Objective To investigate the association between physical activity levels and blood lipids among college freshmen, and to provide scientific evidence for the health management of college freshmen. Methods An electronic questionnaire survey on physical activity was conducted on freshmen of a university, and fasting blood biochemical indicators were detected. The International Physical Activity Questionnaire (IPAQ) short form was used to evaluate the physical activity levels of the participants. Dyslipidemia was defined as an abnormality in any one of the following serum lipid parameters: total cholesterol, triglycerides, low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), or non-high-density lipoprotein cholesterol. Binary logistic regression and stratified analyses were employed to explore the relationship between physical activity and blood lipids. Results A total of 3 401 participants were included, with an average age of 18.45 ± 0.92 years, and 60.5% were female. The prevalence of dyslipidemia was 17.7%, with a higher rate among males (22.1%) than females (14.8%). After adjusting for confounding factors related to blood lipids, high-intensity physical activity was negatively associated with the risk of elevated LDL-C among males (OR = 0.36, 95% CI: 0.13–0.99, P = 0.049). Conclusion Among freshmen at a medical college in Hubei Province, high-intensity physical activity is negatively associated with the risk of elevated LDL-C in males, but this association needs to be further confirmed by larger prospective cohort studies.

Objective To gain insights into the biological characteristics of different populations of Culex tritaeniorhynchus within and around the Yellow Sea wetland from the perspective of the occurrence of resistance, we investigated the levels of resistance to deltamethrin and kdr gene mutation in the wetland and its peripheral areas. Methods Specimens were collected from Cx. tritaeniorhynchus populations at two monitoring sites in the Rare Bird National Nature Reserve and Tiaozi Ni Wetland Scenic Area, and also from two populations in Yancheng City and the Liuhe District of Nanjing, and the resistance of these mosquitoes to deltamethrin was determined using the CDC biotest bottle method. For each concentration of deltamethrin assessed, a random subset of exposed specimens was selected for amplification of the kdr gene fragment, followed by Sanger sequencing to identify and analyze resistance-associated mutations. Results The LC50 levels of deltamethrin among mosquitoes from the four populations in Luhe, Yancheng, the Rare Bird National Nature Reserve and the Tiaozi Ni Wetland Scenic Area were 2.048 5, 7.798 2, 3.473 3, and 17.695 5 mg/mL, respectively, with corresponding concentrations of deltamethrin ranging from 0.005 to 5.000,0.050 to 50.000,0.050 to 25.000 and 0.050 to 50.000 mg/mL, respectively. Furthermore, the ranges of the KT50 values were 11.76-107.43, 67.05-216.30,29.77-107.43 and 28.40-329.51 min; the 1-h knockdown rates were 34.58%-99.15%, 9.52%-43.80%, 55.09%-73.01%, and 10.09%-68.07%; and the 24-h mortality rates were 12.15%-67.52%,9.52%-79.56%,13.17%-82.21%, and 11.01%-78.99%, respectively. With respect to kdr gene mutation, we assayed a total of 63,70,59, and 57 mosquitoes for the four populations, for which we detected L1014F mutation frequencies of 14.29%, 35.00%, 20.34%, and 31.58%, respectively, with a majority of these mutations being heterozygous for resistance. In addition, five adult mosquitoes were identified has having synonymous mutations at site 1011[i. e. , AAT(asparagine)mutation to AAC(asparagine)]. Conclusions Our findings revealed the clear resistance of Cx. tritaeniorhynchus to deltamethrin in the Yancheng region of the Yellow Sea wetland, and the resistance phenotype and kdr frequency of Cx. tritaeniorhynchus in the wetland environment were comparable to those of Cx. tritaeniorhynchus in the wetland environment, thereby indicating that the resistance of different populations of Cx. tritaeniorhynchus was homogeneous under the pressure of different insecticide selection within and around the wetland. However, the underlying mechanisms need to be further studied.

