Mediastinal Neoplasms ; Male ; Retrospective Studies ; High-Throughput Nucleotide Sequencing ; Prognosis ; Lymphoma, Large B-Cell, Diffuse/genetics* ; Middle Aged ; Adult ; Aged ; Neoplasm Recurrence, Local ; Mutation

Ischemic stroke (IS) is a globally life-threatening disease. Presently, few therapeutic medicines are available for treating IS, and rt-PA is the only drug approved by the US Food and Drug Administration (FDA) in the US. In fact, many agents showing excellent neuroprotection but no blood flow-improving activity in animals have not achieved ideal clinical efficacy, while thrombolytic drugs only improving blood flow without neuroprotection have limited their wider application. To address these challenges and meet the huge unmet clinical need, we have designed and identified a novel compound AAPB with dual effects of neuroprotection and cerebral blood flow improvement. AAPB significantly reduced cerebral infarction and neural function deficit in tMCAO rats, pMCAO rats, and IS rhesus monkeys, as well as displayed exceptional safety profiles and excellent pharmacokinetic properties in rats and dogs. AAPB has now entered phase I of clinical trials fighting IS in China.

Cemental tear is a rare and indetectable condition unless obvious clinical signs present with the involvement of surrounding periodontal and periapical tissues. Due to its clinical manifestations similar to common dental issues, such as vertical root fracture, primary endodontic diseases, and periodontal diseases, as well as the low awareness of cemental tear for clinicians, misdiagnosis often occurs. The critical principle for cemental tear treatment is to remove torn fragments, and overlooking fragments leads to futile therapy, which could deteriorate the conditions of the affected teeth. Therefore, accurate diagnosis and subsequent appropriate interventions are vital for managing cemental tear. Novel diagnostic tools, including cone-beam computed tomography (CBCT), microscopes, and enamel matrix derivatives, have improved early detection and management, enhancing tooth retention. The implementation of standardized diagnostic criteria and treatment protocols, combined with improved clinical awareness among dental professionals, serves to mitigate risks of diagnostic errors and suboptimal therapeutic interventions. This expert consensus reviewed the epidemiology, pathogenesis, potential predisposing factors, clinical manifestations, diagnosis, differential diagnosis, treatment, and prognosis of cemental tear, aiming to provide a clinical guideline and facilitate clinicians to have a better understanding of cemental tear.
Humans ; Dental Cementum/injuries* ; Consensus ; Diagnosis, Differential ; Cone-Beam Computed Tomography ; Tooth Fractures/therapy*

Metachromatic leukodystrophy (MLD) is an inherited disease caused by a deficiency of the enzyme arylsulfatase A (ARSA). Lentivirus-modified autologous hematopoietic stem cell gene therapy (HSCGT) has recently been approved for clinical use in pre and early symptomatic children with MLD to increase ARSA activity. Unfortunately, this advanced therapy is not available for most patients with MLD who have progressed to more advanced symptomatic stages at diagnosis. Patients with late-onset juvenile MLD typically present with a slower neurological progression of symptoms and represent a significant burden to the economy and healthcare system, whereas those with early onset infantile MLD die within a few years of symptom onset. We conducted a pilot study to determine the safety and benefit of HSCGT in patients with postsymptomatic juvenile MLD and report preliminary results. The safety profile of HSCGT was favorable in this long-term follow-up over 9 years. The most common adverse events (AEs) within 2 months of HSCGT were related to busulfan conditioning, and all AEs resolved. No HSCGT-related AEs and no evidence of distorted hematopoietic differentiation during long-term follow-up for up to 9.6 years. Importantly, to date, patients have maintained remarkably improved ARSA activity with a stable disease state, including increased Functional Independence Measure (FIM) score and decreased magnetic resonance imaging (MRI) lesion score. This long-term follow-up pilot study suggests that HSCGT is safe and provides clinical benefit to patients with postsymptomatic juvenile MLD.
Humans ; Leukodystrophy, Metachromatic/genetics* ; Pilot Projects ; Genetic Therapy/methods* ; Hematopoietic Stem Cell Transplantation ; Male ; Follow-Up Studies ; Female ; Lentivirus/genetics* ; Child ; Child, Preschool ; Hematopoietic Stem Cells/metabolism* ; Cerebroside-Sulfatase/metabolism* ; Adolescent

Nanoparticle delivery systems have good application prospects in the field of precision therapy, but the preparation process of nanomaterial has problems such as short in vivo circulation time, easy recognition, and clearance by the immune system in the body. In recent years, biomimetic nanoparticle delivery systems mediated by natural cell membranes have become a research hotspot to address these issues. The natural membrane biomimetic nanoparticle delivery system cleverly integrates the advantages of natural biofilm "autologous" and "artificial" functional carriers by using endogenous cell membranes to modify the surface of nanocarriers, endowing them with characteristics such as tumor targeting, low immunogenicity, and long blood circulation. Currently, biomimetic nanoparticle delivery systems have been used in the treatment of malignant tumors, cardiovascular diseases, bacterial infections, and other diseases. This paper analyzes the development status and current research hotspots of natural cell membrane camouflaged biomimetic nanoparticle delivery systems mainly reviews the latest research progress of red blood cell membrane camouflaged biomimetic nanoparticle delivery systems in the field of disease treatment in recent years. It focuses on exploring the advantages, future development prospects, and limitations of biomimetic nanoparticle delivery systems based on red blood cell membrane camouflage in improving drug delivery, to provide a reference for the in-depth research and development of this system.