Objective: To explore the association role of anxiety and depressive symptoms with Internet gaming disorder (IGD) and emotional-behavioral problems among junior high school students, so as to provide references for preventing the occurrence and progression of emotional-behavioral problems in middle school students. Methods: From September to October 2024, a random cluster sampling method was adopted to select 38 069 students from 28 junior high schools in 14 counties (cities and districts) and functional areas of Jining City, Shandong Province. Surveys were conducted by Nine item Internet Gaming Disorder Scale-Short Form, Generalized Anxiety Disorder-7, Patient Health Questionnaire-9, and Strengths and Difficulties Questionnaire. The correlation of emotional and behavioral issues, online game addiction, anxiety and depressive symptoms among junior high school students was analyzed by Speaman correlation analysis. Mediation analysis was used to explore the role of anxiety and depressive symptoms between IGD and emotional-behavioral problems among junior high school students. Results: The detection rates of emotional-behavioral problems, anxiety symptoms, depressive symptoms, and IGD among junior high school students were 19.24 %, 9.48%, 16.69%, and 19.68%, respectively. The scores of emotional-behavioral problems, anxiety symptoms, depressive symptoms and IGD were 10.00 (6.00, 15.00), 3.00 (0.00, 7.00), and 4.00 (1.00, 8.00), 13.00 (10.00, 19.00), respectively. There were positive correlations between each pair of emotional-behavioral problem, IGD, anxiety symptoms, and depressive symptoms scores ( r =0.51-0.81, all P <0.01). Anxiety and depressive symptoms played mediating roles between IGD and emotional-behavioral problems among junior high school students, with mediating effect values of 0.16 (95% CI =0.15-0.17) and 0.12 (95% CI =0.11-0.14), respectively (both P <0.01). Conclusions Anxiety and depressive symptoms mediate the relationship between IGD and emotional-behavioral problems among junior high school students. It is necessary to identify early signs of IGD among junior high school students, strengthen intervention for anxiety and depressive symptoms, to prevent the occurrence and development of emotional and behavioral issues.

This study aims to investigate the ameliorating effect of Corni Fructus(CF) on the myocardial ischemic injury and the pharmacokinetic properties of characteristic components of CF. The mouse model of isoproterenol-induced myocardial ischemia was established and administrated with the aqueous extract of CF. The general efficacy of CF in ameliorating the myocardial ischemic injury was evaluated based on the cardiac histopathology and the levels of myocardial injury markers: creatine kinase isoenzyme(CK-MB) and cardiac troponin I(cTn-I). The metabolomics analysis was carried out for the heart and serum samples of mice to screen the biomarkers of CF in ameliorating the myocardial ischemic injury and then the predicted biomarkers were submitted to metabolic pathway enrichment. The pharmacokinetic analysis was performed for morroniside, loganin, and cornuside Ⅰ in mouse heart and serum samples to obtain the pharmacokinetic parameters of these components. The pharmacokinetic parameters were then integrated on the basis of self-defined weighting coefficients to simulate an integrated pharmacokinetic profile of CF iridoid glycosides in the heart and serum of the mouse model of myocardial ischemia. The results indicated that CF reduced the pathological damage to cardiac cells and tissue(hematoxylin-eosin staining) and lowered the levels of CK-MB and cTn-I in the serum of the mouse model of myocardial ischemia(P<0.01). Metabolomics analysis screed out 31 endogenous metabolites in the heart and 35 in the serum as biomarkers of CF in ameliorating the myocardial ischemic injury. These biomarkers were altered by modeling and restored by CF. Six metabolic pathways in the heart and 5 in the serum were enriched based on these metabolic markers. The main integrated pharmacokinetic parameters of CF iridoid glycosides were T_(max)=1 h, t_(1/2)=(1.52±0.05) h in the heart and T_(max)=1 h, t_(1/2)=(1.56±0.50) h in the serum. Both concentration-time curves showed a double-peak phenomenon. In conclusion, CF demonstrated the cardioprotective effect by regulating metabolic pathways such as taurine and hypotaurine metabolism, and pantothenic acid and coenzyme A biosynthesis. The integrated pharmacokinetics reflect the general pharmacokinetic properties of characteristic components in CF.
Animals ; Cornus/chemistry* ; Mice ; Metabolomics ; Drugs, Chinese Herbal/administration & dosage* ; Male ; Myocardial Ischemia/metabolism* ; Humans ; Troponin I/metabolism* ; Myocardium/pathology* ; Disease Models, Animal ; Biomarkers/metabolism* ; Creatine Kinase, MB Form/metabolism*