Objective: To investigate the longitudinal associations between dietary patterns in early childhood and myopia among children, so as to provide evidence for improving early childhood dietary patterns and promoting healthy ocular development among children. Methods: Participants were derived from the Ma-anshan Birth Cohort (MABC). A total of 1 432 children were included. Dietary patterns at 2.5 years of age were collected in 2017 using a food frequency questionnaire completed by parents. In 2022, cycloplegic refraction and ocular biometric parameters were measured in children aged 7-8 years. Food components were grouped into tertiles ( T1-T 3), and latent class analysis (LCA) was used to identify dietary pattern at the age of 2.5. Log-binomial regression and multiple linear regression model were applied to examine the associations of dietary patterns and their latent classes with myopia, spherical equivalent (SE), and axial length (AL). Results: The prevalence of myopia among children was 23.9%. After adjusting for covariates, the T 2 group of cereals and tubers was negatively associated with myopia rate ( RR=0.72, 95%CI =0.57-0.90) and AL ( β=-0.15, 95%CI =-0.24 to -0.05), and positively associated with SE ( β=0.21, 95%CI =0.06-0.35)(all P ＜0.05). Linear regression models showed that the T 2 group of fruits and vegetables was positively associated with AL ( β=0.09, 95%CI =0.00- 0.19 ); the T 3 group of high sugar foods ( β=0.11, 95%CI =0.00-0.21) and the T 3 group of processed foods ( β= 0.10 , 95%CI =0.00-0.19) were positively associated with AL; total scores for high sugar foods ( β=0.07, 95%CI =0.00-0.14) and processed foods ( β=0.09, 95%CI =0.01-0.17) were positively associated with AL (all P <0.05). After adjusting for sex, age, and parental myopia, the comprehensive high intake pattern was positively associated with AL ( β=0.12, 95%CI =0.00-0.23, P <0.05). After further adjusting for daily screen time and daily outdoor activity time, the association was no longer statistically significant ( β= 0.11 , 95%CI =-0.00-0.23, P >0.05). Conclusions Moderate consumption of cereals and tubers in early childhood may reduce the risk of myopia and delay AL growth. In contrast, high sugar and highly processed diets may promote AL and increase myopia risk. Establishing healthy dietary habits in early childhood and limiting intake of high sugar and processed foods is crucial for promoting ocular development in children.

Objective To investigate the influencing factors of advanced bone age in early adolescence, and to provide a scientific basis for the early identification of children and adolescents with abnormal bone age development. Methods A prospective cohort study design was adopted. From July 2022 to September 2023, height, weight, and body composition data of children were collected, with the baseline age of the study participants being 8.42±0.50 years. Subsequently, from March 2024 to November 2025, these children in the cohort were followed up and their bone age development was monitored. In the end, a total of 1142 participants with complete data were included in the study. Results In early adolescence, there were 239 individuals (20.93%) with early bone age development and 103 (9.02%) with delayed development. The proportion of early bone age development was higher among individuals whose mothers had gestational hypertension during pregnancy, and the difference was statistically significant (χ²=8.90, P<0.05). The proportion of early bone age development was higher among boys, and the difference was statistically significant (χ²=41.69, P＜0.001). Disordered multiclass logistic regression analysis showed that after adjusting for demographic factors, overweight (OR=2.65, 95%CI:1.81-3.88), obesity (OR=6.51, 95%CI: 4.45-9.53), and excessive body fat percentage (OR=4.60, 95% CI: 3.01-7.03) were associated with an increased risk of early bone age development in children and adolescents. Conclusion Being overweight/obese and having an excessive body fat percentage can increase the risk of early bone age development in adolescents.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To explore the preventive and therapeutic effects of Dahuang Zhechong Pill (DZP) on pulmonary fibrosis and the underlying mechanisms. METHODS: The first key rate-limiting enzyme hexokinase 2 (HK2) of glycolysis was silenced and over-expressed through small interfering RNA and lentivirus using lung fibroblast MRC-5 cell line, respectively. The cell viability, migration, invasion and proliferation were detected by cell counting kit-8, wound healing assay, transwell assay, and flow cytometry. The mRNA and protein expression levels of HK2 were detected by RT-PCR and Western blotting, respectively. The contents of glucose, adenosine triphosphate (ATP) and lactate in MRC-5 