Hepatocellular carcinoma (HCC) is a lethal cancer with high morbidity rates worldwide. It is a major threat to public health in China, due to the combination of known and new risk factors, such as endemic hepatitis B virus (HBV), dietary aflatoxin exposure, and the occurrence of metabolic dysfunction-associated steatotic liver disease (MASLD). Although many methods for surveillance and multimodal therapies, such as surgery, local ablation, transarterial therapy, and new systemic agents, have been available, the survival rates of HCC remains poor. They have very limited durable responses, long post-treatment recurrence rates, and high resistance to treatment. This reflects an imperfect picture of the biological cause of the disease and a need for new mechanistic or targeted techniques. A significant characteristic of HCC, in common with other aggressive cancers, is the presence of reprogrammed, hyperactive cell metabolism. Tumor cells hijack metabolic pathways to promote their uncontrolled growth, stress survival, invasion and metastasis. While classical mechanisms such as the Warburg effect, lipid metabolism and glutamine utilization have been understood, the lysosome, which was once viewed as a static “waste disposal unit” to remove old organelles and proteins, is instead a dynamic signaling and metabolic core. The lysosomes incorporate nutrients, energy and stress signals by master regulators such as mTORC1 (activated on its surface) that balance anabolic growth and catabolic recycling to the cellular demands. In HCC, lysosomes are not passive, but are highly active and dysregulated. HCC cells upregulate lysosomes, which scavenge intracellular components via enhanced autophagy and engulf extracellular proteins via macropinocytosis, crucial for survival in the nutrient-poor, hypoxic tumor microenvironment. In addition to metabolism, lysosomes exhibit pro-invasive functions by secreting hydrolases to remodel the extracellular matrix, promote angiogenesis, and suppress stromal immune cells to foster a pro-tumor microenvironment. In a clinical context, lysosomes play an important role in therapeutic resistance: they sequester and inactivate chemotherapeutics via lysosomal sequestration, and enhanced autophagic flux protects the cell from therapy-induced damage, contributing to relapse, as lysosomal dysfunction is a key cause of treatment failure. This makes lysosomes promising yet challenging therapeutic targets in HCC. Recent preclinical and early clinical studies investigate multiple strategies to exploit the susceptibility of lysosomes: lysosome-specific agents, alkalinizing the lysosome lumen or inducing membrane permeabilization and lysosome-dependent cell death; pharmacological inhibition of key lysosomal enzymes or autophagy to impair nutrient recycling and stress adaptation; smart nanotherapeutic agents or antibody-drug conjugates, specifically activated in the acidic lysosomal environment or utilizing lysosomal pathways for efficient intracellular drug release; and combination strategies of lysosome-targeting agents with tyrosine kinase inhibitors or immunotherapy to overcome resistance and achieve synergistic antitumor effects. In summary, our review systematically presents the role of lysosomes in HCC, from metabolic reprogramming and microenvironmental adaptation to therapeutic resistance. By synthesizing the latest mechanistic insights and preclinical advances, this review highlights the indispensable role of lysosomes in the complex HCC biological network, emphasizing that an in-depth understanding of this dynamic organelle holds great promise for developing innovative, targeted therapies, offering new hope for improving the poor prognosis of global HCC patients.

Clinical death refers to the permanent cessation of life functions. This article reviews the definition of clinical death and the various scenarios in which it occurs, classifies the process of clinical death, and discusses the criteria for determining uncontrollable cardiac death, controllable cardiac death and the criteria and workflow for determining brain death. It elaborates on the relationship between brain death and death, and proposes the areas to note when standardizing the medical documentation of death cases. Based on this, it introduces the content of the management system and workflow construction for death determination in medical institutions, including management structure, personnel qualifications, document norms, quality control system and training mechanism. Paying attention to the construction of the management system and workflow for death determination in medical institutions is of great significance for ensuring medical quality and safety, promoting the healthy development of organ donation, and maintaining the seriousness of legal and ethical practices.

