[Objective] To explore the relationship between neutrophil activation under cardiopulmonary bypass (CPB) and the incidence of cardiac surgery-associated acute kidney injury (CS-AKI). [Methods] This prospective cohort study enrolled adult patients who scheduled for cardiac surgery under CPB at West China Hospital between May 1, 2022 and March 31, 2023. The primary outcome was acute kidney injury (AKI). Blood samples (5 mL) were obtained from the central vein before surgery, at rewarming, at the end of CPB, and 24 hours after surgery. Neutrophils were labeled with CD11b, CD54 and other markers. To assess the effect of neutrophils activation on AKI, propensity score matching (PSM) was employed to equilibrate covariates between the groups. [Results] A total of 120 patients included into the study, and 17 (14.2%) developed AKI. Both CD11b⁺ and CD54⁺ neutrophils significantly increased during the rewarming phase and the increases were kept until 24 hours after surgery. During rewarming, the numbers of CD11b⁺ neutrophils were significantly higher in AKI compared to non-AKI (4.71×10⁹/L vs 3.31×10⁹/L, Z=-2.14, P<0.05). Similarly, the CD54⁺ neutrophils counts were also significantly higher in AKI than in non-AKI before surgery (2.75×10⁹/L vs 1.79×10⁹/L, Z=-2.99, P<0.05), during rewarming (3.12×10⁹/L vs 1.62×10⁹/L, Z=-4.34, P<0.05), and at the end of CPB (4.28×10⁹/L vs 2.14×10⁹/L, Z=-3.91, P<0.05). An analysis of 32 matched patients (16 in each group) revealed that CD11b⁺ and CD54⁺ neutrophil levels of AKI were 1.74 folds (4.83×10⁹/L vs 2.77×10⁹/L, Z=-2.72, P<0.05) and 2.34 folds (3.32×10⁹/L vs 1.42×10⁹/L, Z=-4.12, P<0.05), respectively, of non-AKI at rewarming phase. [Conclusion] Neutrophils are activated during CPB, and they can be identified by CD11b/CD54 markers. The activated neutrophils of AKI patients are approximately 2 folds of non-AKI during the rewarming phase, with disparity reached peak between groups during rewarming. These findings suggest the removal of 50% of activated neutrophils during the rewarming phase may be effective to reduce the risk of AKI.

BACKGROUND: Most studies have evaluated disability-adjusted life years (DALYs) of colorectal cancer (CRC) patients based on a set of generic disability weights (DWs). This study aimed to apply local CRC-stage-specific DWs to estimate the burden of DALYs for CRC (CRC-DALYs) in populations in China and consider the influence of local screening coverage of CRC. METHODS: A prevalence-based model was constructed using data from various sources. Years lived with disability (YLDs) were estimated mainly via cumulative prevalence data (based on CRC incidence rates, population numbers, and survival rates), stage-specific proportions of CRC, and DWs of the local population. Years of life lost (YLLs) were calculated based on the CRC mortality rates and standard life expectancies. CRC incidence and mortality rates for the years 2020, 2025, and 2030 were estimated by joinpoint regression, and the corresponding DALYs were predicted. The main assumption was made for CRC screening coverage. Sensitivity analyses were used to assess the impact of population, DWs, and coverage. RESULTS: In 2017, among the Chinese population, the estimated number of CRC-DALYs was 4,303,314 (11.9% for YLDs). If CRC screening coverage rate in China (2.3%) remains unchanged, the overall DALYs in 2030 are predicted to increase by 37.2% (45.1% of those aged ≥65 years). More optimistically, the DALYs would then decrease by 0.7% in 2030 (from 5,902,454 to 5,860,200) if the coverage could be increased to 25.0%. A sensitivity analysis revealed that using local DWs would change the base-case values by 5.7%. CONCLUSIONS The estimated CRC-DALYs in China using population-specific DWs were considerably lower (with a higher percentage of YLDs) than the global burden of disease (GBD) estimates (5,865,004, of 4.6% for YLDs), suggesting the impact extent of applying local parameters. Sustainable scale-up CRC screening needs to be in place to moderate the growth trend of CRC-DALYs in China.
