Background: and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking. Methods: This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance. Results: Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal. Conclusions The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.

Background: and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking. Methods: This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance. Results: Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal. Conclusions The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.

Background: and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking. Methods: This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance. Results: Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal. Conclusions The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.

Abelmoschi Corolla, the dried corolla of Abelmoschus manihot, has anti-inflammatory, antioxidant, and anti-fibrosis activities. Its chemical constituents mainly include flavonoids, organic acids, steroids, and polysaccharides. This study reviewed the research progress in the chemical constituents and pharmacological activities of Abelmoschi Corolla in recent 20 years. According to the concept of quality marker(Q-marker), the Q-markers of Abelmoschi Corolla were predicted from plant phylogeny, chemical constituent specificity, traditional efficacy, chemical constituent measurability, and absorbed constituents. The primary Q-markers for Abelmoschi Corolla were anticipated to include quercetin-3'-O-β-D-glucopyranoside, gossypetin-8-O-β-D-glucuronide, isoquercetin, myricetin,quercetin, and hyperoside, with the aim of providing reference data for improving the quality evaluation system of Abelmoschi Corolla.
Abelmoschus/chemistry* ; Drugs, Chinese Herbal/pharmacology* ; Flowers/chemistry* ; Humans ; Animals ; Quality Control ; Flavonoids/chemistry*

Chaihu and Longgu Muli Decoction has demonstrated significant efficacy in the treatment of tachyarrhythmia accompanied by anxiety and depression. However, there is a lack of standardized guidelines for its clinical application. In this study, the Chaihu and Longgu Muli Decoction was investigated through extensive research on ancient and modern literature, as well as a collection of clinical medical records. The basic information, medication details, and diagnostic information from medical records, personal experience literature, and clinical cases in the treatment of tachyarrhythmia accompanied by anxiety were extracted and analyzed to preliminarily identify the prescription characteristics and syndrome patterns. Subsequently, the Delphi method was employed to construct an item pool based on the data obtained in the first step. An expert questionnaire was prepared to collect scores and revision opinions from experts regarding these items. After statistical analysis and group discussions, a second round of questionnaires was formed by screening out certain items. This process was repeated until a final item set for the treatment of tachyarrhythmia accompanied by anxiety with Chaihu and Longgu Muli Decoction was determined. These findings provided guidance for clinical prescription practices. By extracting 71 syndromes and signs, as well as 33 tongue and pulse characteristics, the main syndrome features included palpitations, chest tightness, irritability, etc., which were basically consistent with the ancient syndromes. Through frequency analysis and group discussions, 71 items were screened out. After screening, modification, and primary and secondary division, 11 main diagnostic items and 10 secondary diagnostic items were determined. On this basis, the research team believes that Chaihu and Longgu Muli Decoction is mainly indicated for the following syndromes in the treatment of tachyarrhythmia accompanied by anxiety(palpitations, poor sleep, bitter taste, dry mouth, irritability/easily angered/anxiety/fearfulness/easily startled, red tongue with greasy yellow coating, rapid pulse, high work/life pressure, tachyarrhythmia on electrocardiogram/Holter monitor, and positive results on anxiety scale). Secondary syndromes include chest tightness, shortness of breath, feeling heavy and weak in the body, sweating, poor appetite, constipation, greasy white tongue coating, wiry pulse, slippery pulse, or knotted and intermittent pulse.
Drugs, Chinese Herbal/therapeutic use* ; Humans ; Delphi Technique ; Anxiety/complications* ; Tachycardia/psychology* ; Female ; Male ; Middle Aged ; Adult ; Aged

This study aimed to explore the effects and mechanisms of total extracts from Anthriscus sylvestris on pulmonary hypertension in rats. Sixty male SD rats were divided into normal(NC) group, model(M) group, positive drug sildenafil(Y) group, low-dose A. sylvestris(ES-L) group, medium-dose A. sylvestris(ES-M) group, and high-dose A. sylvestris(ES-H) group. On day 1, rats were intraperitoneally injected with monocrotaline(60 mg·kg~(-1)) to induce pulmonary hypertension, and the rat model was established on day 28. From days 15 to 28, intragastric administration of the respective treatments was performed. After modeling and treatment, small animal echocardiography was used to detect the right heart function of the rats. Arterial blood gas was measured using a blood gas analyzer. Hematoxylin and eosin(HE) staining and Masson staining were performed to observe cardiopulmonary pathological damage. Flow cytometry was used to detect apoptosis in the lung and myocardial tissues and reactive oxygen species(ROS) levels. Western blot was applied to detect the expression levels of transforming growth factor-β1(TGF-β1), phosphorylated mothers against decapentaplegic homolog 3(p-Smad3), Smad3, tissue plasminogen activator(t-PA), and plasminogen activator inhibitor-1(PAI-1) in lung tissue. A blood routine analyzer was used to measure inflammatory immune cell levels in the blood. Enzyme-linked immunosorbent assay(ELISA) was used to detect the expression levels of P-selectin and thromboxane A2(TXA2) in plasma. The results showed that, compared with the NC group, right heart hypertrophy index, right ventricular free wall thickness, right heart internal diameter, partial carbon dioxide pressure(PaCO_2), apoptosis in cardiopulmonary tissue, and ROS levels were significantly increased in the M group. In contrast, the ratio of pulmonary blood flow acceleration time(PAT)/ejection time(PET), right cardiac output, change rate of right ventricular systolic area, systolic displacement of the tricuspid ring, oxygen partial pressure(PaO_2), and blood oxygen saturation(SaO_2) were significantly decreased in the M group. After administration of the total extract of A. sylvestris, right heart function and blood gas levels were significantly improved, while apoptosis in cardiopulmonary tissue and ROS levels significantly decreased. Further testing revealed that the total extract of A. sylvestris significantly decreased the levels of interleukin-1β(IL-1β), interleukin-6(IL-6), and PAI-1 proteins in lung tissue, while increasing the expression of t-PA. Additionally, the extract reduced the levels of inflammatory cells such as leukocytes, lymphocytes, granulocytes, and monocytes in the blood, as well as the levels of P-selectin and TXA2 in plasma. Metabolomics results showed that the total extract of A. sylvestris significantly affected metabolic pathways, including arginine biosynthesis, tyrosine metabolism, and taurine and hypotaurine metabolism. In conclusion, the total extract of A. sylvestris may exert an anti-pulmonary hypertension effect by inhibiting the TGF-β1/Smad3 signaling pathway, thereby alleviating immune-inflammatory responses and thrombosis.
Animals ; Male ; Smad3 Protein/metabolism* ; Transforming Growth Factor beta1/metabolism* ; Rats, Sprague-Dawley ; Rats ; Signal Transduction/drug effects* ; Hypertension, Pulmonary/genetics* ; Thrombosis/immunology* ; Drugs, Chinese Herbal/administration & dosage* ; Humans ; Apoptosis/drug effects*