ObjectiveHistorically documented Zhejiang Atractylodis Macrocephalae Rhizoma（Baizhu） possesses premium characteristics such as phoenix-like head and crane-like neck， pronounced sweetness， and fragrant aroma. However， its current market circulation is low， and the processed products with Zhejiang-style characteristics are at the risk of being lost. This study aims to preserve the ancient Zhejiang-style processing techniques and evaluate them using modern scientific methods. MethodsMultidimensional intelligent sensory evaluation was used to digitally characterize the "quality-structure" of the external appearance of nine-steamed and nine-processed Baizhu medicinal materials（intermediate processed products） and the "odor-taste" of the internal quality of its decoction pieces（slices）， and the appearance parameters were digitally characterized by colorimeter， texture analyzer， electronic nose and electronic tongue， the chemical composition was analyzed via ultra-performance liquid chromatography-quadrupole-time-of-flight mass spectrometry（UPLC-Q-TOF-MS/MS）. Then， cluster analysis on the differences in odor between the medicinal materials（intermediate processed products） and decoction pieces（slices） of nine-steamed and nine-processed Baizhu was conducted， as well as the differences in taste between water-soluble and alcohol-soluble extracts of the decoction pieces（slices）， and the correlation analysis of chroma value-alcohol-soluble extract content-component response value. ResultsThe nine-steamed and nine-processed Baizhu had a dark brown to black epidermis， a brownish-yellow to brownish-gray cross-section， a slightly tough texture， a faint odor， and a slightly sweet， bitter and pungent taste. Texture analyzer measurements revealed minimal adhesion and maximum recovery in the middle section of the characteristic processed Baizhu， consistent with the processing endpoint of thorough steaming and cooking. The head section showed the highest internal hardness， elasticity and chewiness， indicating a denser texture in this area. The electronic nose sensor could clearly distinguish the difference between the medicinal materials and its decoction pieces， with a more significant clustering effect at 60 ℃ for 30 minutes compared to ambient temperature headspace for 2 hours， highlighting the significant impact of the baking degree before slicing on the quality. The electronic tongue taste signal map clearly distinguished the differences between water-soluble and alcohol-soluble extracts of nine-steamed and nine-processed Baizhu decoction pieces， and the addition of auxiliary materials during processing could enhance its alcohol-soluble extract content. A total of 82 chemical components were identified in the characteristic processed Baizhu. After processing， the contents of 58 components increased， while 24 components decreased. Correlation analysis revealed significant negative correlations（P<0.01） between ethanol-soluble extract content and colorimetric values of brightness（L^*）， yellow-bule value（b^*）， and total color difference（E^*_ab）. E^*_ab showed marked negative correlations（P<0.05） with the response values of isochlorogenic acid A and C. ConclusionThis study establishes a modern intelligent sensory evaluation model for multidimensional holographic characterization of nine-steamed and nine-processed Baizhu， clarifying the correlation between increased isochlorogenic acid content and the visual color appearance after different steaming cycles， as well as its intrinsic alcohol-soluble extracts. This provides a reference for quality evaluation and processing standards of the Zhejiang-style characteristic processed products.

Objective This study reports on the obligatory parasitism of water mites Arrenurus sp. on Anopheles messeae at the Manzhouli Port, Inner Mongolia, China. Methods Duing July 2024, a survey on the mosquito diversity was conducted at the Manzhouli Port. Captured mosquitoes and their ectoparasites were identified to species level. Results A total of 1840 adult mosquitoes were collected, representing species from three genera: Culex(Cx. modestus, Cx. pipiens pallens), Aedes(Ae. dorsalis, Ae. flavidorsalis, Ae. flavescens), and Anopheles (An. messeae). Among all the mosqutioes specimens,3 out of 150 captured An. messeae were found to carry ectoparasitic mites, with number of 2,4,27 mites separately. Morphological and molecular identification reached the same result as water mites(Hydrachnidiae, Hydracrina). COI gene sequence showed 94% similarity with the closest species Arrenurus truncatellus. Conlusions Literature review suggests water mites are host-specific parasitism of mosquito species and herein with the first record of Arrenurus sp. parasiting on An. Messeae in the most high-latitude region globally.