Humans ; Colorectal Neoplasms/diagnosis* ; China/epidemiology* ; Disability-Adjusted Life Years ; Male ; Prevalence ; Female ; Middle Aged ; Aged ; Early Detection of Cancer ; Quality-Adjusted Life Years ; Adult ; Incidence

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To explore the preventive and therapeutic effects of Dahuang Zhechong Pill (DZP) on pulmonary fibrosis and the underlying mechanisms. METHODS: The first key rate-limiting enzyme hexokinase 2 (HK2) of glycolysis was silenced and over-expressed through small interfering RNA and lentivirus using lung fibroblast MRC-5 cell line, respectively. The cell viability, migration, invasion and proliferation were detected by cell counting kit-8, wound healing assay, transwell assay, and flow cytometry. The mRNA and protein expression levels of HK2 were detected by RT-PCR and Western blotting, respectively. The contents of glucose, adenosine triphosphate (ATP) and lactate in MRC-5 cells were determined by enzyme-linked immunosorbnent assay (ELISA). Then, the relationship between miR-29b-2-5p and HK2 was explored by luciferase reporter gene assay. Pulmonary fibrosis cell model was induced by transforming growth factor-β 1 (TGF-β 1) in MRC-5 cells, and the medicated serum of DZP (DMS) was prepared in rats. MRC-5 cells were divided into control, TGF-β 1, TGF-β 1+10% DMS, TGF-β 1+10% DMS+miR-29b-2-5p inhibitor, TGF-β 1+10% DMS+inhibitor negative control, TGF-β 1+10% DMS+miR-29b-2-5p mimic and TGF-β 1+10% DMS+mimic negative control groups. After miR-29b-2-5p mimics and inhibitors were transfected into MRC-5 cells, all groups except control and model group were treated with DMS. The effect of DMS on MRC-5 cells were detected using aforementioned methods and immunofluorescence. Similarly, the contents of glucose, ATP and lactate in each group were measured by ELISA. RESULTS: The mRNA and protein expressions of HK2 in MRC-5 cells were successfully silenced and overexpressed through si-HK2-3 and lentiviral transfection, respectively. After silencing HK2, the mRNA and protein expressions of HK2 were significantly decreased (P<0.01), and the concentrations of glucose, ATP and lactate were also significantly decreased (P<0.05). The proliferation, migration and invasion of MRC-5 cells were significantly declined (P<0.05 or P<0.01), while the apoptosis of MRC-5 cells was significantly increased (P<0.01). After overexpressing HK2, the mRNA and protein expressions of HK2 were significantly increased (P<0.05), and the concentrations of glucose, ATP and lactate were also significantly increased (P<0.05 or P<0.01). The proliferation, migration and invasion of MRC-5 cells were significantly increased (P<0.05 or P<0.01), while the apoptosis of MRC-5 cells was significantly decreased (P<0.05). The relative luciferase activity of 3'UTR-WT+hsa-miR-29b-2-5p transfected with HK2 was significantly decreased (P<0.01). After miR-29b-2-5p mimic and inhibitor were transfected into the MRC-5 cells, DMS intervention could significantly reduce the concentration of glucose, ATP and lactate, and the mRNA and proteins expressions of HK2, phosphofructokinase and pyruvate kinase isoform M2 (P<0.05 or P<0.01). The proliferation, migration and invasion of MRC-5 cells were alleviated (P<0.05 or P<0.01), and the deposition of fibronectin, α-smooth muscle actin, and collagen I were significantly decreased (P<0.05 or P<0.01). CONCLUSIONS Glycolysis is closely related to pulmonary fibrosis. DZP reduced glycolysis and inhibited fibroblasts' excessive differentiation and abnormal collagen deposition through the miR-29b-2-5p/HK2 pathway, which played a role in delaying the process of pulmonary fibrosis.