To elucidate the mechanism by which steaming affects the quality of Curcuma kwangsiensis root tubers, methods such as LSCM, RVA, dual-wavelength spectrophotometry, LF-NMR, and LC-MS were employed to qualitatively and quantitatively detect changes in starch gelatinization characteristics, water distribution, and material composition of C. kwangsiensis root tubers under different steaming durations. Based on multivariate statistical analysis, the correlation between differences in gelatinization parameters, water distribution, and terpenoid material composition was investigated. The results indicate that steaming affects both starch gelatinization and water distribution in C. kwangsiensis. During the steaming process, transformations occur between amylose and amylopectin, as well as between semi-bound water and free water. After 60 min of steaming, starch gelatinization and water distribution reached an equilibrium state. The content of amylopectin, the amylose-to-amylopectin ratio, and parameters such as gelatinization temperature, viscosity, breakdown value, and setback value were significantly correlated(P≤0.05). Additionally, the amylose-to-amylopectin ratio was significantly correlated with total free water and total water content(P≤0.05). Steaming induced differences in the material composition of C. kwangsiensis root tubers. Clustering of primary metabolites in the OPLS-DA model was distinct, while secondary metabolites were classified into 9 clusters using the K-means clustering algorithm. Differential terpenoid metabolites such as(-)-α-curcumene were significantly correlated with zerumbone, retinal, and all-trans-retinoic acid(P<0.05). Curcumenol was significantly correlated with isoalantolactone and ursolic acid(P<0.05), while all-trans-retinoic acid was significantly correlated with both zerumbone and retinal(P<0.05). Alpha-tocotrienol exhibited a significant correlation with retinal and all-trans-retinoic acid(P<0.05). Amylose was extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and α-tocotrienol(P<0.05). Amylopectin was significantly correlated with zerumbone(P<0.05) and extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and 9-cis-retinoic acid(P<0.01). The results provide scientific evidence for elucidating the mechanism of quality formation of steamed C. kwangsiensis root tubers as a medicinal material.
Curcuma/chemistry* ; Starch/chemistry* ; Multivariate Analysis ; Water/chemistry* ; Terpenes/analysis* ; Plant Roots/chemistry* ; Plant Tubers/chemistry* ; Drugs, Chinese Herbal/chemistry*

Quality control is a key link in the modernization process of traditional Chinese medicine(TCM). Studies have shown that the effects of active components in TCM depend on not only their chemical composition but also their suitable physical forms and states. The physical phase structures, such as micelles, vesicles, gels, and nanoparticles, can improve the solubility, delivery efficiency, and targeting precision of active components. These structures significantly enhance the pharmacological activity while reducing the toxicity and side effects, demonstrating functional activity surpassing that of active components and highlighting the key effects of "structures" on "functions" of active components. Taking the physical phase structure as a breakthrough point, this paper outlines the common types of TCM physical phase structures. Furthermore, this paper explores how to realize the quality upgrading of TCM through the precise regulation of physical phase structures based on the current applications and potential of TCM physical phase structures in processing to increase the efficacy and reduce the toxicity, compounding and decocting processes, drug delivery systems, and quality control, aiming to provide novel insights for the future quality control of TCM.
Quality Control ; Drugs, Chinese Herbal/standards* ; Medicine, Chinese Traditional/standards* ; Humans ; Drug Delivery Systems

PURPOSE: To methodically assess the effectiveness of augmentative plating (AP) and exchange nailing (EN) in managing nonunion following intramedullary nailing for long bone fractures of the lower extremity. METHODS: PubMed, EMBASE, Web of Science, and the Cochrane Library were searched to gather clinical studies regarding the use of AP and EN techniques in the treatment of nonunion following intramedullary nailing of lower extremity long bones. The search was conducted up until May 2023. The original studies underwent an independent assessment of their quality, a process conducted utilizing the Newcastle-Ottawa scale. Data were retrieved from these studies, and meta-analysis was executed utilizing Review Manager 5.3. RESULTS: This meta-analysis included 8 studies involving 661 participants, with 305 in the AP group and 356 in the EN group. The results of the meta-analysis demonstrated that the AP group exhibited a higher rate of union (odds ratio: 8.61, 95% confidence intervals (CI): 4.12 - 17.99, p < 0.001), shorter union time (standardized mean difference (SMD): -1.08, 95% CI: -1.79 - -0.37, p = 0.003), reduced duration of the surgical procedure (SMD: -0.56, 95% CI: -0.93 - -0.19, p = 0.003), less bleeding (SMD: -1.5, 95% CI: -2.81 - -0.18, p = 0.03), and a lower incidence of complications (relative risk: -0.17, 95% CI: -0.27 - -0.06, p = 0.001). In the subgroup analysis, the time for union in the AP group in nonisthmal and isthmal nonunion of lower extremity long bones was shorter compared to the EN group (nonisthmal SMD: -1.94, 95% CI: -3.28 - -0.61, p < 0.001; isthmal SMD: -1.08, 95% CI: -1.64 - -0.52, p = 0.002). CONCLUSION In the treatment of nonunion in diaphyseal fractures of the long bones in the lower extremity, the AP approach is superior to EN, both intraoperatively (with reduced duration of the surgical procedure and diminished blood loss) and postoperatively (with an elevated union rate, shorter union time, and lower incidence of complications). Specifically, in the management of nonunion of lower extremity long bones with non-isthmal and isthmal intramedullary nails, AP demonstrated shorter union time in comparison to EN.
Humans ; Bone Nails/adverse effects* ; Bone Plates/adverse effects* ; Femoral Fractures/surgery* ; Fracture Fixation, Intramedullary/methods* ; Fractures, Ununited/surgery* ; Lower Extremity/injuries*