Background Polycyclic aromatic hydrocarbons (PAHs) are significant organic components of PM_2.5 and exhibit carcinogenic and mutagenic properties. Long-term exposure to high level of atmospheric particulate matter and particle-bound PAHs may contribute to the burden of environmentally related diseases in China. Objective To characterize PM_2.5 concentrations and PM_2.5-bound PAHs in three districts of Guangzhou from 2016 to 2024, and to assess the incremental lifetime cancer risk (ILCR) associated with inhalation exposure to PAHs among different population groups. Methods PM_2.5 samples were collected monthly from the 10th to the 16th day of each month at rooftop monitoring sites on office buildings in Yuexiu, Conghua, and Panyu districts between 2016 and 2024. PM_2.5 concentrations were measured, and 16 priority PAHs were quantified using high-performance liquid chromatography (HPLC). Seasonal and regional variations in PM_2.5 and PAH concentrations were analyzed using the Kruskal-Wallis test. Potential PAH sources were identified using diagnostic ratio analysis and principal component analysis (PCA). The ILCR model was employed to estimate inhalation-related cancer risks for different population groups. Results From 2016 to 2024, the annual median PM_2.5 concentrations in Guangzhou were 51.0, 46.0, 45.0, 41.5, 31.0, 32.0, 30.0, 26.0, and 37.5 μg·m⁻³, respectively, showing an overall declining trend. PM_2.5 concentrations varied significantly by season, following the order of winter > spring/autumn > summer (H=475.341, P < 0.001). Spatially, PM_2.5 concentrations were highest in Yuexiu, followed by Panyu and Conghua (H=36.226, P < 0.001). The annual median PAH concentrations were 3.95, 4.22, 3.73, 3.13, 2.54, 2.16, 2.78, 2.36, and 1.75 ng·m⁻³, respectively. PAH concentrations showed a similar seasonal pattern (winter > spring/autumn > summer; H=320.392, P < 0.001). However, their spatial distribution differed from that of PM_2.5: Conghua > Panyu > Yuexiu (H=55.938, P < 0.001). Diagnostic ratios and PCA indicated that the major sources of PAHs were traffic-related emissions (gasoline and diesel combustion) and coal combustion, with additional contributions from petroleum volatilization and biomass burning. Benzo[a]pyrene (BaP) toxic equivalent concentrations declined over time and remained below the Chinese standard limit of 1 ng·m⁻³ after 2018. The median inhalation-related ILCRs were 0.094×10⁻⁶ for children, 0.035×10⁻⁶ for adolescents, and 0.293×10⁻⁶ for adults. Conclusion From 2016 to 2024, PM_2.5 and PM_2.5-bound PAH pollution levels in Guangzhou generally declined. Suburban areas had the lowest PM_2.5 concentrations but the highest PAHs concentrations. Both PM_2.5 and PM_2.5-bound PAHs exhibited significant seasonal variations, with the highest levels in winter and the lowest levels in summer. The primary sources of PAHs were vehicular emissions and coal combustion, and PAHs posed no significant carcinogenic risk to the study population.