MicroRNAs/genetics* ; Glycolysis/genetics* ; Animals ; Pulmonary Fibrosis/metabolism* ; Humans ; Drugs, Chinese Herbal/therapeutic use* ; Hexokinase/genetics* ; Cell Line ; Cell Proliferation/drug effects* ; Rats, Sprague-Dawley ; Rats ; Cell Movement/drug effects* ; Male ; Cell Survival/drug effects* ; Signal Transduction/drug effects*

Objective:To explore the clinical and genetic etiology of a Chinese pedigree affected with type 2 Long QT syndrome (LQTS).Methods:A pedigree with type 2 LQTS presented at Fuwai Central China Cardiovascular Hospital on August 23, 2019 was selected as the study subject. Peripheral blood samples were collected from the proband and her parents. Following extraction of genomic DNA, whole exome sequencing (WES) was carried out for the proband, and candidate variant was screened through functional annotation and protein-protein interaction (PPI) analysis. Sanger sequencing was conducted to verify the pathogenicity of candidate variant. This study was approved by Medical Ethics Committee of the Fuwai Central China Cardiovascular Hospital (Ethics No. 2019-15).Results:WES revealed that the proband has harbored a missense variant of the KCNH2 gene, namely c. 1478A>G (p.Tyr493Cys), which was confirmed by Sanger sequencing to have inherited from her father. Based on the guidelines from the American College of Medical Genetics and Genomics (ACMG), the variant was classified as likely pathogenic (PM2_supporting+ PM5+ PP3+ PP4). Conclusion:The KCNH2 gene c. 1478A>G (p.Tyr493Cys) variant probably underlay the type 2 LQTS in this pedigree.

Objective To investigate the molecular mechanism of Brusatol(BRU)regulating apoptosis of Hela cells through TLR9-MyD88 signaling pathway.Methods Hela cells preserved in our laboratory were treated with Brucea javanica at different concentrations(0,5.0,10.0,20.0,40.0,80.0 nmol·L-1).Hela cells were divided into Control group(normal cultured Hela cells),BRU-L group(treated with 10.0 nmol·L-1 Brucea javanica)and BRU group-H(treated with 20.0 nmol·L-1 Brucea javanica)Cells were treated with nmol·L-1 of Brucea javanica),BRU+pcDNA-NC group(transfected with pcDNA-NC+20.0 nmol·L-1 of Brucea javanica),BRU-H+pcDNA-TLR9 group(transfected with pcDNA-TLR9+20.0 nmol·L-1 of Brucea javanica).Cell proliferation was detected by CCK-8 and EdU methods.Apoptosis was detected by TUNNEL staining and flow cytometry.The protein expression levels of TLR9,MyD88,Bax,Bcl-2,Cleaved Caspase-3 and Cleaved Caspase-9 were detected by Western blot.Cell apoptosis and mitochondrial membrane potential detection kit(JC-1)were detected by flow cytometry,and the contents of adenosine triphosphate(ATP)and reactive oxygen species(ROS)were detected by ELISA.Results Compared with 0 nmol·L-1 group,the survival rate and IC50 value of 10 nmol·L-1 group were significantly decreased(P<0.05).After stimulation of BRU with different concentrations,the proliferation ability of cells was significantly decreased in a dose-dependent manner(P<0.05).Compared with control group,the 5-ethynyl-2'-deoxyuracil(EDU)positive cell rate,TUNEL positive cell rate,apoptosis rate and Bcl-2 protein of cells in BRU-L,BRU-H and pcDNA-NC groups were significantly decreased.The protein levels of TLR9 and MyD88,Bax,Bax/Bcl-2,Cleaved Caspase-3 and Cleaved Caspase-9 were significantly increased(P<0.05).In control group,BRU-L,BRU-H group/BRU-H+pcDNA-NC,there was a continuous decreasing trend(P<0.05).Compared with the BRU-H+pcDNA-NC group,the EDU positive cell rate,TUNEL positive cell rate,apoptosis rate and Bcl-2 protein in the BRU-H+pcDNA-TLR9 group were significantly increased.The protein levels of TLR9 and MyD88,Bax,Bax/Bcl-2,Cleaved Caspase-3 and Cleaved Caspase-9 were significantly decreased(P<0.05).Compared with Control group,JC-1 level and ATP content in BRU-L,BRU-H and BRU-H+pcDNA-NC groups were