Qing court records show that Arecae Semen was extensively applied. The royal medical records of the Qing Dynasty document nine types of Arecae Semen, with the Palace Museum preserving seven kinds, totaling twelve cultural relics. Historical documents and physical artifacts corroborate each other, providing evidence for the study of the supply channels and court processing of Arecae Semen in the Qing court. According to relevant Qing court archival records, the sources of Arecae Semen used in the imperial court were diverse, including tributes from foreign countries such as Vietnam and Gurkha, annual tributes from local governments in Guangdong, gifts from close aides, and commodities purchased by the Imperial Household Department from civilian shops. The imperial physicians of the Qing court placed great emphasis on the specifications of Arecae Semen slices and were extremely meticulous about their processing. The variety of Arecae Semen slices used in the Qing palace exceeded those recorded in the botanical texts of the era. Compared with the commonly used processing methods for Arecae Semen in the Qing Dynasty, the imperial physicians adjusted the properties and efficacy of the herbs through different processing techniques, based on the patient's condition, constitution, and other factors, in order to meet the clinical treatment needs of the court. The slicing of Arecae Semen in the Qing court required strict control of thickness, with an average thickness of 0.44 mm, which is significantly thinner than the Arecae Semen slices found in today's markets. The texture was softer, making them easier to chew and absorb. Both the Qing court Arecae Semen slices and the Muxiang Binglang Pills focused on the use of authentic medicinal materials, ensuring the quality of the medicine and enhancing the efficacy of Arecae Semen through meticulous selection and preparation.
China ; Drugs, Chinese Herbal/history* ; Humans ; Medicine, Chinese Traditional/history* ; History, 19th Century ; History, Ancient ; History, 17th Century ; History, 18th Century

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To explore the construction method of a resistant multiple myeloma (MM) patient-derived xenotransplantation (PDX) model. METHODS: 1.0×10⁷ MM patient-derived mononuclear cells (MNCs), 2.0×10⁶ MM.1S cells and 2.0×10⁶ NCI-H929 cells were respectively subcutaneously inoculated into NOD.CB17-Prkdc^scid Il2rg^tm1/Bcgen (B-NDG) mice with a volume of 100 μl per mouse to establish mouse model. The morphologic, phenotypic, proliferative and genetic characteristics of PDX tumor were studied by hematoxylin-eosin staining, immunohistochemical staining (IHC), cell cycle analysis, flow cytometry and fluorescence in situ hybridization (FISH). The sensitivity of PDX tumor to bortezomib and anlotinib monotherapy or in combination was investigated through cell proliferation, apoptosis and in vitro and in vivo experiments. The effects of anlotinib therapy on tumor blood vessel and cell apoptosis were analyzed by IHC, TUNEL staining and confocal fluorescence microscope. RESULTS: MM PDX model was successfully established by subcutaneously inoculating primary MNCs. The morphologic features of tumor cells from MM PDX model were similar to those of mature plasma cells. MM PDX tumor cells positively expressed CD138 and CD38, which presented 1q21 amplification, deletion of Rb1 and IgH rearrangement, and had a lower proliferative activity than MM cell lines. in vitro, PDX, MM.1S and NCI-H929 cells were treated by bortezomib and anlotinib for 24 hours, respectively. Cell viability assay showed that the IC₅₀ value of bortezomib were 5 716.486, 1.025 and 2.775 nmol/L, and IC₅₀ value of anlotinib were 5 5107.337, 0.706 and 5.13 μmol/L, respectively. Anlotinib treatment increased the apoptosis of MM.1S cells (P < 0.01), but did not affect PDX tumor cells (P >0.05). in vivo, there was no significant difference in PDX tumor growth between bortezomib monotherapy group and control group (P >0.05), while both anlotinib monotherapy and anlotinib combined with bortezomib effectively inhibited PDX tumor growth (both P < 0.05). The vascular perfusion and vascular density of PDX tumor were decreased in anlotinib treatment group (both P < 0.01). The apoptotic cells in anlotinib treatment group were increased compared with those in control group (P < 0.05). CONCLUSION Bortezomib-resistant MM PDX model can be successfully established by subcutaneous inoculation of MNCs from MM patients in B-NDG mice. This PDX model, which retains the basic biological characteristics of MM cells, can be used to study the novel therapies.
Animals ; Bortezomib ; Humans ; Multiple Myeloma/pathology* ; Mice ; Apoptosis ; Drug Resistance, Neoplasm ; Cell Line, Tumor ; Xenograft Model Antitumor Assays ; Mice, Inbred NOD ; Disease Models, Animal ; Cell Proliferation ; Transplantation, Heterologous