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

Triclocarban (TCC) is a broad-spectrum antimicrobial widely used in various personal care products, textiles, and children's toys. TCC has potential reproductive and developmental toxicity in animals. However, little is known regarding the effect of TCC on human sperm function. In this study, an in vitro assay was used to investigate the effects of TCC on normal human spermatozoa and the possible underlying mechanisms involved. Semen from healthy male donors was collected and cultured in complete Biggers, Whitten and Whittingham (BWW) and low-sugar BWW media, followed by treatment with TCC at concentrations of 0, 0.1 µmol l -1 , 1 µmol l -1 , 10 µmol l -1 , and 100 µmol l -1 for 4 h. TCC was found to reduce the sperm total motility and progressive motility. Moreover, the sperm kinematic parameters, straight-line velocity (VSL), average path velocity (VAP), and curvilinear velocity (VCL) were affected in a dose-dependent manner. After treatment with TCC at the lowest effective concentration of 10 µmol l -1 , TCC caused a significant decrease in mitochondrial adenosine triphosphate (ATP) production and mitochondrial membrane potential (MMP) and a significant increase in reactive oxygen species (ROS), similar to the observations with the positive control carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP), suggesting that TCC may decrease sperm motility by affecting the oxidative phosphorylation (OXPHOS) pathway. In a sugar-free and low-sugar BWW culture environment, TCC enhanced the damaging effect on sperm motility and ATP, MMP, and lactate decreased significantly, suggesting that TCC may also affect the glycolytic pathway that supplies energy to spermatozoa. This study demonstrates a possible mechanism of TCC toxicity in spermatozoa involving both the OXPHOS and glycolysis pathways.
Male ; Sperm Motility/drug effects* ; Humans ; Carbanilides/pharmacology* ; Oxidative Phosphorylation/drug effects* ; Glycolysis/drug effects* ; Membrane Potential, Mitochondrial/drug effects* ; Adenosine Triphosphate/metabolism* ; Spermatozoa/metabolism* ; Reactive Oxygen Species/metabolism* ; Mitochondria/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To examine the effectiveness of Chinese medicine (CM) Lianhua Qingwen Granule (LHQW) and Jingyin Gubiao Prescription (JYGB) in asymptomatic or mild patients with Omicron infection in the shelter hospital. METHODS: This single-center retrospective cohort study was conducted in the largest shelter hospital in Shanghai, China, from April 10, 2022 to May 30, 2022. A total of 56,244 asymptomatic and mild Omicron cases were included and divided into 4 groups, i.e., non-administration group (23,702 cases), LHQW group (11,576 cases), JYGB group (12,112 cases), and dual combination of LHQW and JYGB group (8,854 cases). The length of stay (LOS) in the hospital was used to assess the effectiveness of LHQW and JYGB treatment on Omicron infection. RESULTS: Patients aged 41-60 years, with nadir threshold cycle (C_T) value of N gene <25, or those fully vaccinated preferred to receive CM therapy. Before or after propensity score matching (PSM), the multiple linear regression showed that LHQW and JYGB treatment were independent influence factors of LOS (both P<0.001). After PSM, there were significant differences in LOS between the LHQW/JYGB combination and the other groups (P<0.01). The results of factorial design ANOVA proved that the LHQW/JYGB combination therapy synergistically shortened LOS (P=0.032). CONCLUSIONS Patients with a nadir C_T value <25 were more likely to accept CM. The LHQW/JYGB combination therapy could shorten the LOS of Omicron-infected individuals in an isolated environment.
Humans ; Drugs, Chinese Herbal/therapeutic use* ; Male ; Female ; Middle Aged ; Adult ; China/epidemiology* ; Hospitalization ; COVID-19 Drug Treatment ; COVID-19/epidemiology* ; SARS-CoV-2 ; Retrospective Studies ; Treatment Outcome ; Length of Stay ; Young Adult ; Aged