cells were determined by enzyme-linked immunosorbnent assay (ELISA). Then, the relationship between miR-29b-2-5p and HK2 was explored by luciferase reporter gene assay. Pulmonary fibrosis cell model was induced by transforming growth factor-β 1 (TGF-β 1) in MRC-5 cells, and the medicated serum of DZP (DMS) was prepared in rats. MRC-5 cells were divided into control, TGF-β 1, TGF-β 1+10% DMS, TGF-β 1+10% DMS+miR-29b-2-5p inhibitor, TGF-β 1+10% DMS+inhibitor negative control, TGF-β 1+10% DMS+miR-29b-2-5p mimic and TGF-β 1+10% DMS+mimic negative control groups. After miR-29b-2-5p mimics and inhibitors were transfected into MRC-5 cells, all groups except control and model group were treated with DMS. The effect of DMS on MRC-5 cells were detected using aforementioned methods and immunofluorescence. Similarly, the contents of glucose, ATP and lactate in each group were measured by ELISA. RESULTS: The mRNA and protein expressions of HK2 in MRC-5 cells were successfully silenced and overexpressed through si-HK2-3 and lentiviral transfection, respectively. After silencing HK2, the mRNA and protein expressions of HK2 were significantly decreased (P<0.01), and the concentrations of glucose, ATP and lactate were also significantly decreased (P<0.05). The proliferation, migration and invasion of MRC-5 cells were significantly declined (P<0.05 or P<0.01), while the apoptosis of MRC-5 cells was significantly increased (P<0.01). After overexpressing HK2, the mRNA and protein expressions of HK2 were significantly increased (P<0.05), and the concentrations of glucose, ATP and lactate were also significantly increased (P<0.05 or P<0.01). The proliferation, migration and invasion of MRC-5 cells were significantly increased (P<0.05 or P<0.01), while the apoptosis of MRC-5 cells was significantly decreased (P<0.05). The relative luciferase activity of 3'UTR-WT+hsa-miR-29b-2-5p transfected with HK2 was significantly decreased (P<0.01). After miR-29b-2-5p mimic and inhibitor were transfected into the MRC-5 cells, DMS intervention could significantly reduce the concentration of glucose, ATP and lactate, and the mRNA and proteins expressions of HK2, phosphofructokinase and pyruvate kinase isoform M2 (P<0.05 or P<0.01). The proliferation, migration and invasion of MRC-5 cells were alleviated (P<0.05 or P<0.01), and the deposition of fibronectin, α-smooth muscle actin, and collagen I were significantly decreased (P<0.05 or P<0.01). CONCLUSIONS Glycolysis is closely related to pulmonary fibrosis. DZP reduced glycolysis and inhibited fibroblasts' excessive differentiation and abnormal collagen deposition through the miR-29b-2-5p/HK2 pathway, which played a role in delaying the process of pulmonary fibrosis.
MicroRNAs/genetics* ; Glycolysis/genetics* ; Animals ; Pulmonary Fibrosis/metabolism* ; Humans ; Drugs, Chinese Herbal/therapeutic use* ; Hexokinase/genetics* ; Cell Line ; Cell Proliferation/drug effects* ; Rats, Sprague-Dawley ; Rats ; Cell Movement/drug effects* ; Male ; Cell Survival/drug effects* ; Signal Transduction/drug effects*

Objective:This study aims to initially establish a scoring system for comprehensively reflecting the severity of intracranial atherosclerotic lesions and to explore the correlation between this score and atherosclerotic risk factors as well as stroke events.Methods:This study retrospectively analyzed patients who underwent head and neck computer tomography angiography(CTA)examinations and had head MRI examinations within one month before or after the CTA examination from January 2021 to August 2024 in Beijing Hospital.An intracranial atherosclerosis disease score(ICADS)system was constructed based on the degree and number of vascular stenosis.The relationship between ICADS and atherosclerotic risk factors was explored by grouping patients according to the quartile of ICADS.Patients were divided into acute stroke group and non-acute stroke group to compare differences in ICADS and cerebrovascular disease risk factors between the two groups, and to investigate the correlation between stroke events and ICADS.Results:There were statistically significant differences in the proportions of patients with hypertension and diabetes among different ICADS groups.Multiple linear regression analysis showed that hypertension( B=1.17, 95% CI: 0.20-2.14, P<0.05)and diabetes( B=2.75, 95% CI: 1.85-3.64, P<0.001)were risk factors for higher ICADS.The ICADS was higher in the acute stroke group than in the non-acute stroke group(9 vs.6, P<0.001), and a higher ICADS was identified as a risk factor for stroke( OR=1.10, 95% CI: 1.07-1.14, P<0.001). Conclusions:ICADS can comprehensively reflect the severity of intracranial atherosclerotic lesions and is correlated with stroke events, making it useful for clinical screening of high-risk patients for stroke.