significantly decreased,while ROC content and mitotracker positive cell level were significantly increased(P<0.05).Compared with BRU-L group,JC-1 level and ATP content in BRU-H group and BRU-H+pcDNA-NC group were further decreased,while ROC content and mitotracker positive cell level were further increased(P<0.05).Compared with the BRU-H+pcDNA-NC group,the levels of JC-1 and ATP in the BRU-H+pcDNA-TLR9 group were increased,while the levels of ROC,mitotracker staining positive cells were decreased(P<0.05).Conclusion Brucea javanica can produce Hela cell proliferation by regulating TLR9-MyD88 signaling pathway.

Objective:To investigate personal exposures to nitrogen oxides(NOX)and nitrogen di-oxide(NO2)and the influence of baseline personal characteristics,living environment and daily activity patterns of the participants on the exposures among adults over 35 in Tianjin and Shanghai.Methods:In this panel study,91 healthy nonsmoking adults aged over 35 from Tianjin and Shanghai participated in our study.The study was conducted in summer and winter.The participants were followed for three times with an interval of at least two weeks.Only participants in Shanghai were followed once in winter because of the COVID-19 pandemic.Twenty-seven participants completed follow-up visits in both seasons.We measured their 24 h personal exposures to NOX and NO2and collected their baseline and time-activity in-formation through questionnaire/diary.The linear mixed model was used to analyze the associations be-tween potential influencing factors and personal NOX and NO2 exposure levels.Results:There were 349 follow-up visits with valid 24 h personal NO2 and NOX exposure measurements in the two cities.The ave-rage 24 h personal exposures to NO2 and NOX(volume fraction)in Tianjin participants were 18.0 x 10-9 and 26.2 × 10-9 in summer,and 31.0 x 10-9 and 54.9 x 10-9in winter,respectively;and the average 24 h personal exposures to NO2 and NOX in Shanghai participants were 38.7 x 10-9and 100.0x10-9in summer,and 45.5 x10-9 and 139.2 x 10-9 in winter,respectively.The results of univariate regression analysis showed that their personal NOX exposure levels were significantly associated with city,season,gender,average daily cooking times,and ambient NO2 concentrations measured at fixed-site monitoring stations.In addition to the above factors,the personal NOX exposure levels were also significantly associ-ated with educational level and the personal NO2 exposure levels were also significantly associated with passive smoking,average daily home time,cooking energy type,residential distance from main traffic road,and use of kitchen ventilators.Multivariate regression analysis showed that the personal exposure levels of NO2 and NOX were significantly lower in Tianjin than that in Shanghai,were significantly lower in summer than that in winter,and were significantly and positively associated with ambient NO2 concen-trations measured at fixed-site monitoring stations.In addition,personal NOX exposure levels were signifi-cantly lower in females than in males,and personal NO2 exposure levels were significantly positively asso-ciated with average daily cooking times and significantly inversely associated with average daily home time.For every interquartile range(IQR)increase(12.7 × 10-9)in ambient NO2,the personal NO2 exposure levels increased by 27.5％(95％CI:17.0％-38.9％),and personal NOX exposure levels in-creased by 16.1％(95％CI:7.1％-25.8％).Conclusion:Season,city and ambient NO2 concentra-tions are significant influencing factors of personal exposure levels of NO2and NOX At the same time,the personal exposures levels of NO2 are also affected by lifestyle factors.Our study provides scientific evi-dence for making precise air pollution control decisions and reducing the exposure levels of NOX in the population.