Objective: To compare the biological characteristics of human induced pluripotent stem cell-derived platelet exosomes (hiPSC-Plt-Exos) with those of conventional apheresis platelet exosomes (Plt-Exos), specifically focusing on their differential abilities to enhance the proliferation and migration of human umbilical cord mesenchymal stem cells (hUC-MSCs). Methods: Exosomes were isolated from hiPSC-derived Plt and apheresis Plt concentrate using size exclusion chromatography. These exosomes were then characterized through nanoparticle tracking analysis (NTA), transmission electron microscopy (TEM), and Western blotting. Co-culture experiments into hUC-MSCs were conducted with hiPSC-Plt-Exos and apheresis Plt-Exos, respectively. Their effects on the proliferation and migration of hUC-MSCs were assessed via cell proliferation assays and scratch tests. Results: hiPSC-Plt-Exos and apheresis Plt-Exos exhibited comparable particle sizes, morphological features (such as the characteristic cup-shaped structure), and surface markers (including CD9 and HSP70). Notably, hiPSC-Plt-Exos demonstrated a significantly greater ability to enhance the proliferation and migration of hUC-MSCs compared to apheresis Plt-Exos (P<0.05). These differences provide critical comparative data for their application in various clinical contexts. Conclusion: This study establishes a theoretical foundation for developing precise therapeutic strategies based on hiPSC-Plt-Exos. Furthermore, it underscores the necessity of selecting the appropriate type of exosomes according to the specific disease microenvironment to achieve optimal therapeutic outcomes.

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

OBJECTIVES: To investigate the clinical characteristics and prognosis of infants and young children with basal ganglia infarction after minor head trauma (BGIMHT). METHODS: A retrospective analysis was conducted on the clinical data and follow-up results of children aged 28 days to 3 years with BGIMHT who were hospitalized at Children's Hospital of Soochow University from January 2011 to January 2022. RESULTS: A total of 45 cases of BGIMHT were included, with the most common symptom being limb movement disorders (96%, 43/45), followed by facioplegia (56%, 25/45). Cerebral imaging showed that 72% (31/43) had infarction accompanied by basal ganglia calcification. After conservative treatment, 42 children (93%) showed significant symptom improvement, while 3 children (7%) experienced recurrent strokes. The median follow-up time was 82 months (range: 17-141 months). At the last follow-up, 97% (29/30) had residual basal ganglia softening lesions. Among 29 cases participating in questionnaire follow-up, 66% (19/29) recovered normally, 17% (5/29) showed significant improvement in symptoms, and 17% (5/29) had poor improvement. According to the grading of the Global Burden of Disease Control Projects, only 1 child (3%) had severe sequelae. There were no significant differences in age at onset, gender, or presence of concomitant basal ganglia calcification between children with and without neurological sequelae (P>0.05). CONCLUSIONS The most common initial symptom of BGIMHT is limb movement disorder, and imaging results indicate that most children have concurrent intracranial calcifications. Most infarct lesions later transform into softening lesions, resulting in a generally good prognosis.
Humans ; Male ; Female ; Infant ; Child, Preschool ; Craniocerebral Trauma/complications* ; Follow-Up Studies ; Retrospective Studies ; Basal Ganglia/pathology* ; Infant, Newborn

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE To standardize the strategies for prevention and control of Chikungunya(CHIK)in healthcare in-stitutions so as to reduce the risk of transmission in the institutions.METHODS A working group comprising the ex-perts in hospital infection control,infectious diseases,and microbiology systematically reviewed domestic and international evidence and current guidelines,integrated China's vector ecology and healthcare realities,conducted two rounds of Delphi to achieve expert consensus,and graded the evidence and recommendation strength using the Oxford Centre for Evidence Based Medicine system.RESULTS The consensus issues 18 actionable recommendations on triage,patient mosquito-proof isolation,integrated vector control,protection of susceptible populations,environmental cleaning and disinfection,specimen management,medical textile handling,and outbreak emergency response,with each statement assigned an evi-dence level and recommendation strength.CONCLUSION This consensus is for the first time in China to provide evidence-graded strategies for control of CHIK in healthcare institutions,offering work flow-oriented,implementable guidance for clinicians,laboratorians,and infection-control personnel under different risk scenarios and enhancing the comprehensive coping capacity of the healthcare institutions.