Mineral oil contaminants composed of saturated hydrocarbons(MOSH)and aromatic hydrocarbons(MOAH)are commonly found in edible oils and related processed foods.Currently,the analysis of mineral oils primarily employs the liquid chromatography-gas chromatography-flame ionization detector(LC-GC-FID)method.Liquid chromatography is used to purify and separate MOSH and MOAH from interfering substances,and the interface technology transfers MOSH or MOAH into different GC channels for quantitative analysis.The MOSH and MOAH chromatograms typically exhibit an irregular hump shape,with sharp peaks above the hump representing natural hydrocarbon interferences,which usually do not affect the identification of the hump profile.However,when the purification of interferences is incomplete,they can form one or more gaps above the hump,interfering with the accurate judgment and delineation of the hump profile,and leading to poor reproducibility of analysis results of mineral oil.In this study,an algorithm that mimicked the manual drawing of the hump shape or contour was proposed for automatically determining the mineral oil hump contour(i.e.,the lower envelope line).The algorithm used a multiple second-order difference quotient filtering method to identify and remove the gaps above the hump.The method involved first searching and determining the lowest value of the mineral oil hump,which was the valley point sequence,and then applying second-order difference quotient filtering to the valley point sequence.Compared to the hump,the second-order difference quotient of sharp peaks was a significantly larger negative value.By filtering out the points in the valley point sequence with larger negative second-order difference quotients(or multiple second-order difference quotients),the sharp peaks above the hump were removed.To verify the accuracy of the algorithm,42 different types of samples,including edible oils and milk powders were analyzed,using both the automatic algorithm and manual methods.The results showed that there were no significant differences in the detected mineral oil contents between these two methods.

Fe/Mn/Gd polymetallic nanooxide(FMGN)were prepared by one-step solvent thermal reaction by using Fe(acac)3,Mn(acac)2 and Gd(acac)3 as reaction precursors.Next,hyaluronic acid(HA)was used to modify FMGN to fabricate tumor-targeting T 1-T 2 dual-mode magnetic resonance imaging(MRI)contrast agent(HA-FMGN)for accurate diagnosis of prostate cancer.The structure and morphology of FMGN were observed by transmission electron microscope(TEM).It was found that FMGN exhibited a uniform nanocluster spherical structure when the feeding ratio of iron acetylacetonate,manganese acetylacetonate,and gadolinium acetylacetonate was 3:2:1.X-ray diffraction(XRD)analysis showed that FMGN had a typical inverse spinel structure of Mn doped Fe 3O 4,with Gd existing in the form of amorphous gadolinium oxide.The longitudinal relaxivity(r 1)and transverse relaxivity(r 2)of FMGN were 13.395 and 428.535 L/(mmol·s),respectively,measured by 0.5 T MRI analyzer,which proved that FMGN had excellent T 1-T 2 dual-mode MRI contrast capability.The cytotoxicity and hemolysis test found that HA-FMGN didn't damage red cells and induce toxicity for normal cells,indicating that HA-FMGN had excellent cell biocompatibility.The internalization efficacy of HA-FMGN was observed by CLSM,and the results showed that HA-FMGN possessed excellent prostate tumor-targeting ability.In vivo MRI experiment showed that HA-FMGN significantly enhanced T 1 and T 2 weighted MRI signal to noise ratio(SNR)of prostate tumor,which promoted the accurate diagnosis of orthotopic prostate cancer.