Deep vein thrombosis(DVT)is a common peripheral vascular disease in clinical practice.The lack of precise and efficient early diagnostic techniques renders it susceptible to being overlooked or misdiagnosed,and therefore,identifying trustworthy biomarkers is a major issue that has to be resolved.In this study,the endogenous metabolites in the urine of DVT rats were screened by metabolomics technology based on gas chromatograph-mass spectrometry(GC-MS)and the characteristic metabolites were identified by multiple feature selection algorithms and multivariate statistical analysis,for the development of a machine learning-based diagnostic model for DVT.The urine samples in metabolic cage in the thrombus development phase(between 48 and 72 h)of rats were collected,which was used as the models for inferior vena cava ligation.The metabolic profiles of the control group and DVT were obtained using the GC-MS method.A total of 176 kinds of endogenous metabolites were identified in rat urine through comparison with the FiehnLib database,26 kinds of differential metabolites associated with DVT were screened through a combination of the Mann-Whitney U test and orthogonal partial least squares discriminant analysis(OPLS-DA),and 13 kinds of significant metabolites strongly correlated with DVT were further evaluated in conjunction with various machine learning feature selection techniques.For DVT diagnosis,machine learning models such as Gaussian Naive Bayes(GNB),support vector machine(SVM),logistic regression(LR),and linear discriminant analysis(LDA)were developed.The diagnostic model constructed using 13 kinds of key metabolites demonstrated excellent accuracy and stability,and surpassed the predictive performance of the models utilizing 176 kinds of metabolites and 26 kinds of differential metabolites,as evidenced by examination and comparison of each model's efficacy.The study showed that the integration of multiple feature selection algorithms for analyzing metabolite information in DVT rat urine was capable of effectively identifying reliable potential markers of DVT.Furthermore,the developed machine learning model offered a novel technical approach for the automated diagnosis of DVT.

Objective To detect the expression changes of interleukin-10(IL-10)and transforming growth factor-β1(TGF-β1)during the development of deep vein thrombosis in mice,and to explore the application value of them in thrombus age estimation.Methods The mice in the experimental group were subjected to ligation of inferior vena cava.The mice were sacrificed by excessive anesthesia at 1 d,3 d,5 d,7 d,10 d,14 d and 21 d after ligation,respectively.The inferior vena cava segment with thrombosis was extracted below the ligation point.The mice in the control group were not ligated,and the inferior vena cava segment at the same position as the experimental group was extracted.The ex-pression changes of IL-10 and TGF-β1 were detected by immunohistochemistry(IHC),Western blot-ting and real-time qPCR.Results IHC results revealed that IL-10 was mainly expressed in monocytes in thrombosis and TGF-β1 was mainly expressed in monocytes and fibroblast-like cells in thrombosis.Western blotting and real-time qPCR showed that the relative expression levels of IL-10 and TGF-β1 in each experimental group were higher than those in the control group.The mRNA and protein levels of IL-10 reached the peak at 7 d and 10 d after ligation,respectively.The mRNA expression level at 7 d after ligation was 4.72±0.15 times that of the control group,and the protein expression level at 10 d after ligation was 7.15±0.28 times that of the control group.The mRNA and protein levels of TGF-β1 reached the peak at 10 d and 14 d after ligation,respectively.The mRNA expression level at 10 d after ligation was 2.58±0.14 times that of the control group,and the protein expression level at 14 d after ligation was 4.34±0.19 times that of the control group.Conclusion The expressions of IL-10 and TGF-β1 during the evolution of deep vein thrombosis present time-dependent sequential changes,and the expression levels of IL-10 and TGF-β1 can provide a reference basis for thrombus age estimation.